More Fields
Strain Species Genotype
RG3130 C. elegans col-157(ve630[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
homozygous viable. Deletion of 1753 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: attttgatgattcctcttgcaaatccagac ; Right flanking sequence: gttggcaaaaaaacaatattttttcctgat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.