syIs812 [srj-26p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASH neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.

syIs815 [nlp-76p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASH neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.

syIs816 [ocr-4p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for OLQ neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.

syEx1708 [dat-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for dopaminergic neurons (CEP, ADE, PDE). syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.

Him.

Defective in male sex drive regulation. Reference: Nat Neurosci. 2012 Dec;15(12):1675-82.

Male leaving assay defective (Las), lethargic, hypereversal. Reference: Barrios, A, et al. Nat Neurosci. 2012 Dec;15(12):1675-82.

Reference: Liu T, et al. J Neurosci. 2007 Jul 4;27(27):7174-82.

Superficially WT.

Superficially WT.

Male mating response defect.

oyIs14 [sra-6::GFP + lin-15(+)].

Slighty Dpy. Slighty Unc. Ventral clear patch due to distal tip cell migration defects. Ectopic expression of AWA neuronal markers.

WT phenotype.

Thermotaxis defective.

ytEx100 [mel-47(3245 bp rescuing fragment) + rol-6(su1006)]. Maintain by picking Rollers. Animals which have lost the transgene look wt but are fully penetrant Mel. Mutant embryos arrest with less than 100 cells.

ytEx209 contains [pRM8 (mel-46+) + pTG96(sur-5::GFP)]. GFP minus worms are Mel or sterile at 25 C (completely penetrant). Strong but not fully penetrant Mel at 15 C. Culture at 20°C or higher in order not to lose the transgene. To start a yt5 homozygous culture transfer several GFP minus worms to 15°C.

ytEx211 contains [pRM8(mel-46+) + pTG96(sur-5::GFP)]. Larval lethal. GFP minus worms die or arrest as L4 larvae.

etIs1 [ric-19p::ric-19::GFP + rol-6(su1006). Egl. Low levels of ric19::GFP fusion protein expression driven by the ric-19 promoter in all neurons except for strong expression in the pharyngeal M2 neurons. Nearly 90% of worms have defects in the distal ends of the pharyngeal M2 neurons.

etIs1 [ric-19p::ric-19::GFP + rol-6(su1006). Low levels of ric19::GFP fusion protein expression driven by the ric-19 promoter in all neurons except for strong expression in the pharyngeal M2 neurons. Nearly 90% of worms have defects in the distal ends of the pharyngeal M2 neurons.

etIs1 [ric-19p::ric-19::GFP + rol-6(su1006). Low levels of ric19::GFP fusion protein expression driven by the ric-19 promoter in all neurons except for strong expression in the pharyngeal M2 neurons. About 30% of worms have defects in the distal ends of the pharyngeal M2 neurons.

sa580 is a G-to-A transition that changes a glycine at position 965 to a glutamate in MIG-6. Reference: Jafari M, et al. (2010) Genetics 186:969-982.

etIs1 [ric-19p::ric-19::GFP + rol-6(su1006). Low levels of ric19::GFP fusion protein expression driven by the ric-19 promoter in all neurons except for strong expression in the pharyngeal M2 neurons.

etIs1 [ric-19p::ric-19::GFP + rol-6(su1006). Low levels of ric19::GFP fusion protein expression driven by the ric-19 promoter in all neurons except for strong expression in the pharyngeal M2 neurons.

Reference: Ohta H, et al. Genetics. 2008 Oct;180(2):785-96.

Dpy. Unc. dpy-3 is epistatic to lon-2.

Unc. Dpy. Rol(ts).

Unc. Dpy. Rol(ts).

vhIs24 [vha-6p::GFP::rab-5 Q78L + Cbr-unc-119(+)].  Large endosomes in the intestinal cells.

Maintain at 15C.  Temperature-sensitive embryonic lethal with defects in embryonic cytokinesis.  Suppressor of the lin-2 Vul phenotype

Dpy, Emb, Lvl, Suppressor of the lin-2 Vul phenotype, large endosomes in coelomocytes

izEx5 [lgg-1p::GFP::lgg-1 + odr-1p::RFP]. Pick RFP+/GFP+ animals to maintain. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

izEx5 [lgg-1p::GFP::lgg-1 + odr-1p::RFP]. Maintain at 15C or 20C. Sterile at 25C. Pick RFP+/GFP+ animals to maintain. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

izEx5 [lgg-1p::GFP::lgg-1 + odr-1p::RFP]. Maintain at 15C or 20C. Sterile at 25C. Pick RFP+/GFP+ animals to maintain. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

vsIs33 [dop-3::RFP] V. gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. Reference: Leung CK, et al. PLoS One. 2013 Apr 29;8(4):e62166.

zfIs18 [mec-4p::ChR2::YFP + lin-15(+)]. Reference: Shipley FB, et al. Front Neural Circuits. 2014 Mar 24;8:28.

zfIs42 [rig-3p::GCaMP3::SL2::mCherry + lin-15(+)]. Reference: Shipley FB, et al. Front Neural Circuits. 2014 Mar 24;8:28.

rrrIs1 [pie-1p::GFP::Histone H2B::cye-1 3'UTR + unc-119(+)]. Slightly Unc.

rrrIs2 contains [pie-1p::GFP::Histone H2B::cye-1 3'UTR (S1mt+deltaS2-3)+ unc-119(+)]. Slightly Unc.

Dpy. Maternal effect temperature sensitive embryonic lethal - leaky. Maintain at 15C. mett-10 was formerly known as let-42.

Slow growth. Abnormal tail.

Hypomorphic allele. Temperature-sensitve Daf-c. Maintain at 15 C. Reference: Gerisch B, Antebi A. Development. 2004 Apr;131(8):1765-76.

ynIs34 [flp-19p::GFP] IV. Him. Transcriptional flp-19 reporter. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Clark SG & Chiu C. Development. 2003 Aug;130(16):3781-94. Kim K & Li C. J Comp Neurol. 2004 Aug 2;475(4):540-50.

jsIs1 [(pSB120) snb-1::GFP + rol-6(su1006)]. Roller Unc.

Large body. Egl.

snt-1(md290) is a 3264-bp deletion removing all coding sequence in exons 3-8. Breakpoints: ttatagatttcaattaaatagtaaacaaaa / / aatctctctttgttttcactcttccaacat. Reference: Nonet ML, et al. Cell. 1993 Jul 2;73(7):1291-305.

snt-1(md220) is a 9-bp deletion in exon 5 removing V312-L314. Breakpoints: ggtacgtcccaactgctggtaaattgacag / / tggaagcaaaaaatcttaagaaaatggacg. Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.

snt-1(md259) is a 2-bp deletion in exon 6A. Breakpoints: tttcattttctggggtaattttcagatcct / / tgtgaagattgtgttgatgcaaggtggaaa. Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.

unc-41(md134) is a 5.9-kb deletion that forms an in-frame splice site in the middle of an exon allowing protein production.