pkIs1275 [gpc-2::GFP + dpy-20(+)]. Reporter construct includes 2.3 kbp of upstream sequence and most of the gpc-2 open reading frame. 2.5 kbp PCR fragment generated with primers gpc2-1 (TCTGCAGCACGACGATAATC, extended with a SphI site) and gpc2-2 (GTCGATTGGGTTCACAAGTG, extended with a BamHI site) into vector pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94.

Lethargic in the absence of stimulation. 1500 bp deletion including the promoter and first three exons of C. elegans rabphilin homolog.

Viable, fertile, with no obvious behavioral or morphological phenotypes. A 1677 bp deletion in the C18H9.7 gene which encodes a C. elegans homolog of the rapysn (vertebrate) gene. The lesion deletes exons 4 through 10, leaving exons 3 and 11 in frame. The deletion junction is cagaagaaaaagttcgctttgaactaaAGAACCTATTGAAAATTCTTACTT. Previously called rap-1.

rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4431. Reference: Dour S and Nonet ML. In preparation.

jsIs682 [rab-3p::GFP::rab-3 + lin-15(+)] III. rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals with GFP::RAB-3 mislocalized to neuronal cell bodies. Presence of jsIs682 makes definitive identification of ok3296 homozygotes much easier. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4337. Reference: Dour S and Nonet ML. In preparation.

Aldicarb resistant. Lethargic Unc - jerky especially in backward movement. Low pumping rate. Molecular lesion for md247 is a 20 bp duplication yielding a frameshift mid-way through the transmembrane domain.

ltIs6 [pIC35; pie-1p::kbp-5::GFP-TEV-STag + unc-119(+)].

ltIs7 [(pIC41) pie-1p::kbp-4::GFP::TEV-STag + unc-119(+)]. [NOTE: Array might be prone to silencing; rescue of unc-119 appears incomplete.]

ltIs9 [pie-1p::kbp-3::GFP::TEV-S Tag + unc-119(+)].

ltIs5 [(pIC36) pie-1p::kbp-1::GFP::TEV-STag + unc-119(+)].

Dyf. Osm. Throws males. Reduced mating efficiency (ME 2-3). Deletion extends over 1610 bp in the intron between exons 3 and 4 and ending 30 bp after the STOP codon (cosmid F02D8 pb 25954-27563 are deleted). Complements dyf-4(m158).

Segregates WT GFP+ heterozygotes, larval-arrested ok600 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. [NOTE: Although ok600 has been reported as a 1085 bp deletion in hsf-1, sequencing of the hsf-1 PCR product revealed only an 877 bp deletion (5'-AAATAAAAATTTCTTAGAAA [877 bp deletion] TGTACATGGGATCCGGTCCA-3'). (Lamitina Lab, 12/17/2012)]

otEx4844 [acr-14p(300bp promoter)::DsRed2 + pha-1(+)]. Maintain by picking DsRed2(+) animals. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.

otIs374 [unc-47p(300bp)::mChopti::unc-54 3'UTR + pha-1(+)]. mChopti is visible under dissecting scope.

otEx4961 [lsy-6(300bp 3')::GFP::unc-54 3'UTR + ttx-3:mCherry]. Maintain by picking animals with mCherry in the AIY neurons.

otEx5016 [lsy-6 300bp 3'::lsy-6p::YFP::unc-54 3'UTR + ttx-3p::mCherry + pha-1(+)]. Maintain at 25C; pick mCherry(+). Some rescued worms do not have ttx-3::mCherry expression.

otEx5018 [lsy-6p::YFP::lsy-6(300bp 3')::unc-54 3'UTR + ttx-3:mCherry + pha-1(+)]. Maintain by picking animals with mCherry in the AIY neurons. Maintain at 25C to select for pha-1(+) array.

otEx5021 [lsy-6(fosmid - delta 300 bp 3')::GFP + ttx-3::mCherry]. Maintain by picking animals with mCherry expression in the AIY neurons.

otEx5022 [lsy-6(fosmid - delta 150 bp 3') + ttx-3::mCherry]. otIs3 [gcy-7p::GFP + lin-15(+)] V. Maintain by picking animals with mCherry expression in the AIY neurons. Fosmid with 150 bp deletion does not rescue ASE asymmetry.

otIs386 [lsy-6(fosmid - delta 150 bp 3')::GFP + ttx-3::mCherry].

otEx4963 [lsy-6p(fosmid delta 150bp downstream)::GFP + ttx-3:mCherry]. Maintain otEx4963 by picking animals with mCherry in the AIY neurons. otIs306 [hsp-16.2::che-1::3xHA + rol-6(su1006)]. Rollers.

otIs437 [unc-3p::rab-3::GFP + ttx-3p::mCherry] V. Reporter contains 558bp upstream of unc-3 start site; marks presynapses of DA/DB class motor neurons innervating muscle and VD motor neurons in dorsal nerve cord. Reference: Kratsios P, et al. Curr Biol. 2015 May 18;25(10):1282-95.

otIs453 [itr-1::GFP::utr-1a 3' UTR + pha-1(+)]. itr-1::GFP reporter contains sequence from 2282bp upstream of exon 2 of itr-1a through end of exon 3, and carrying the utr-1a 3' UTR. Reference: Kratsios P, et al. Elife. 2017 Jul 5;6. pii: e25751. doi: 10.7554/eLife.25751. PMID: 28677525

otIs527 [nlr-1p::GFP::unc-54 3'UTR + pha-1(+)]. Reporter contains 150bp upstream of the nlr-1 start codon. Derived from injection of pMG144; line 4-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.

oyIs14 [sra-6::GFP + lin-15(+)] V. ot820 is an 8bp deletion 15bp from the start of the sax-7S start codon, resulting in a frameshift and sax-7S isoform-specific null allele.

otIs348 [unc-47p::mChopti::unc-54 3'UTR + pha-1(+)] IV. Him. otIs348 contains 300 bp upstream of the unc-47 start codon; derived from injection of pMG92; line 2-16. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.

otIs575 [unc-46p::GFP + pha-1(+)] I. Him. otIs575 contains 234 bp upstream of the unc-46 start codon; derived from injection of pMG117; line 17-2. Integrated in LG I near ceh-8 and ceh-12. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.

otEx5999 [nhr-67(fosmid) + unc-47p::mChopti]. Him. ot795 is lethal after L1 stage; all animals L2 and older should carry the extra-chromosomal array. otEx5999 carries fosmid WRM0613bE08; reporter contains 300 bp upstream of the unc-47 start codon. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.

otEx6001 [nhr-67(fosmid) + unc-47p::GFP]. Him. ot795 is lethal after L1 stage; all animals L2 and older should carry the extra-chromosomal array. otEx6001 carries fosmid WRM0613bE08; reporter contains 300 bp upstream of the unc-47 start codon. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.

Null allele generated by gRNAs targeted to the first and last exons of ceh-14, resulting in a 4061bp deletion from +35 to +4098 relative to the start of the ORF.

otDf1is a deletion obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method removing ceh-41, ceh-21, T26C11.9, and ceh-39. 8968 bp deletion, from position -159 upstream ceh-39 ATG, to +1608 from ATG ceh-41 (+89 from STOP ceh-41).

ot1028 = 80bp deletion on Exon 8 (first exon isoform A - isoform with CUT domains), leading to a frameshift and early stop codon in Exon 8 expected to affect only isoform A. Deletion coordinates: +9069 to +9148. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. ot1028 is molecularly identical to ot1031.

otEx7647 [ttll-9p(500 bp)::GFP + pha-1(+)]. Maintain at 25C to retain array. OLQ neurons are marked with GFP. Can be used to isolate OLQ by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

Null allele of unc-86 generated by gRNAs targeted to the first and last exons, resulting in a 3202 bp deletion from -8 to +3194 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341

Null allele of ceh-14 generated by gRNAs targeted to the first and last exons, resulting in a 4056 bp deletion from +40 to +4096 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341

Null allele of unc-30 generated by gRNAs targeted to the first and last exons, resulting in a 5168 bp deletion from -37 to +5131 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341

CRISPR/Cas9-engineered 1691 bp deletion removing entire hlh-32 locus; similar to syb6773 deletion. Reference: Aguilar GR, et al. bioRxiv 2024.07.12.603289; doi: https://doi.org/10.1101/2024.07.12.603289

otEx8199 [sshk-1p::GFP + pha-1(+)]. Maintain at 25C. 370 bp of promoter directly upstream of sshk-1 fused to GFP. Reference: Aguilar GR, et al. bioRxiv 2024.07.12.603289; doi: https://doi.org/10.1101/2024.07.12.603289

Worms appear WT. 1071 bp deletion removes the entire lsy-6 hairpin and part of the predicted C32C4.3 gene. ASEL takes on ASER gene expression profile.

otIs224 [cat-1(2493bp)::GFP].

Pick wild-type to maintain. Heterozygotes are wild-type and should segregate wild-type heterozygotes, bcl-11 homozygotes (L1 larval arrest with starved appearance), and Dpy Unc homozygotes (Medium Dpy, Shrinker, poor backing). Maintain by picking wild-type and scoring for proper segregation of progeny. bcl-11 homozygotes have weak pharyngeal muscle contractions and pharyngeal lumen fails to open. cu10 is a 555 bp deletion (V:6360921..6361460). Predicted bcl-11 null allele. Reference: Vilimas, Tomas. (2004). Genes regulating ceh-22 and pharyngeal development of Caenorhabditis elegans.. University of Illinois at Chicago. Thesis. https://hdl.handle.net/10027/12060

A 600 bp deletion in the unc-60b coding region. unc-60a is intact. Strong Unc - nearly paralyzed. No UNC-60b protein is detected by western blot. UNC-60a is expressed at normal level.

wgIs140 [sbp-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44.

wgIs506 [xbp-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs563 [cebp-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

wgIs746 [tbp-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

CRISPR/Cas9 engineered 1515 bp deletion of gmap-1; flanking sequences ACCTATCCAAAGCTT and TGCCAAGACATTGAA. Dessication sensitive. Shorter body length. Increased permeability of the cuticle. Reference: Ngale Njume F, et al. iScience. 2022 Oct 14;25(11):105357. doi: 10.1016/j.isci.2022.105357. PMID: 36339267.

ulbEx112 [gmap-1p::gmap-1(cDNA)::SL2::GFP + unc-122p::RFP]. Pick animals with RFP+ expression in coelomocytes to maintain. ulb13 is a CRISPR/Cas9 engineered 1515 bp deletion of gmap-1; flanking sequences ACCTATCCAAAGCTT and TGCCAAGACATTGAA. Expression of exogenous gmap-1 quantifiable via the GFP signal. Reference: Ngale Njume F, et al. iScience. 2022 Oct 14;25(11):105357. doi: 10.1016/j.isci.2022.105357. PMID: 36339267.

Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

Temperature sensitive. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]