| BAN925 |
C. elegans |
bcl-11(bon172) V/nT1[umnIs49] (IV;V). Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type mKate2+ and segregate wild-type mKate2+, very few non-mKate arrested larvae (bon145 homozygotes mostly Emb), Vul mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type mKate2+. bcl-11(bon172) is a CRISPR/Cas9-engineered deletion causing truncation of BCL-11 lacking ∼196 amino acids and carrying a predicted triple HA sequence (3xHA) at the C terminus. Genotyping primers: Fw GTGAGCTTGCTGAGCCAGCT and Rev CGGGTAAGAGAAGATTGAGCGCAA; bcl-11(bon172): ~250 bp; WT: NO PRODUCT. Reference: Niedworok P, et al. 2026 Jan 7;29(2):114422. doi: 10.1016/j.isci.2025.114422. PMID: 41641102. |
|