Endogenous fzr-1 locus tagged with 3xV5 close to the N-terminus. Insertion site is a few amino acids downstream of start site (...PAN-3xV5-SPA…). Primer sequences to validate the strain: slc316 GCTTTTGCGTGTTCTCCTCA, slc317 TGAATCCTGAGTCATCATCCGAGT, WT product 347 bp, q1290[3xV5::fzr-1] product 485 bp.

qSi422 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site. GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

qSi424 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter and GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

qSi425 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. qSi425 contains engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site, and TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter. GFP is visible in germline nuclei. Derived by targeted modification of FBEb in parental strain JK6690. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in FBEa mutant, no product in wild-type). Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

rajSi50 [gld-1p::GFP::H2B::gld-1 3'UTR + Cbr-unc-119(+)] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. GFP is visible in germline nuclei, low in distal germ cells, increases proximally, strong in oocytes. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa: slc314 GTCACCAAGTACACTTCCAGCAAG / slc311 TGGCAACATGATGTATGGCACA (100 bp band in FBEa wt). FBEb: slc314 GTCACCAAGTACACTTCCAGCAAG / slc304 GGGTTAGCGTTAAGATAACACA (~500 bp band in FBEb wt). References: Theil K, et al. Nature Commun. 2019 Sep 16;10(1):4205. doi: 10.1038/s41467-019-12050-7. PMID: 31527589. Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

GFP and 3xFLAG tags inserted into endogenous ebp-2 locus. No overt phenotypes. GFP fluorescence is observed the tips of growing microtubules. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.

No obvious phenotype. Chromosomal deletion beginning from -42 bp to +1196 bps relative to elt-4 ATG (+20bp insert).

1953 bp deletion. Salt chemotaxis learning defective. Reference: Proc Natl Acad Sci U S A. 2011 May 3;108(18):7589-94.

Chemotaxis abnormality, developmental delay, small brood size.  pe420 is a 22 bp deletion in exon 1.

daf-2(pe2722) is a daf-2c-isoform specific mutation. pe2722 is a CRISPR/Cas9-engineered 41 bp deletion (ggttgatgacgatgatgagcccggcggcaggaggcagtgagcaaca) in daf-2 exon 11.5. Guide RNA sequence: gacgatgaagagcccggcgg. Reference: Nagashima T, et al. PLoS Genet. 2019 Jul 19;15(7):e1008297. PMID: 31323047

Deletion flanking sequence (X: 764793) AGTCAACTACTAAAAAACGT-TTTTTTT-TTTTTTCAAATTCTAGAATAAGTT (X:765504). 667 BP DELETION. 7 T insertion.

Dyf. Osm. Reduced mating efficiency (ME 2-3). Deletion extends over 1610 bp in the intron between exons 3 and 4 and ending 30 bp after the STOP codon (cosmid F02D8 pb 25954-27563 are deleted). Complements dyf-4(m158).

243 bp internal deletion.

Mild locomotory defects, sluggish response to physical stimuli, and reduced thrashing rate. Phenotype more severe than ok3. ok2 is a 1189 bp deletion (III:9519159-9520346) removing amino acids 314-693 and inserting a glutamic acid at the deletion site. Flanking sequence: GACCGACTTCCAACCAGTTACCCAG...ATGTTATGAAGTTCAATCCGGATTGTTTCTC ATCAAATGT.

Mild locomotory defects, sluggish response to physical stimuli, and reduced thrashing rate. Phenotype less severe than ok2. ok3 is a 1047 bp deletion (III:9518654-9519699) and 13 nucleotude insertion (producing two termination codons) resulting in a protein truncated at amino acid 693 plus an inserted glutamic acid. Flanking sequence: GCTCGAGGATGCTGCTCACAAACTGAAAATG...GAATAGTATCCGTGAATAGTATCCG TGAAGATTCTG.

Slightly short and fat as adults. 1376 bp deletion of part of intron 1 through intron 4. Contains an integrated hlh-8::GFP reporter marking the postembryonic M lineage.

760 bp deletion beginnin in exon 3 and ending in exon 4. No strong visible phenotype.

745 bp deletion of cdk-4 from intron I to exon3 removing putative ATP binding domain and catalytic residues. Most homozygous animals arrest at L2 due to absence of most or all postembryonic somatic cell divisions. Some germline proliferation resulting in slightly elongated gonad.

Unc strain which throws Unc and DpyUncs which arrest as early larvae (which live 2 weeks). Maintain by picking Unc.

kasEx149 [oig-1p(2.6kb_del)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 2.6kb cis-regulatory region with 200bp deletion removing predicted LIN-39 binding site upstream of oig-1 was fused to GFP. Expression of oig-1::GFP in GABAergic motor neurons is been abolished; expression was observed specifically in cholinergic motor neurons of the ventral nerve cord. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx151 [oig-1p(2.6kb_del)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 2.6kb cis-regulatory region with 300bp deletion removing predicted LIN-39 binding site upstream of oig-1 was fused to GFP. Expression of oig-1::GFP in GABAergic motor neurons is retained, but eliminates ectopic expression in cholinergic motor neurons of the ventral nerve cord. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx271 [pxd-1::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with pxd-1 genomic region (-2,165 to -1 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.

kasEx273 [cal-2::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with cal-2 genomic region (-3,326 to -1 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.

kasEx275 [lgc-4::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with lgc-4 genomic region (-669 to +1,797 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.

kasEx277 [ldb-1::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with ldb-1 genomic region (+1,063 to +4,393 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.

kasEx279 [nep-21::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with nep-21 genomic region (-3,471 to -865 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.

kasEx281 [D2007.2::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with D2007.2 genomic region (-2,997 to -517 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.

kasEx283 [dmsr-2::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with dmsr-2 genomic region (-3,452 to -1 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.

kasEx284 [ncs-2::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with ncs-2 genomic region (-3,455 to -1 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.

kasEx286 [npr-29::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with npr-29 genomic region (-9,810 to -6,028 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.

kasEx288 [drn-1::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with drn-1 genomic region (-6,346 to -4,825 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.

Abnormal locomotion phenotype. 970 bp deletion.

At 20C heterozygotes segregate WT heterozygotes, Unc unc-34(e566) homozygotes, and Mog ife-3(ok191) homozygotes. At 25C ife-3(ok191) homozygotes are not always Mog, but progeny of the non-Mog homozygotes are embryonic lethal. Deletion of 686 bp from ife-3 removes proximal promoter and all of exon 1. Breakpoint determined by B. Keiper is: taattttcatattttccgct/tatcta/ttatcgattttttccagatg. Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 3; B0348.6); paralog of human eIF4E isoform.

No apparent phenotype. Outcrossed version of RB579. Deletion of 1628 bp removes ife-2 exon 4. Deletion extends into R04A9.3 and removes exons 1 and 2 of unknown gene. IFE-2 protein is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint independently determined by BDK and Vancouver KO Group is AAAACAATTTTCCACTGCT/AA/TTTTTGCAAAGTATTCAATT. Eukaryotic translation initiation factor 4E gene (isoform 2).

C05D9.5 Homozygous. Deletion of 1778 bp removes 1088 bp upstream of start codon and all of exons 1 and 2. IFE-4 is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint determined by BDK is CATCGAGTCGGGACGTGATG/AGTAGTGCAAGACTGATAAA. Eukaryotic translation initiation factor 4E gene (isoform 4).

bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V.  Temperature-sensitive germ cell apoptosis leading to infertility at 25 C. Apoptosing germ cells are decorated by CED-1::GFP in the gonad. Loss of p170 form of IFG-1 (but not p130 IFG-1) confirmed by Western blot. Escaping eggs are fertilized and embryonic lethal. Mos-1 transposon insertion previously described as ifg-1::mos-1(cxP9279) II; confirmed by triple primer PCR with 5’-ACCAAACTGGGCAAACAAAG-3’, 5’-GCTCAATTCGCGCCAAACTATG-3’, and 5’-CTTCCTGAAATTTGGTTTAACAGT-3’. Homozygous ifg-1::mos yields only 444 bp product. Outcrossed heterozygotes yield both 353 bp (wild type ifg-1) and 444 bp products.

bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V.  Resistant to germ cell apoptosis. No apoptosing germ cells are decorated by CED-1::GFP in the gonad. ced-3 deletion confirmed by genomic triple primer PCR with 5’-AGTTCACCGTGACAGCGTCTCTTC-3’, 5’-CGATTACGACTTGAACTGTATCCGA-3’, and 5’-TCTTGTGTAAACGAGATTTGCAATG-3’. Homozygous ced-3(n2452) yields only 1,110 bp product. Outcrossed heterozygotes yield both 1,411 bp (wild type ced-3) and 1,110 bp products. [NOTE: (11-05-2019) A user has reported this strain exhibits temperature-sensitive sterility when raised at 25C.]

Superficially WT. byDf1 completely suppresses the Egl defect of sel-12 mutants. byDf1 derepresses the transcription of hop-1 in the early larval stages. byDf1 is a deletion of 31,069 bases from position 3052 of cosmid F46H6 to position 6698 of cosmid C07A12 with a single A base pair insertion. byDf1 deletes F46H6.2/dgk-2, F46H6.4, F46H6.1/rhi-1, C07A12.5/spr-3 and part of C07A12.7. byDf1 is null for spr-3 by sequence and northern analysis. Deletion can be detected with the primers RB1222 CTT ACT AGT ACT AGC TCG CG and RB1224 CCT GTC CAT AAG TGC AGT CC, which give a product of 1540 bp. This strain may not be used for commercial purposes.

T21C9.2, F32G8.6. Serotonin-deficient by anti-serotonin staining. Bleach hypersensitive. Likely also dopamine-deficient (but not tested). Slightly sickly. External left primer: TTTCTTTTCTTGTTGCGCCT. External right primer: TCGAAAAAGTCTGCTTCGGT. Internal left primer: CGTCTTCCGTTTCTTTTTCG. Internal right primer: TCTTGGAATGTGGGATGTGA. Internal WT amplicon: 2497 bp. Deletion size: 2238 bp. Deletion left flank: CGACTAGATTGATTTCCTTCTGTCCCTTCA. Deletion right flank: CTTGACGGAACAACGCCTCGATCTGATCTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.

Serotonin and dopamine-deficient, bleach hypersensitive, general chemical hypersensitivity, fragile cuticle. 652 bp deletion removes entire first exon. Derived by outcrossing FX773 five times to N2.

Dpy. AQR and PQR migration defects. Body wall muscle defects. etr-1(lq133) is 2 bp deletion frameshift in alternatively-spliced exon 8. Reference: Ochs ME, et al. G3: Genes Genomes, Genetics. 2020 Jul 7;10(7):2365-2376. doi: 10.1534/g3.120.401182. PMID: 32398235

F53C11.8. Homozygous. Outer Left Sequence: AGGCGGAGAAAGTGACTTGA. Outer Right Sequence: CCCCTCACGCAGTGTTTTAT. Inner Left Sequence: TGAAGCAAATTGCAATCCAG. Inner Right Sequence: AACGAAATTGTGATCGGAGG. Inner Primer WT PCR Product: 2317. Deletion size: 1190 bp.

C37E2.5 Deletion size 601 bp.

C37E2.5 Deletion size 786 bp.

xchEx91 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42(F20S/L35P)::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. Control strain for LSD2104. Upon heat shock, non-sticky form of human amyloid beta is expressed and secreted into the extracellular space. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

sma-4(jj278) worms are small, and the mutation can suppress the sma-9(0) loss of M-derived coelomocyte defect. sma-4(jj278) is a true molecular null allele of sma-4; the 3,556 bp deletion (position: Chromosome III: 5,816,203….5,819,759) removes almost the entire coding region of sma-4. Reference: McKillop AN, et al. (2018). A new deletion allele of sma-4. microPublication Biology. https://doi.org/10.17912/Z4Z9-CE10.

vs163 is a 169 bp deletion removing exon 2 and causing frameshift.

Very weak Egl. rgs-1=C05B7.7, a C. elegans RGS (Regulator of G protein Signaling) gene. nr2017 is a presumptive null allele. nr2017 is a 638 bp deletion of sequences whose limits are CGAGAAATTGTCAACACTAAC...GTTTGGAATGGTTTATCAGTT. The deleted material is replaced by the following 35 bp insertion: TATGTTTAAGTTAAGTTTATAGTTTAAGTTTAAAG.

rgs-2=F16H9.1, a C. elegans RGS (Regulator of G protein Signaling) gene. vs17 is a presumptive null allele. vs17 is a 1136 bp deletion of sequences with limits: ATATATATATCTCATTACTGG...AATCAAGTGTAACACTAATAT. rgs-1;rgs-2 double mutants fail to rapidly turn on egg-laying behavior when fed after starvation.