More Fields
Strain Species Genotype
PS9469 C. elegans col-43(sy1782) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-43. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTATGCTGCCGTCTCATTCTCAATTGTGGCCGTTC right flanking sequence: TTTCGGTGGTGCTCACACTACCAATGGTCTACAAT inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTCAATTGTGGCCGTTCTTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616