More Fields
Strain Species Genotype
UTK19 C. elegans cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X; utkEx14. Show Description
utkEx14 [mbr-1p::GFP + cwn-1p(1.8kb)::cwn-1 + rol-6(su1006)]. Rollers.
UTK2 C. elegans mbr-1(qa5901) X. Show Description
Culture under normal conditions. Reference: Curr Biol. 2005 Sep 6;15(17):1554-9.
UTK20 C. elegans cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X; utkEx15. Show Description
utkEx15 [mbr-1p::GFP + cwn-1p(5.8kb)::cwn-2 + rol-6(su1006)]. Rollers.
UTK21 C. elegans vang-1(ok1142) mbr-1(qa5901) X. Show Description
UTK3 C. elegans cam-1(ak37) II; mbr-1(qa5901) X; utkEx2. Show Description
utkEx2 [mbr-1p::GFP + rol-6(su1006)]. Rollers.
UTK4 C. elegans cam-1(gm122) II; mbr-1(qa5901) X. Show Description
UTK5 C. elegans cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X. Show Description
UTK6 C. elegans cwn-1(ok546) II; mbr-1(qa5901) X. Show Description
UTK7 C. elegans cwn-2(ok895) IV; mbr-1(qa5901) X. Show Description
UTK8 C. elegans cam-1(gm122) cwn-1(ok546) II; mbr-1(qa5901) X; utkEx3. Show Description
utkEx3 [mbr-1p::GFP + rol-6(su1006)]. Rollers.
UTK9 C. elegans cam-1(gm122) II; cwn-2(ok895) IV; mbr-1(qa5901) X;utkEx4. Show Description
utkEx4 [mbr-1p::GFP + rol-6(su1006)]. Rollers.
UV21 C. elegans him-19(jf6) I. Show Description
Reference: Tang L, et al. Mol Biol Cell. 2010 Mar 15;21(6):885-96.
UV26 C. elegans him-19(tm3538) I. Show Description
Reference: Tang L, et al. Mol Biol Cell. 2010 Mar 15;21(6):885-96.
UV7 C. elegans unc-119(ed3) III; jfIs2. Show Description
jfIs2[pie-promoter::GFP::zhp-3 + unc-119(+)]. Maintain at 15C.
VB1050 C. elegans maa-1(sv37) III. Show Description
VB1336 C. elegans nnt-1(tm358) X. Show Description
Sensitive to oxidative stress.
VB674 C. elegans nnt-1(sv34) X. Show Description
Sensitive to oxidative stress.
VC3622 C. elegans T26A5.8(gk3858) III. Show Description
Homozygous viable. Deletion of 7 bp. Left flanking sequence: AGCCTTCTGCTGACTAATAACTTTCCATTT; Right flanking sequence: GCGGACTTGCACTGGAAATTTTAATTTCTT. See WormBase Variation gk3858 for details.
VF2 C. elegans pcs-1(tm1748) II. Show Description
Hypersensitive to cadmium. Maintain under normal conditions. 588 bp deletion + 3 bp insertion [36918/36919 - AAA - 37506/37507]. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
VH725 C. elegans pha-1(e2123) III; hdEx231. Show Description
hdEx231 [C16C10.10::GFP + pha-1(+)]. Ubiquitous expression of glyoxalase-1::GFP. Maintain at 25 C. Reference: Morcos M et al. (2008) Aging Cell 7(2):260-9.
VJ317 C. elegans erm-1(tm677) I; sDp2 (I;f). Show Description
Animals which have lost the Dp grow up to bagging adults with few progeny. Some of these hatch but die as L1s.
VK1104 C. elegans vkEx1104. Show Description
vkEx1104 [nhx-2p::YFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
VK1241 C. elegans vkEx1241. Show Description
vkEx1241 [nhx-2p::mCherry::lgg-1 + myo-2p::GFP]. Diffuse mCherry expression in intestine. GFP+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
VK1260 C. elegans vkEx1260. Show Description
vkEx1260 [nhx-2p::cpl-1::YFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
VK1870 C. elegans vkEx1870. Show Description
vkEx1870 [nhx-2p::F13D12.6(G166R)::YFP + myo-2p::mCherry]. YFP+ intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
VK1879 C. elegans vkEx1879. Show Description
vkEx1879 [nhx-2p::cpl-1(W32A Y35A)::YFP + myo-2p::mCherry]. YFP+ accumulation in intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
VK1984 C. elegans unc-51(e369) V; vkEx1879. Show Description
vkEx1879 [nhx-2p::cpl-1(W32A Y35A)::YFP + myo-2p::mCherry]. YFP+ accumulation in intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
VK689 C. elegans vkIs689. Show Description
vkIs689 [nhx-2p::sGFP::ATM + myo-2p::mCherry]. Diffuse GFP expression in intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
VK694 C. elegans vkIs694. Show Description
vkIs694 [nhx-2p::sGFP::ATZ + myo-2p::mCherry]. GFP+ intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
VK737 C. elegans vkEx737. Show Description
vkEx737 [hsp-4p::GFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
VL10 C. elegans unc-119(ed3) III; wwEx41. Show Description
wwEx41 [hlh-13::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL1176 C. elegans alh-8(ww48) II. Show Description
Partial lethality on low B12 diet; supplemental vitamin B12 is helpful. Reference: Watson E, et al. Elife. 2016 Jul 6;5.
VL12 C. elegans unc-119(ed3) III; wwEx42. Show Description
wwEx42 [hlh-15::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL13 C. elegans unc-119(ed3) III; wwEx43. Show Description
wwEx43 [hlh-27::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL148 C. elegans unc-119(ed3) III; wwEx23. Show Description
wwEx23 [mir-270p::GFP + unc-119(+)]. Maintain by picking non-Unc.
VL187 C. elegans unc-119(ed3) III; wwEx20. Show Description
wwEx20 [mir-245p::GFP + unc-119(+)]. Maintain by picking non-Unc.
VL188 C. elegans unc-119(ed3) III; wwEx26. Show Description
wwEx26 [mir-42-44p::GFP + unc-119(+)]. Maintain by picking non-Unc.
VL19 C. elegans unc-119(ed3) III; wwEx44. Show Description
wwEx44 [hlh-33::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL2 C. elegans unc-119(ed3) III; wwEx35. Show Description
wwEx35 [hlh-16::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL205 C. elegans unc-119(ed3) III; wwEx28. Show Description
wwEx28 [mir-72p::GFP + unc-119(+)]. Maintain by picking non-Unc.
VL211 C. elegans unc-119(ed3) III; wwEx18. Show Description
wwEx18 [mir-227-80p::GFP + unc-119(+)]. Maintain by picking non-Unc.
VL23 C. elegans wwEx12. Show Description
wwEx12[ZC204.12::GFP + rol-6(su1006)]. Maintain by picking Rollers.
VL3 C. elegans unc-119(ed3) III; wwEx36. Show Description
wwEx36 [hlh-19::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL30 C. elegans unc-119(ed3) III; wwEx45. Show Description
wwEx45 [unc-3::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL33 C. elegans unc-119(ed3) III; wwEx46. Show Description
wwEx46 [lin-22::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL347 C. elegans unc-119(ed3) III; wwEx19. Show Description
wwEx19 [mir-230p::GFP + unc-119(+)]. Maintain by picking non-Unc.
VL353 C. elegans unc-119(ed3) III; wwEx30. Show Description
wwEx30 [mir-57p::GFP + unc-119(+)]. Maintain by picking non-Unc.
VL396 C. elegans unc-119(ed3) III; wwEx29. Show Description
wwEx29 [mir-83p::GFP + unc-119(+)]. Maintain by picking WT.
VL397 C. elegans unc-119(ed3) III; wwEx31. Show Description
wwEx31 [mir-268p::GFP + unc-119(+)]. Maintain by picking WT.
VL4 C. elegans unc-119(ed3) III; wwEx37. Show Description
wwEx37 [ngn-1::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.