Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5198 mutation is G->A, flanking sequences AATTAAAAAATGTTTAATACCACCTATTCA and ACAGCAAAAACTACAAAGTCCACGACAACC.

Homozygous viable. Deletion of 5972 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: GTAGTTCCGTTCTGACAGTTCTTTGTTAAG. Right flanking sequence: TGGCGCAACGAGGAACTTGGAGACCTTATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.