More Fields
Strain Species Genotype
RB1830 C. elegans C37E2.1(ok2368) X. Show Description
C37E2.1. Homozygous. Outer Left Sequence: TTGGGTTCGTGATTTGTTGA. Outer Right Sequence: CCAAGACCACCGAAACAACT. Inner Left Sequence: ACAAGTTCTGGTGGGGATTG. Inner Right Sequence: AATTTCACAGCTGGCCATTC. Inner Primer PCR Length: 2507 bp. Deletion Size: 1441 bp. Deletion left flank: TACGGAACTTGTCAATGACGGCATCAGCAA. Deletion right flank: GAGCCTCATGTTCAGACCCTGAAGTTCTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1831 C. elegans set-22(ok2370) V. Show Description
Y32F6A.1. Homozygous. Outer Left Sequence: CAATCAAAATGAGTTCGGCA. Outer Right Sequence: TCCTCAACTGATAGACGGGC. Inner Left Sequence: AAATTGGCAACAGACTCAAAAA. Inner Right Sequence: TCTCGATTGAAATTCCCGAG. Inner Primer PCR Length: 3158 bp. Deletion Size: 1483 bp. Deletion left flank: CAACAATGTCTCTTGAGAATTCAAAAATCT. Deletion right flank: AAGATATTTAAATACTTTTAAAACTTTTTA. Insertion Sequence: ATATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1832 C. elegans acc-4(ok2371) III. Show Description
T27E9.9 Homozygous. Outer Left Sequence: cgtcctcgccattctcttag. Outer Right Sequence: tttcgccaaaattatctccg. Inner Left Sequence: atccgaggacacagatttgg. Inner Right Sequence: tggccttcgttgtcttcttt. Inner Primer PCR Length: 3018. Deletion size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1833 C. elegans K10B3.5(ok2372) X. Show Description
K10B3.5 Homozygous. Outer Left Sequence: aaagccgttcatgtcaaacc. Outer Right Sequence: acgagagaagacatgggacg. Inner Left Sequence: gagtagtgtgagctgctgcg. Inner Right Sequence: ggtgttccttctcaaatggc. Inner Primer PCR Length: 3221. Deletion size: about 2600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1834 C. elegans che-7(ok2373) V. Show Description
F26D11.10. Homozygous. Outer Left Sequence: AAAATTCGTCCGAGTCGTTG. Outer Right Sequence: GAGCAGTGGCTCTTTGCTCT. Inner Left Sequence: TGATTCTGGCCATCAGAATTT. Inner Right Sequence: GGGGCACAAAAATGAGAGAA. Inner Primer PCR Length: 3059 bp. Deletion Size: 1496 bp. Deletion left flank: TGCCCACGTACATTATTTTTGTCGCCTGAA. Deletion right flank: GCACTGCCATCATAATAAGAAACGATGATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1835 C. elegans F41D9.1(ok2374) X. Show Description
F41D9.1 Homozygous. Outer Left Sequence: tcgtgctccactctcatttg. Outer Right Sequence: gttgaaccgatcggaagaga. Inner Left Sequence: aagaaaggtgagcgctgtgt. Inner Right Sequence: gccttgtggcctaatggata. Inner Primer PCR Length: 3251. Deletion size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1836 C. elegans W05B5.2(ok2375) I. Show Description
W05B5.2 Homozygous. Outer Left Sequence: acgttaagaaaccgcctttg. Outer Right Sequence: cggaatcgtcctgaaatgtt. Inner Left Sequence: aagtctccaccaatgcaaaa. Inner Right Sequence: ttctttcttttatttttcggtttca. Inner Primer PCR Length: 3143. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1837 C. elegans C54A12.2(ok2376) II. Show Description
C54A12.2. Homozygous. Outer Left Sequence: AGGCTACCGTGTCGGTATTG. Outer Right Sequence: TCAGTCGGCAACGTATGAAA. Inner Left Sequence: GAAAAATGTTGAGGCGGTGT. Inner Right Sequence: ATCTTTGGCATGTTTGGCTC. Inner Primer PCR Length: 2721 bp. Deletion Size: 1540 bp. Deletion left flank: TCCCACTTCCTTCTGCAATAACCTTAACAC. Deletion right flank: CAGAGAATGCAATTTGATAATGATGGTTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1839 C. elegans C18H2.2(ok2379) III. Show Description
C18H2.2. Homozygous. Outer Left Sequence: AAGTTGGAACCTTGGAGCCT. Outer Right Sequence: ACAGCGTCGTTGAAAGATCA. Inner Left Sequence: AACTGCTCCCATGTGACCTAA. Inner Right Sequence: CACTTCTGAAAATTCCACCGA. Inner Primer PCR Length: 3037 bp. Deletion Size: 1531 bp. Deletion left flank: TATTTTTCGTGTAACAATCTATTTTTCGTGGAACAATCTATTTTTCGTGTAACAATCTA TTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATT TTTC. Deletion right flank: ATCATCTTTGGATGTGACCAGCGCTGAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1840 C. elegans M28.8(ok2380) II. Show Description
M28.8. Homozygous. Outer Left Sequence: AACTCCAGCTCGCAATGAAT. Outer Right Sequence: GCCAAGGTTTGCAAGTTTGT. Inner Left Sequence: TGTGCTCAGTATTCGGGATCT. Inner Right Sequence: ACAAACCGACAGATTTGCCT. Inner Primer PCR Length: 3039 bp. Deletion Size: 2145 bp. Deletion left flank: TGAACCTCTTTGTTTGTTCTTATCAATTTA. Deletion right flank: TTAATATCGGGTAAGACAAATTAGTGTGAT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1841 C. elegans Y32G9A.8(ok2383) V. Show Description
Y32G9A.8 Homozygous. Outer Left Sequence: gcacagggaactggtttgtt. Outer Right Sequence: ggtaccgtctttttgggaca. Inner Left Sequence: gtcctcttcttgggctcctt. Inner Right Sequence: cagccaaaaatacactgcga. Inner Primer PCR Length: 2685. Deletion size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1842 C. elegans Y54E10A.3(ok2384) I. Show Description
Y54E10A.3. Homozygous. Outer Left Sequence: CACCATGCCAGTTATCAACG. Outer Right Sequence: CCGAAAAATTGTTTTGCAGC. Inner Left Sequence: TCGATTTCACTGCAGTCTGG. Inner Right Sequence: TGACATATTTCAACGCGACG. Inner Primer PCR Length: 2527 bp. Deletion Size: 1157 bp. Deletion left flank: TTCTGACAATAAAATAAACTTTATTTTTTA. Deletion right flank: TTAGAAAATATCCGAAAAAAATATCCGCCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1843 C. elegans lin-42(ok2385) II. Show Description
F47F6.1. Homozygous. Outer Left Sequence: CGGTTACGCATTGAAAGACA. Outer Right Sequence: AGTCCCTTTTGCCTGGATCT. Inner Left Sequence: TTTTGCAGGAAACGTAAAGGA. Inner Right Sequence: AGGGGCCTGATCCTAAGAAA. Inner Primer PCR Length: 3109 bp. Deletion Size: 2632 bp. Deletion left flank: CCGGGTTCAGGCCCATATAGGCCTATAGGC. Deletion right flank: ACGGGGGGCTACCCGGCTGGGTGGGAAGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1844 C. elegans F56C9.5(ok2386) III. Show Description
F56C9.5 Homozygous. Outer Left Sequence: tgaccgttttccaaaacaca. Outer Right Sequence: caaaatcgggcgtactcatt. Inner Left Sequence: atttcgacggtttacttgcg. Inner Right Sequence: cagccatacttcccaatcgt. Inner Primer PCR Length: 2278. Deletion size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1845 C. elegans dod-17(ok2387) IV. Show Description
K10D11.1. Homozygous. Outer Left Sequence: GTGCAAAGACCACCGATTTT. Outer Right Sequence: CTTGAGAGCGCCTTTCACTC. Inner Left Sequence: GACAAAACGCCCAGTTTCAT. Inner Right Sequence: CTTTGCTTCTATGTCGGCGT. Inner Primer PCR Length: 2109 bp. Deletion Size: 1489 bp. Deletion left flank: TTCATCTGTCTAGCGTTTGCTACTGCAATT. Deletion right flank: AATCGATGAGATGGTGGAACTCCGGCCGCA. Insertion Sequence: CGATGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1846 C. elegans C30G12.6(ok2389) II. Show Description
C30G12.6. Homozygous. Outer Left Sequence: TTCATGGGAACACACTCCAA. Outer Right Sequence: CAGGGATCTCACTAGCCCAA. Inner Left Sequence: AACACGTGACGAATGATCCA. Inner Right Sequence: AAACCGTTTTCGCACAAATC. Inner Primer PCR Length: 3210 bp. Deletion Size: 1408 bp. Deletion left flank: TCATTCTTATTCCCTAAAAGAGCTGGAATG. Deletion right flank: TCACAGTTACTTCATCACAACATGTGGTTT. Insertion Sequence: TGTTACTTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1847 C. elegans Y76G2A(ok2390) I. Show Description
Y76G2A. Homozygous. Outer Left Sequence: CATACGCAAACGCCAAAGTA. Outer Right Sequence: CGGATGCTCTATTTGGGAAA. Inner Left Sequence: GGATACAAGGAACAGGCAGC. Inner Right Sequence: GTGAGCTTCTGTGATCCCGT. Inner Primer PCR Length: 2243 bp. Deletion Size: 833 bp. Deletion left flank: GCTGAAGGATCAGAACATCAGGAAGAGCCT. Deletion right flank: AAAACTTAAGTCAGGTGGAAAAATATTTTC. Insertion Sequence: TTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1848 C. elegans F19C6.4(ok2392) X. Show Description
F19C6.4. Homozygous. Outer Left Sequence: AACATTCTGTCCCCTATGCG. Outer Right Sequence: AACCGTACAAAAAGCATGGC. Inner Left Sequence: CAGCCATACAGCGTTTTGAA. Inner Right Sequence: GCCTACGGAGCAGAAGATTG. Inner Primer PCR Length: 3163 bp. Deletion Size: 1030 bp. Deletion left flank: AAGCGATAATACTCCGTTTCATATACCAGT. Deletion right flank: ATATTAGAGGAGTTTTTTGGGTTGAAAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1849 C. elegans C43E11.11(ok2393) I. Show Description
C43E11.11. Homozygous. Outer Left Sequence: TCAGATGCCCAAAGATGTGA. Outer Right Sequence: CTTCGGTGCTTAACGAGGTC. Inner Left Sequence: CGGAGATCACATCGGAGATT. Inner Right Sequence: GGGCTTTTTCTGCAGTCATC. Inner Primer PCR Length: 3346 bp. Deletion Size: 1230 bp. Deletion left flank: TTCCGAAAACCCGAGAAAACGATGACGATA. Deletion right flank: TTTAAATTTATTTATTTAACTTGTCTAACT. Insertion Sequence: AATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1850 C. elegans C44C8.6(ok2394) IV. Show Description
C44C8.6 Homozygous. Outer Left Sequence: gctcaaaatttcggcacatt. Outer Right Sequence: accggactagctccaccttt. Inner Left Sequence: actctgtgccaccaaaaacc. Inner Right Sequence: catatccgtccattgttccc. Inner Primer PCR Length: 2719. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1851 C. elegans hpr-9(ok2396) III. Show Description
Y39A1A.23 Homozygous. Outer Left Sequence: aaattcgctgaaatcatggc. Outer Right Sequence: gttgggtttttgatgtgcct. Inner Left Sequence: aatcgaaaaaccgacaccct. Inner Right Sequence: cctccaactttccgacaaga. Inner Primer PCR Length: 2639. Deletion size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1853 C. elegans dos-1(ok2398) III. Show Description
ZK507.4. Homozygous. Outer Left Sequence: CGCCGACTTCATCATTCTCT. Outer Right Sequence: AAAGGCACAGCACATTACCC. Inner Left Sequence: TATCTGCGTGACGGTTTTTG. Inner Right Sequence: GAGCGCGTCTTTAAAGGGTA. Inner Primer PCR Length: 2244 bp. Deletion Size: 1674 bp. Deletion left flank: TCGTTTGAATCCCACCATTCAGAACCCAGG. Deletion right flank: AAAGAAATCGCAAAAGACGCACCCCAATCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1854 C. elegans sms-1(ok2399) IV. Show Description
H21P03.3. Homozygous. Outer Left Sequence: TGAAAACAATGGCCAGATCA. Outer Right Sequence: TTCGTCTCGTCGAATCTGTG. Inner Left Sequence: ACGAGCACAAGTGTGTGTCC. Inner Right Sequence: TGATAAACCAGCAAGTCCCC. Inner Primer PCR Length: 1168 bp. Deletion Size: 620 bp. Deletion left flank: GAGAATTGATCCAATGAAACAGAGACGACG. Deletion right flank: GGTCAAATTTTAAAGCAAATTTTCGAAAAA. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1855 C. elegans B0213.15(ok2401) V. Show Description
B0213.15 Homozygous. Outer Left Sequence: ggagaaaagcgtggtctctg. Outer Right Sequence: tttccgaaaaatcgaacagg. Inner Left Sequence: tagtgcaaacggagttggtg. Inner Right Sequence: tactgagaagaccgccgagt. Inner Primer PCR Length: 2540. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1856 C. elegans B0213.15(ok2402) V. Show Description
B0213.15 Homozygous. Outer Left Sequence: ggagaaaagcgtggtctctg. Outer Right Sequence: tttccgaaaaatcgaacagg. Inner Left Sequence: tagtgcaaacggagttggtg. Inner Right Sequence: tactgagaagaccgccgagt. Inner Primer PCR Length: 2540. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1857 C. elegans B0213.15(ok2403) V. Show Description
B0213.15 Homozygous. Outer Left Sequence: ggagaaaagcgtggtctctg. Outer Right Sequence: tttccgaaaaatcgaacagg. Inner Left Sequence: tagtgcaaacggagttggtg. Inner Right Sequence: tactgagaagaccgccgagt. Inner Primer PCR Length: 2540. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1858 C. elegans ifd-1(ok2404) X. Show Description
R04E5.10. Homozygous. Outer Left Sequence: AGAATGCTTGAAAGCCGAGA. Outer Right Sequence: ACTACGGAAGGGCATGTGAC. Inner Left Sequence: CGACCGAAAATGTACCAACA. Inner Right Sequence: TTGCGGTAAACTCTGATCCC. Inner Primer PCR Length: 3151 bp. Deletion Size: 1863 bp. Deletion left flank: AATATCATGGTATAGCACTTTAAAAACTTT. Deletion right flank: ATTTTAAAAAAAGCAAATTAAAAACTAATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1859 C. elegans B0391.5(ok2405) V. Show Description
B0391.5 Homozygous. Outer Left Sequence: aagaccttcccgatttcgat. Outer Right Sequence: ccagcccatagtttccaaga. Inner Left Sequence: caattccggctcgaaataaa. Inner Right Sequence: cctgctctgcttggaatagg. Inner Primer PCR Length: 3191. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1860 C. elegans F35A5.1(ok2406) X. Show Description
F35A5.1. Homozygous. Outer Left Sequence: AACCACCGAAACCAACAGAG. Outer Right Sequence: CGCCGTGAGGATGATAAGTT. Inner Left Sequence: ACTCCCAAACCGAAGGAAGT. Inner Right Sequence: TTCTGATCAATTTCCCGAGG. Inner Primer PCR Length: 2698 bp. Deletion Size: 2012 bp. Deletion left flank: AGCTGATTCTCTTGGTGGACCTAAGCCAAA. Deletion right flank: CAAACTGCGGCTTTAATTACACAGGAAGGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1861 C. elegans arl-5(ok2407) III. Show Description
ZK632.8. Homozygous. Outer Left Sequence: GACAAGTCATTCCGCGATTT. Outer Right Sequence: TCGTCCAACAAATGATCGAA. Inner Left Sequence: GTTGCACCGCTAAACCCTAA. Inner Right Sequence: GCCAGAAGAAAGTGAGCCAG. Inner Primer PCR Length: 2126 bp. Deletion Size: 1199 bp. Deletion left flank: TCTTCCCGTTCTTTTTTATTCAAACTTATG. Deletion right flank: ATATTAAAATTAAAATTATTTTCAGTTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1862 C. elegans F07G6.2(ok2408) X. Show Description
F07G6.2. Homozygous. Outer Left Sequence: AGTATGCTAGCCCGGAAGGT. Outer Right Sequence: GTCTCAGCAAAACCAGGGAG. Inner Left Sequence: TGCGCTGTTTAGAATTGTGC. Inner Right Sequence: CGATGTTTGGGTGTCACATT. Inner Primer PCR Length: 3052 bp. Deletion Size: 1625 bp. Deletion left flank: ATTTTTGCCGACATTAGTTTAAAAAATTAA. Deletion right flank: GTGCTAGGACGTAGCGCTTTCATGCAGGCG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1863 C. elegans flp-12(ok2409) X. Show Description
C05E11.8. Homozygous. Outer Left Sequence: AATCAAAACGCAATTTTCGG. Outer Right Sequence: AGGGGAGGACCATCATTAGG. Inner Left Sequence: AAAATTGCAATAAACACGGGA. Inner Right Sequence: CTTGGTCGGCACATAAGCTC. Inner Primer PCR Length: 1155 bp. Deletion Size: 564 bp. Deletion left flank: AGCTTTTATAAATATCAGCCTAAATTTGGC. Deletion right flank: GGGTTTTCTTGCTGGGCCCCATAAGACGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1864 C. elegans msh-2(ok2410) I. Show Description
H26D21.2. Homozygous. Outer Left Sequence: ACCATTTTGGCAACTTGGAG. Outer Right Sequence: GCGAAACCAATTCACCGTAT. Inner Left Sequence: CAACTCCCTCGAAAACCTTG. Inner Right Sequence: TCCCTGCAGGACCATTTTAC. Inner Primer PCR Length: 3099 bp. Deletion Size: 1300 bp. Deletion left flank: AATTAGTTACCTTCAAAGTGACTCGGAAAT. Deletion right flank: CCCTGTTCACTCGAGTATAGCTCAACGGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1865 C. elegans hum-6(ok2411) X. Show Description
T10H10.1. Homozygous. Outer Left Sequence: GGGGAACGAAACCCATTAGT. Outer Right Sequence: TGGAAAACTGAACTCGAGCA. Inner Left Sequence: TCAAAACCGAAAGAGCACAA. Inner Right Sequence: GCTCTCGATCATCAACCACA. Inner Primer PCR Length: 3314 bp. Deletion Size: 1767 bp. Deletion left flank: CACCCCTACCTGTACCACACCACAGCTTCG. Deletion right flank: GGTTTAGTCTGTATATTGCACTTTTTGATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1866 C. elegans F01G12.2(ok2412) X. Show Description
F01G12.2 Homozygous. Outer Left Sequence: ggagctggagtggaaatgaa. Outer Right Sequence: ccgcctgctcatctatcttc. Inner Left Sequence: cgcaacggaatatccttttt. Inner Right Sequence: tcgctacccttgatattcgc. Inner Primer PCR Length: 1284. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1867 C. elegans C10H11.1(ok2413) I. Show Description
C10H11.1. Homozygous. Outer Left Sequence: GCGCCGAAAAAGTACAAAAA. Outer Right Sequence: AGTAATGACGGTTTCACCGC. Inner Left Sequence: TTGTGCAGGAGAAACGTGAG. Inner Right Sequence: TGCATCGTTCTGTTTCCAAG. Inner Primer PCR Length: 3296 bp. Deletion Size: 2472 bp. Deletion left flank: GGATCGAAGAATGTCGATGTGAGACTTGTA. Deletion right flank: GTTGTGTACAAAGGAGCAGAACCTGAGCAG. Insertion Sequence: CT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1868 C. elegans hum-8(ok2414) IV. Show Description
Y66H1A.6. Homozygous. Outer Left Sequence: AATTTTCGGCAATCGACACT. Outer Right Sequence: GATGCATTTGAATGAGGCAA. Inner Left Sequence: TTGACGGAATTCCCAAAAAT. Inner Right Sequence: CTCACCACAATGGCCAAATA. Inner Primer PCR Length: 3122 bp. Deletion Size: 1206 bp. Deletion left flank: AAAGTCCATTTCCTTTCAATTCAAATAACT. Deletion right flank: AATGTCTCGAAAACGGTTTAAAAGAGTAAA. Insertion Sequence: TTTTCCTTTCAATTTCAAATAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1869 C. elegans W06B11.1(ok2415) X. Show Description
W06B11.1. Homozygous. Outer Left Sequence: AAAACGATATTGGGCTGTGG. Outer Right Sequence: GCATCGGTTTTCAGTGGAAT. Inner Left Sequence: AGATTGCCTGGGTGAAATGT. Inner Right Sequence: AGCCTATGCACAGAGCTGGT. Inner Primer PCR Length: 3070 bp. Deletion Size: 1660 bp. Deletion left flank: TTTAAAATGTTTGTTTTTTTGTAAATTGAT. Deletion right flank: TTATTTCAGTCTTTGGATGCCAAATTATAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1870 C. elegans clec-49(ok2416) V. Show Description
W04D12.6. Homozygous. Outer Left Sequence: ACAGGAACCCCCTGAAAAAT. Outer Right Sequence: TACATCAACTGGGCACCAAA. Inner Left Sequence: AAACCGGAAAATCCTAAGCC. Inner Right Sequence: AATCCGGGAAAGGAAAATTG. Inner Primer PCR Length: 3163 bp. Deletion Size: 1614 bp. Deletion left flank: CGGGTTTTCAATTTCGTGATGTCATTGAAT. Deletion right flank: CCGGCAAATTGGCAAATTGCCGGAATTGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1871 C. elegans stn-2(ok2417) X. Show Description
F27D9.8. Homozygous. Outer Left Sequence: ATTACGGCAAACAGAAACCG. Outer Right Sequence: CCCCTCTGGGAAATAGGAAC. Inner Left Sequence: TTGACTCATCGCGTGTCTTT. Inner Right Sequence: CGAATGAGCGTTCATAGCAA. Inner Primer PCR Length: 3180 bp. Deletion Size: 1569 bp. Deletion left flank: CGGTTCGGTAATATGCTTGCTCAAAAAGTT. Deletion right flank: TTGTTTCTACTCATGTTTCTTCGTCCTTTT. Insertion Sequence: TTGTTAAAGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1872 C. elegans C27A2.1(ok2421) II. Show Description
C27A2.1. Homozygous. Outer Left Sequence: ATGCAACGTGCTAAAGCAAA. Outer Right Sequence: GTGGTTCCATTCCACATTCC. Inner Left Sequence: AAGCTCGAGCGAGACTTCAG. Inner Right Sequence: ACATCTGAATGGAACTGGGC. Inner Primer PCR Length: 3285 bp. Deletion Size: 2424 bp. Deletion left flank: AAATAATATTTATTTTTGTTGAAAAATTAG. Deletion right flank: TTGAAAACCGTGCACGTATCCACGATAAAC. Insertion Sequence: CTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1875 C. elegans Y65B4A.3(ok2425) I. Show Description
Y65B4A.3. Homozygous. Outer Left Sequence: ACCTCCTCAGACGACTCGAA. Outer Right Sequence: GAGCGCGAAAATTCAAAGAG. Inner Left Sequence: GTCGCCATATCGTCGTTTTT. Inner Right Sequence: CCGATTTTAGAGGAAGACCAGA. Inner Primer PCR Length: 3213 bp. Deletion Size: 1830 bp. Deletion left flank: CATGGTTTCCGACTGTTTTTCCTGTTAAAT. Deletion right flank: TTTTTTCCACATGTGTGGATCTCAATTTAT. Insertion Sequence: GTTAAAAAATGTATGAAAAAAAATTTTAAAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1877 C. elegans Y44A6D.3(ok2427) V. Show Description
Y44A6D.3. Homozygous. Outer Left Sequence: AGGTGTTCCACCAGCACAAT. Outer Right Sequence: TGCCGTGCTTCTATCTTCCT. Inner Left Sequence: TCTCTCATCTTTCGCTTCACC. Inner Right Sequence: CAACTCTTAAGCCACAAAACTGT. Inner Primer PCR Length: 3141 bp. Deletion Size: 1471 bp. Deletion left flank: ATTCTGATGGAAATGACTAGAAGGCAAGGC. Deletion right flank: ATTGATGTGCCTGAAATTTGAAAAAAATGT. Insertion Sequence: TTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1878 C. elegans ptp-3(ok2428) II. Show Description
C09D8.1 Homozygous. NOTE: C09D8.1 used to be ptp-1; ptp-1 is now C48D5.2. Outer Left Sequence: aaatccgttgagcaaacacc. Outer Right Sequence: gtccttctcgattttcagcg. Inner Left Sequence: ttttacggccaattttctgc. Inner Right Sequence: atatccttgtgcgcgtaacc. Inner Primer PCR Length: 2770. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1880 C. elegans nas-32(ok2430) V. Show Description
T02B11.7. Homozygous. Outer Left Sequence: GGATCTACCATGAGCCAGGA. Outer Right Sequence: CGAAAATGAGAACGGAAAGC. Inner Left Sequence: TGTGCACCCGTAGACACATT. Inner Right Sequence: GACGGGTCGTACTTTTGGAA. Inner Primer PCR Length: 2939 bp. Deletion Size: 1989 bp. Deletion left flank: AATTCGTCCGCCCATGGTGTATACCATCAC. Deletion right flank: CATGTCCAATGCTGGTGGATTCTCGGTTAT. Insertion Sequence: TTCTTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1881 C. elegans nas-36(ok2431) I. Show Description
C26C6.3. Homozygous. Outer Left Sequence: AAAAATGAAGTGCCGGTGTC. Outer Right Sequence: GTTTATCAACAGGGCACGCT. Inner Left Sequence: TTTGCGCAATATGCATTCTC. Inner Right Sequence: CGTCGTCCCCTGAAAGATAA. Inner Primer PCR Length: 3089 bp. Deletion Size: 2659 bp. Deletion left flank: ATGAAAAAATTGGCGCATTCAAGAAGTTTT. Deletion right flank: TTTCTTGTTATAACATTTTCAAATTTCCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1882 C. elegans sgn-1(ok2432) II. Show Description
F07H5.2. Homozygous. Outer Left Sequence: ACGTGTGTTTGTGGGTTTCA. Outer Right Sequence: AAAGCCACGTTCGATTCAAG. Inner Left Sequence: CCCCTTCTCAATATTCGGGT. Inner Right Sequence: AAGCTTCCAGCCTCCTTTGT. Inner Primer PCR Length: 3103 bp. Deletion Size: 1620 bp. Deletion left flank: TTGAGCACAATTCCGATGGCAAGGATCAAA. Deletion right flank: AGGTTTAATTATATTATTATAGTACACATC. Insertion Sequence: TATATTATTATAGTACAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1883 C. elegans W03B1.2(ok2433) IV. Show Description
W03B1.2. Homozygous. Outer Left Sequence: ATGGCAATTGCGTATAAGGC. Outer Right Sequence: CTAGTGATGGCGCAGTTGAA. Inner Left Sequence: CAAAGACCTTGTCTGAACCTGA. Inner Right Sequence: AAACAGCACTGCTTCCAACC. Inner Primer PCR Length: 3025 bp. Deletion Size: 2350 bp. Deletion left flank: TGAGGATCCGGAATGAGAGCAGAAACCAGC. Deletion right flank: GAAGGAGTACGAGAACGAGTCAAAGAACAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1884 C. elegans B0285.7(ok2434) III. Show Description
B0285.7. Homozygous. Outer Left Sequence: ATAGGCGCATTAGATGACGG. Outer Right Sequence: CATTTTCGCATTTCTCGGAT. Inner Left Sequence: TTGAACAAGAAATAACATTGAAAAA. Inner Right Sequence: CTGTGCCTGTCTCATGCCTA. Inner Primer PCR Length: 1167 bp. Deletion Size: 630 bp. Deletion left flank: ACAAATTCGCTTTCTCCACAGCCACCATCT. Deletion right flank: AGAATCTGCCTGCCTTATACCTAAATGTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1886 C. elegans lgc-20&B0491.5(ok2436) II. Show Description
B0491.5, B0491.4. Homozygous. Outer Left Sequence: ATCCTTTCACCAATTCCACG. Outer Right Sequence: CATGGATCGGTCTTTGGAGT. Inner Left Sequence: GTCATTTCGTCGGAATTTGG. Inner Right Sequence: TTTGTAATTCAGCAAGGGACG. Inner Primer PCR Length: 3101 bp. Deletion Size: 1454 bp. Deletion left flank: CAAAACTAATGAGTCAAAGCGCTCAGTCAT. Deletion right flank: TTACAGAGAATTTTGTTAAATTTTAAAAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807