H06O01.2 Homozygous. Outer Left Sequence: gggaagattggggaaaagaa. Outer Right Sequence: tgcacaaaaagcttgaacca. Inner Left Sequence: catcgaaaactttcggaatga. Inner Right Sequence: ggctcaccagaagcagtttt. Inner Primer PCR Length: 1197. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y55B1BR.2 Homozygous. Outer Left Sequence: gtggcgtcagagtgtctcaa. Outer Right Sequence: taatcctaaggcaaagccca. Inner Left Sequence: ggtggagagacgcagagttc. Inner Right Sequence: ccaaagcctaagcctgagc. Inner Primer PCR Length: 1323. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02E10.8 Homozygous. Outer Left Sequence: gcatcacatggaagccctat. Outer Right Sequence: tcccgaagatgaccacaaat. Inner Left Sequence: tccgcaagtttccagaaaag. Inner Right Sequence: atacgcgccacaaatcaact. Inner Primer PCR Length: 1249. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40D4.1 Homozygous. Outer Left Sequence: gcaattcattccgctctttc. Outer Right Sequence: tagtcgagcacatgagtggc. Inner Left Sequence: cggacagcagaagctcactt. Inner Right Sequence: acgatacggtgtatgcacga. Inner Primer PCR Length: 1133. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6G.2 Homozygous. Outer Left Sequence: cccatacgtactcggagcat. Outer Right Sequence: aatagctctgcaccggaaga. Inner Left Sequence: cttccagcacgaagaagcat. Inner Right Sequence: tgcaacgagaagatcgagtg. Inner Primer PCR Length: 1136. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27E9.4 Homozygous. Outer Left Sequence: gaatgttcgcatctgacgtg. Outer Right Sequence: cgcagcgacatacacttgtt. Inner Left Sequence: attgcgaaaatccccctcta. Inner Right Sequence: aatctttaaaggcgcacacg. Inner Primer PCR Length: 1148. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01A2.11 Homozygous. Outer Left Sequence: ccgtccaaatcgaattccta. Outer Right Sequence: agacgaagagttcggggaat. Inner Left Sequence: tcccagctatgggagcttta. Inner Right Sequence: taccatgtcacgcgatgttt. Inner Primer PCR Length: 1123. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01G10.8 Homozygous. Outer Left Sequence:ccaaccgacttccttgttgt . Outer Right Sequence: attcgttcatcagccacctc. Inner Left Sequence: ggctgcggggaattatatgt. Inner Right Sequence: tccgagagccaatgttttct. Inner Primer PCR Length: 1192. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06A12.4 Homozygous. Outer Left Sequence: tcgccttgtttactgcctct. Outer Right Sequence: cgctactgcgaacgagtttt. Inner Left Sequence: ctggttggcagttttccagt. Inner Right Sequence: aaacgtttttgttccctttgaa. Inner Primer PCR Length: 1277. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F39B2.7 Homozygous. Outer Left Sequence: acgttttgacagaaatcggg. Outer Right Sequence: tgacgtcattgaggcagaag. Inner Left Sequence: ggcactggaaaagagacaaga. Inner Right Sequence: acgtgctcaaaaacgaatcc. Inner Primer PCR Length: 1228. Estimated Deletion Size: about 200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y105C5B.12 Homozygous. Outer Left Sequence: cattgtgtccaaagtgtccg. Outer Right Sequence: ctgatttctggctctacggg. Inner Left Sequence: gcggttggttcataaattgg. Inner Right Sequence: ggtgagatcacctcgaaagc. Inner Primer PCR Length: 1118. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40F12.7 Homozygous. Outer Left Sequence: aggcaaaccataagcctgaa. Outer Right Sequence: catctttgattttcccgcat. Inner Left Sequence: tggtttttgcattttcaacc. Inner Right Sequence: aaaacactggatccgcattg. Inner Primer PCR Length: 1232. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R03A10.6 Homozygous. Outer Left Sequence: gtcggacgcacagctaagtt. Outer Right Sequence: ggccccaaactacaaacaaa. Inner Left Sequence: gtccgacaatttttgggttc. Inner Right Sequence: aagcatgctccttcttctcg. Inner Primer PCR Length: 1179. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09E5.4 Homozygous. Outer Left Sequence: acatgttgtgcagcattggt. Outer Right Sequence: gcaaagatatcgtggctggt. Inner Left Sequence: gcgacctacggcaaaattag. Inner Right Sequence: gcaacagaaaccattctagcac. Inner Primer PCR Length: 1264. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y73B3B.2 Homozygous. Outer Left Sequence: tgaaaacgtgctcgtacacc. Outer Right Sequence: atgactacggtagatggcgg. Inner Left Sequence: tcgtgcaaagtttgagcatt. Inner Right Sequence: ggaccgaaacatttttgcat. Inner Primer PCR Length: 1130. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46G5A.35 Homozygous. Outer Left Sequence: cttcaggaatcggtttcagc. Outer Right Sequence: agaagccgaagagaaaagcc. Inner Left Sequence: taatctcctcctcagccgtc. Inner Right Sequence: cacatgaagcgtcttcggta. Inner Primer PCR Length: 1314. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807