More Fields
Strain Species Genotype
JK3101 C. elegans fbf-2(q738) II. Show Description
Grows well as a homozygote, possibly small percent Fog. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3107 C. elegans fbf-1(ok91) fbf-2(q704)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are non-Dpy with a green pharynx and a WT germ line. fbf-1 fbf-2 homozygotes are non-Dpy, GFP-, and have small germ lines containing only sperm. mIn1[mIs14 dpy-10(e128)] homozygotes are Dpy, GFP+ and have a WT germ line. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3140 C. elegans gon-1(e2551) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. Segegrate Gon worms which are GFP-. nT1[qIs51] homozygotes are inviable. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3172 C. elegans mig-5&cct-1(ok280)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T05C12.6, T05C12.7. Heterozygotes are WT and GFP+ in the pharynx. mIn1[mIs14 dpy-10(e128)] homozygotes are Dpy and GFP+ in the pharynx. Homozygous mig-5&cct-1(ok280) worms arrest at about L2/L3. Strong loss of function for cct-1 and weak for mig-5. mig-5 is a dishelved homologue. External left primer: CGGCCTAAACGTTGATTGTT. External right primer: CAGAGTGAGTCGTGAACCGA. Internal left primer: TAATCCTGAATCCGGACGAG. Internal right primer: TACGAGATTTCGGTCCCTTG. Internal WT amplicon: 3284 bp. Deletion size: 987 bp. Deletion left flank: GCTGCAGTCTGATGTGCATGGCGGCTCCAT. Deletion right flank: TTGGTGTTGTCTATGCTTCAAGAAAATTGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3182 C. elegans gld-3(q730) nos-3(q650)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Heterozygotes are WT and GFP+. mIn1 homozygotes are Dpy and GFP+. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3203 C. elegans puf-7(ok397) IV. Show Description
B0273.2. External left primer: AAGCATACAGGCGCAGAGAT. External right primer: TACCGTATTGTGGTGCGAAA. Internal left primer: AACGGTTGCTCATCTGACTT. Internal right primer: AAAATTGCGTCGATTTTTGG. Internal WT amplicon: 2701 bp. Deletion size: 1751 bp. Deletion left flank: TTAAAACTTCTAATTTAAATAAAAAATATA. Deletion right flank: TATGTCGTTCAGCAAATGATTTCGATTTGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3221 C. elegans sys-1(q736) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT, but frequently sterile when balanced by hT2[qIs48]. q736 is homozygous embryonic lethal. (Approx. 5% of hets are Sterile when balanced by WT.) hT2[qIs48] homozygotes are inviable. q736 is a deletion of sys-1 deleting from nucleotide 1803 to nucleotide 3992 of the genomic sequence (a of start atg is position 1). Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK323 C. elegans qDf3/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
Heterozygotes are WT and grow slowly. Segregates Lon males. Do not grow at 25C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3231 C. elegans puf-8(q725) II. Show Description
Low penetrance (<10%) Mog. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3263 C. elegans gon-14(q686) V. Show Description
Temperature sensitive. At 25C, q686 have 0-2 gonad arms and are sterile. Some are Pvl. The strongest phenotype is a spf-1-like gonad. At 15C, q686 is 100% fertile. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3276 C. elegans hnd-1(q740) X. Show Description
q740 homozygotes throw about 50% gonadogenesis defective worms (can be gonadless or have a single arm gonad). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3297 C. elegans fbl-1(q750) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+ and segregate q750 homozygotes which are GFP- sterile adults, and dead eggs. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3345 C. elegans gld-3(q741)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Heterozygotes are WT with major GFP signal in pharynx. Segregates WT GFP+, Dpy GFP+ (mIn1 homozygotes) and GFP- gld-3 homozygotes. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3363 C. elegans qIs69 V. Show Description
qIs69 [hnd-1::GFP::lacZ + rol-6(su1006)] V. GFP expression in MS, C, and D lineages, then Z1/Z4. Rollers. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3375 C. elegans gld-3(q730)/mIn1 [mIs14 dpy-10(e128)] II; him-5(e1490) V. Show Description
Heterozygotes are WT with major GFP signal in pharynx. Segregates WT GFP+, Dpy GFP+ (mIn1 homozygotes) and GFP- gld-3 homozygotes. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3437 C. elegans him-5(e1490) V; qIs74. Show Description
qIs74 [sys-1p::GFP::pop-1 + unc-119(+)]. Probably on LG X. May have unc-119 in background. Throws 30% males. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3439 C. elegans ehn-3(q766) IV. Show Description
Occasional one-armed gonads. Reference: Mathies et al. (2004) Development 131(17):4333-43. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3447 C. elegans fog-1(q250)/sep-1(e2406) I; fbf-1(ok91) fbf-2(q704)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
To maintain, check individual fertile worms for both Sep and Fog offspring. sep-1 homozygotes are sterile at 20C and 25C (Sterile and Unc at 25C), and mostly normal at 15C. fog-1; fbf-1 fbf-2 homozygotes have small germ lines and are often Muv. Best to maintain at 25C for scoring. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3476 C. elegans ceh-22(q632) sma-1(e30) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. Segregates Sma, GFP- worms which have partially penetrant gonadogenesis defects. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Crosses with this strain generate very few glowing hermaphrodite cross progeny and many glowing male cross progeny. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3501 C. elegans pop-1(q772) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. q772 is embryonic lethal.
JK3528 C. elegans qEx500. Show Description
qEx500 [hs::sys-1 + rol-6(su1006)]. Pick Rollers to maintain. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3695 C. elegans qIs87. Show Description
qIs87 contains [UAS::fkh-6::GFP + rol-6(su1006)]. Rollers. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3743 C. elegans fog-1(q785) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3744 C. elegans qIs89. Show Description
qIs89 [gon-14::gon-14::VENUS + S. cerevisiae DNA]. gon-14::VENUS is broadly expressed in cell nuclei starting at the 50-100 cell stage of embryogenesis and throughout larval development. Partially concentrated in nuclear speckles. qIs89 rescues the 25C Gon and Ste defects of q686. Low penetrance of sterility and lethality in the strain. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3776 C. elegans qIs90. Show Description
qIs90 [ceh-22b::VENUS (pJK1082) + influenza viral DNA]. qIs90 is an integrated complex array; integration site not mapped. ceh-22b::VENUS can be easily identified by its expression in the pharynx. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3791 C. elegans sys-1(q544) I; qIs95 III. Show Description
qIs95 [(sys-1p::Venus::sys-1 + pttx-3::DsRed]. The DsRed marker is very dim and might be difficult to see it under the dissecting scope. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3826 C. elegans mut-16(mg461) I; larp-1(q783) III. Show Description
Slow growing and throw about 10% dead embryos. q783 is a deletion of the first 4 exons on the larp-1 gene. NOTE: this strain is carrying mut-16(mg461) in the background; It is unknown if mg461 is homozygous in this strain. See JK4545 for a replacement larp-1(q783) strain. mut-16 can be detected using primer1 CCCGCCGATACAGAAACTAA, primer 2 AATATTCGATCGGCAAGCAG for genotyping. The wild-type locus will yield a 824bp PCR product, whereas mg461 will yield a 373bp product. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3965 C. elegans fbf-1(ok91) fbf-2(q704)/mIn1 [mIs14 dpy-10(e128)] II; fem-3(e1996)/qIs24 IV. Show Description
qIs24 [lag-2p::GFP]. Maintain by picking individual animals with green DTCs and green pharynx and scoring offspring for Fems and Fbfs. fem-3 is not well balanced by qIs24. fbf-1 fbf-2 homozygotes are germline proliferation defective and make only sperm. fem-3 homozygotes make only oocytes. fbf-1 fbf-3; fem-3 proliferates more than fbf-1 fbf-2 and makes only oocytes; also Muv. qIs24 contains lag-2::GFP; Distal Tip Cells are green; homozygotes are Rollers and heterozygotes Roll weakly. mIn1 is Dpy and GFP+ in the pharynx. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK4087 C. elegans rnp-8(q784) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. rnp-8 homozyotes are GFP- and look like WT. Slow L4 to Adult transition.
JK4099 C. elegans hlh-2(tm1768) I. Show Description
Temperature sensitive sterile. Partially sterile at 20 C; completely sterile at 25 C. Maintain at <20 C. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK4143 C. elegans qIs57 II; rde-1(ne219) V; qIs140. Show Description
qIs57 [lag-2p::GFP] II. qIs140 [lag-2p::rde-1 + rol-6(su1006)]. Rollers. qIs140 rescues rde-1 in lag-2-expressing cells (as tested by GFP RNAi). qIs57 GFP expression in DTCs. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK4307 C. elegans rnp-8(tm2435) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. PCR using 3 primers: primer A: TCA GCC GAC AAT CTC CGA; primer B: GTA CTG ATT GTA TCC ACC GGC; primer C: GCT CAT AGA AAA GCG ATG G. WT band = 0.5 kb; heterozygote bands = 0.8 and 0.5 kb (double bands), tm2435 bands = 0.8 kb.
JK4545 C. elegans larp-1(q783) III. Show Description
Derived by outcrossing JK3826 to remove mut-16 deletion. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK4563 C. elegans gld-1(q126) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Segregates WT GFP+ heterozygotes, non-GFP sterile gld-1 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK4626 C. elegans cku-80(ok861) unc-119(ed3) III; qIs170. Show Description
qIs170 [gld-1p::gld-1::GFP::FLAG + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Jeong J, Verheyden JM, Kimble J. PLoS Genet. 2011 Mar;7(3):e1001348.
JK4842 C. elegans qSi29 II; unc-119(ed3) III. Show Description
qSi29 [sygl-1p(LBSmut)::H2B::GFP::sygl-1 3'end + unc-119(+)]. Superficially wild-type. Expression of H2B::GFP in the loop region of the germline. qSi29 contains 2kb upstream of the sygl-1 start with the four LAG-1 binding sites (LBS) mutated (RTGRGAA->RacRGAA) driving H2B::GFP under the control of the sygl-1 3' intergenic region. Reference: Kerschner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.
JK5072 C. elegans qSi29 II; unc-119(ed3) III; teIs1 IV. Show Description
qSi29 [sygl-1p(LBSmut)::H2B::GFP::sygl-1 3'end + unc-119(+)]. teIs1 [oma-1::GFP + unc-119(+)]. Superficially wild-type. Expression of H2B::GFP in the loop region of the germline. qSi29 contains 2kb upstream of the sygl-1 start with the four LAG-1 binding sites (LBS) mutated (RTGRGAA->RacRGAA) driving H2B::GFP under the control of the sygl-1 3' intergenic region. oma-1::GFP expression in oocyte cytoplasm. teIs1 rescues GFP expression in silenced germline trangenes more effectively at 25C. Reference: Kerschner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.
JK509 C. elegans glp-1(q231) III. Show Description
Temperature sensitive. Sterile at 25C. Fertile at 15C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK551 C. elegans unc-5(e53) fem-3(q22) IV. Show Description
Temperature sensitive. At 25C, XX germline makes only sperm; at 15C, germline makes oocytes and excess sperm. Unc. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK554 C. elegans dpy-17(e164) glp-1(q224) III; unc-1(e1598) X. Show Description
Raise at 15C. Dpy Unc. unc-102(e1598) changed to unc-1(e1598). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK560 C. elegans fog-1(q253) I. Show Description
Temperature sensitive - raise at 15 or 20C. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK574 C. elegans fog-2(q71) V. Show Description
Male-female strain. Maintain by mating. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be used for any commercial purpose or for work on human subjects.
JK633 C. elegans unc-36(e873)/unc-32(e189) glp-1(q46) III. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and UncSteriles and dead eggs. e873 is aka eT1. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK654 C. elegans fem-3(q23) IV. Show Description
Maintain at 15C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK659 C. elegans mog-3(q74)/unc-93(e1500) dpy-17(e164) III. Show Description
Heterozygote. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK726 C. elegans tra-2(q122) II. Show Description
tra-2(q122) is a gain-of-function allele. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK816 C. elegans fem-3(q20) IV. Show Description
Gain of function. Temperature sensitive. XX germline makes only sperm at 25C; XX germline makes oocytes and excess sperm at 15C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK845 C. elegans sog-10(q162) dpy-17(e164) III. Show Description
Dpy. Cold-sensitive Fog phenotype; incompletely penetrant, even at 12C. Low percentage of sterile hermaphrodites with an Ooc phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK860 C. elegans fem-3(q20) IV; fog-2(q71) V. Show Description
Temperature-sensitive. Maintain at 15 C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK867 C. elegans dpy-17(e164) ncl-1(e1865) unc-36(e251) III; qDp3 (III;f). Show Description
Animals which have the Duplication are Dpy. Animals which have lost the Duplication are DpyUncNcl. qDp3 homozygotes are lethal. Maintain by picking Dpy non-Unc. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.