More Fields
Strain Species Genotype
JD21 C. elegans cca-1(ad1650) X. Show Description
Slow pharyngeal pumping. Abnormal pharyngeal muscle depolarization.
RB2487 C. elegans cca-1(ok3442) X. Show Description
C54D2.5 Homozygous. Outer Left Sequence: tgaacaactgaacaccgagg. Outer Right Sequence: tcaacggtatggctcaaaca. Inner Left Sequence: tgtgcagcaaatcagaacaa. Inner Right Sequence: gcaaggaagaagaaaagcga. Inner Primer PCR Length: 1264. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC39 C. elegans cca-1(gk30) X. Show Description
C54D2.5. Mildly Unc, slow-moving. External left primer: TCGGAGATGGTGATTCTTCC. External right primer: TGATGGAGTCCGGATAAAGC. Internal left primer: TTGCTTTCTCGCATCCTCTT. Internal right primer: TTCCAAGCTCTGGTGGTTTC. Internal WT amplicon: 1379 bp. Deletion size: 267 bp. Deletion left flank: GCGCCACAAAGTAAAGAGCTGCCCATGGGT. Deletion right flank: CTCGAGATAACTTGAGCGCTGGTACACTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
BC14060 C. elegans dpy-5(e907) I; sEx14060. Show Description
sEx14060 [rCes C54D2.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
AX7884 C. elegans pod-2(syb1772[pod-2::His10]) II; mccc-1(syb1666[mccc-1::His10]) IV; pyc-1(syb1680[pyc-1::His10]) V; pcca-1(syb1626[pcca-1::His10]) X. Show Description
Superficially wild-type. Referred to as MP3-His. Strain can be used to biotinylated carboxylases from worm extracts. AX7884 obtained by crossing parental strains PHX1772 pod-2(syb1772[pod-2::His10]) II, PHX1666 mccc-1(syb1666[mccc-1::His10]) IV, PHX1680 pyc-1(syb1680[pyc-1::His10]) V and PHX1626 pcca-1(syb1626[pcca-1::His10]) X to obtain the quadruple His10-tagged strain. The 5xGlycine(G-linker)-His10 tag is a 45 bp sequence (GGAGGAGGAGGAGGACACCATCACCATCACCACCACCACCACCAC) encoding five glycine as a linker and ten histidine residues was knocked in at the C terminus-just upstream of the termination codon-of each of the four carboxylases. Reference: Artan M, et al. J Biol Chem. 2022 Aug 3:102343. doi: 10.1016/j.jbc.2022.102343. Epub ahead of print. PMID: 35933017.
RB1774 C. elegans pcca-1(ok2282) X. Show Description
F27D9.5. Homozygous. Outer Left Sequence: ACGCTTATTTCCGAGCTTCA. Outer Right Sequence: ACGTAAAGATGGCCGATGAG. Inner Left Sequence: AACAACCTTTTTGCAATGCC. Inner Right Sequence: GAAGCTCCAACTGCCAAATC. Inner Primer PCR Length: 3054 bp. Deletion Size: 1754 bp. Deletion left flank: AAATTTGAGAAACTGCGAATGAAATTATCA. Deletion right flank: CGAGCTTGCTTGTCGTTCCAGGCAACTCGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807