Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB2291 C. elegans PDB1.1(ok3114) X. Show Description
PDB1.1 Homozygous. Outer Left Sequence: tgtgttcgtttcagtctcgc. Outer Right Sequence: atgaaaaccaaaatgcgctc. Inner Left Sequence: acggaatatgctccctgatg. Inner Right Sequence: gcccacaaagaagatatgcaa. Inner Primer PCR Length: 1113. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2330 C. elegans PDB1.1(ok3166) X. Show Description
PDB1.1. Homozygous. Outer Left Sequence: TGTGTTCGTTTCAGTCTCGC. Outer Right Sequence: ATGAAAACCAAAATGCGCTC. Inner Left Sequence: ACGGAATATGCTCCCTGATG. Inner Right Sequence: GCCCACAAAGAAGATATGCAA. Inner Primer PCR Length: 1114 bp. Deletion Size: 343 bp. Deletion left flank: TTCGCTGAAATATCATTCATTTAGAATGTA. Deletion right flank: GATGTTACCGTAAACGCGCTATCAGAATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2375 C. elegans lmp-1(ok3228) X. Show Description
C03B1.12 Homozygous. Outer Left Sequence: caattttggttggagaggga. Outer Right Sequence: tcacattcaactcgcgtagc. Inner Left Sequence: cgtaaagtcatcgtacgggc. Inner Right Sequence: gctctgctctcgtagcacaa. Inner Primer PCR Length: 1217. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB695 C. elegans ucp-4(ok195) V. Show Description
K07B1.3. Homozygous. Outer Left Sequence: AGTCCTGAACGGAGCTTTGA. Outer Right Sequence: TACAATGGCAGCAGCAAGTC. Inner Left Sequence: TCGCACATTGGTTTGTTGTT. Inner Right Sequence: AACGGCATGAGTTAGCCAAT. Inner primer WT PCR product: 2995. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3277 C. elegans +/mT1 [umnIs52] II; C14B1.8(ve777[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Mes. Deletion of 858 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 viable adults that produce progeny most of which are sterile (ve777 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TTTTCTTGAGCTTCATCGTCATCGAATCCG ; Right flanking sequence: TGGATTATCCATttttgaactgaaaattca. sgRNA #1: AAAATTATCAGCGAGGGAGA; sgRNA #2: AATAAGTCGATTTCTTTAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3362 C. elegans cyp-33B1(ve862[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2219 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTTCTTCCTTATTCATCAATATTTGTGG ; Right flanking sequence: CGCGTTAGATCACGAAATTGTCACACTGAA. cyp-33B1 sgRNA #1: CGGCGAAGAGGATTACCACC; cyp-33B1 sgRNA #2: ACATTTATATGGAATGACAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RW10913 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10703. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10703 [ceh-26::TGF(10B1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
SHG1683 C. elegans egc-1(ust355[egc-1::GFP::3xFlag]) III. Show Description
GFP::3xFlag inserted into endogenous egc-1/c14b1.12 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544.
SHG1685 C. elegans egc-1(ust355[egc-1::mCherry]) III. Show Description
mCherry inserted into endogenous egc-1/c14b1.12 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544.
TB1 C. elegans ceh-6(mg60)/dpy-5(e61) unc-29(e1072) I. Show Description
ceh-6(mg60) is lethal. Maintain by picking WT and check that it throws 1/4 Dpys. mg60 is a 1.3 kb deletion that removes part of the conserved POU-specific domain. PCR with primers PCR6-5 GAA-TTC-ATG-AAA-TCG-GAG-GCG-T (->) and PCR6-3 GTG-AGA-AGT-GAA-GAG-GAT-TGT-A (<-) yields a band of about 1.6 kb instead of 280 bp as in N2. Backcrossed more than 10 times; in addition, the left arm of LG I was recombined with lin-28 to remove the mutator locus.
VC1243 C. elegans T14B1.1(ok1702) X. Show Description
T14B1.1. Superficially wild type. External left primer: TTTGGGGACATACAAGAGGG. External right primer: TCTCGCAAATAAGGCCATTC. Internal left primer: AGGAGAGGGGAGAAATGGTG. Internal right primer: TGTAATCTTTACCCGCCCAC. Internal WT amplicon: 2121 bp. Deletion size: 1117 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC164 C. elegans swd-3.1 dph-1(ok329) III. Show Description
C14B1.4, C14B1.5. Slow-growing, small broods. Deletion removes 3' end of C14B1.4, 5' end of C14B1.5. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1730 C. elegans C36B1.8(ok2141) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C36B1.8. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2141 homozygotes (often sterile or nearly sterile, but a population can be maintained and will starve a plate). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAAGGACGGCTGTTCCTAAA. External right primer: CATATTGAGCTGGAGTCGCA. Internal left primer: CGAGTACAGAACCGAGGAGG. Internal right primer: ACAATACGCTCTCCGTTTGG. Internal WT amplicon: 3357 bp. Deletion size: 1835 bp. Deletion left flank: TTCTAGCATCTAAATTTTAACAATTAGATT. Deletion right flank: AAATGTATTTTACAACACAATTTCCCTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC180 C. elegans +/eT1 III; tnt-4(gk136)/eT1 V. Show Description
T08B1.2. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk136 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1978 C. elegans T24B1.1(ok2604) I. Show Description
T24B1.1. External left primer: ACCGAACTTGACGAATCCAC. External right primer: TGAACAGGACGATCACTGGA. Internal left primer: TAAAGTGTCCGATATTGCCG. Internal right primer: TCCGATTCCTTGCTGAATTG. Internal WT amplicon: 1116 bp. Deletion size: 494 bp. Deletion left flank: GTTATCACTGAAGATTTCGGCAGACCGGCT. Deletion right flank: GAAAACCAAAAAGTATCAAGTCATGAAATG. Insertion Sequence: AAAGACCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2371 C. elegans W03B1.2(gk3214) dct-15(gk3215) IV; C47E8.6(gk1082) V; F53H4.5(gk3216) X. Show Description
This strain is homozygous for a deletion (gk1082) in C47E8.6, detectable by PCR using the following primers. External left primer: CCGTTACCATGCCAACTCTT. External right primer: TGATTTTGGCCGAGTAGGAC. Internal left primer: CCGTCACCTCTTAACGGAAA. Internal right primer: CGAACCAACCAGAATCTTCG. Internal WT amplicon: 1333 bp. Deletion size: 468 bp. Deletion left flank: GACCAATGCAGCTTCCCGTCGAAAACCTGC. Deletion right flank: GAATATCTTAAGACAATCTGATGATCTTCT. Validation: gk1082 passed by diagnostic PCR, CGH. Other deletions (gk3214, gk3215, gk3216) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2460 C. elegans Y54E5A.5(gk1159) I; acs-3(gk3030) V. Show Description
Y54E5A.5, T08B1.6. The allele gk1159 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TGAAGACGTTGAAGCAGGTG. External right primer: TGTTGACGATGACGGTGTTT. Internal left primer: GTGTTGTTGAAGCAGCTGGA. Internal right primer: GTGGAGACGAAGATCCCAAA. Internal WT amplicon: 2024 bp. Deletion size: 775 bp. Deletion left flank: GGGCTAAAAACGCAAAAACTGCAATTTCTA. Deletion right flank: AAAACAAACAATTTTTCAATATAATTTAAC. The allele gk3030 was identified by CGH but not confirmed by PCR. Left flanking probe: CAAAAGAATCAATCCACTAACAAATTGATTGGAATCGCTGGAATTCACTC. Right flanking probe: GCGGGTTTGACCTGACTACAGTACCACTTTATCATCAATCGAAATTGGAG. Left deleted probe: GGAATCGCTGGAATTCACTCGAGAAAATATATGCACACGATGCATGGAAT. Right deleted probe: GCGGGTTTGACCTGACTACAGTACCACTTTATCATCAATCGAAATTGGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC292 C. elegans +/nT1 IV; sun-1(gk199)/nT1 V. Show Description
F57B1.2. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous gk199 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3461 C. elegans alh-5(gk3382) V/nT1[qIs51] (IV;V). Show Description
T08B1.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3382 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCACCTTTAATAACAATGGGGA. External right primer: CTCCAAGATCTCCCTCTCATGT. Internal left primer: CTTTCCCTACTCGCGCTACTT. Internal right primer: GTGTTGTTTGCCCAAGAATGT. Internal WT amplicon: 1350 bp. Deletion size: 349 bp. Deletion left flank: TTGACAATTGTAACATACTTTGGATCGAAA. Deletion right flank: ATATACCTACGCTACCGTTACAATTTCGCA. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4211 C. elegans C03B1.1(gk5297) X. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5297 mutation is C->T, flanking sequences TTGTACGACGAGTCATGCTGTGTTGGAGCC and GAGGTCGTGATGTCTATCTAAATTTCGGTC.
VC4495 C. elegans C36B1.6(gk5566[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1181 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCGGATATTTTTCGGAAATAATGCCCGGCA. Right flanking sequence: CACCGGTCGGAATACTAAAGAATGAGTCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC586 C. elegans pdi-1(gk271) III. Show Description
C14B1.1. Him, otherwise superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC706 C. elegans let-381(gk302) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F26B1.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk302 homozygotes (sterile DpyUnc). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC855 C. elegans cle-1(gk364) I. Show Description
C36B1.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC899 C. elegans cle-1(gk390) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C36B1.1. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk390 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC943 C. elegans cle-1(gk421) I. Show Description
C36B1.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
ABR212 C. elegans acd-1(sta6) delm-2(ok1822) I. Show Description
acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4).
ABR225 C. elegans acd-1(sta6) delm-2(ok1822) I; delm-1(ok1266) IV. Show Description
acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4). This triple mutant strain was made by crossing the acd-1(sta6) delm-2(ok1822) double mutant with delm-1(ok1226) parental strain RB1177.
AD292 C. elegans spe-51(as39) IV; him-5(e1490) V; asEx95. Show Description
asEx95 [T22B11.1(genomic) + myo-3p::GFP]. Pick GFP+ animals to maintain. as39 is a non-conditional allele of spe-51. Mutant hermaphrodites and males are severely subfertile due to a sperm defect. The extrachromosomal array asEx95 effectively rescues the fertility defect. Him. Reference: Mei X, et al. Curr Biol. 2023 Jul 3;S0960-9822(23)00780-7. doi: 10.1016/j.cub.2023.06.029. PMID: 37453427.
AH102 C. elegans lip-1(zh15) IV. Show Description
Deletion allele which removes exons 2 to 6 of lip-1 (C05B10.1). Incompletely penetrant ovulation defect.
AMP101 C. elegans weSi174 II; daf-2(syb1177[daf-2::AID*::TEV::3xFLAG]) III. Show Description
weSi174 [eif-3.Bp::TIR1::linker::mCherry(dpiRNA)::tbb-2 3'UTR + unc-119(+)] II. Auxin-inducible degradation of DAF-2::AID* causes dauer formation. Reference: Eder M, et al. Cell. 2024 Jul 25;187(15):3919-3935.e19. doi: 10.1016/j.cell.2024.05.050. PMID: 38908368.
AMP116 C. elegans weSi174 II; daf-2(syb1177[daf-2::AID*::TEV::3xFLAG]) glp-1(e2141) III. Show Description
weSi174 [eif-3.Bp::TIR1::linker::mCherry(dpiRNA)::tbb-2 3'UTR + unc-119(+)] II. Maintain at 20C or less. Sterile at 25C. Auxin-inducible degradation of DAF-2::AID* causes dauer formation. Reference: Eder M, et al. Cell. 2024 Jul 25;187(15):3919-3935.e19. doi: 10.1016/j.cell.2024.05.050. PMID: 38908368.
AX7884 C. elegans pod-2(syb1772[pod-2::His10]) II; mccc-1(syb1666[mccc-1::His10]) IV; pyc-1(syb1680[pyc-1::His10]) V; pcca-1(syb1626[pcca-1::His10]) X. Show Description
Superficially wild-type. Referred to as MP3-His. Strain can be used to biotinylated carboxylases from worm extracts. AX7884 obtained by crossing parental strains PHX1772 pod-2(syb1772[pod-2::His10]) II, PHX1666 mccc-1(syb1666[mccc-1::His10]) IV, PHX1680 pyc-1(syb1680[pyc-1::His10]) V and PHX1626 pcca-1(syb1626[pcca-1::His10]) X to obtain the quadruple His10-tagged strain. The 5xGlycine(G-linker)-His10 tag is a 45 bp sequence (GGAGGAGGAGGAGGACACCATCACCATCACCACCACCACCACCAC) encoding five glycine as a linker and ten histidine residues was knocked in at the C terminus-just upstream of the termination codon-of each of the four carboxylases. Reference: Artan M, et al. J Biol Chem. 2022 Aug 3:102343. doi: 10.1016/j.jbc.2022.102343. Epub ahead of print. PMID: 35933017.
AY161 C. elegans mul-1(syb1027) IV. Show Description
F49F1.6. mul-1(syb1027) [IV:4121342..4123166] is a CRISPR/Cas9-engineered ∼1,650-bp deletion mutant of isoforms A and B (565 bp and 952 bp deleted, with generated termination codon), leaving a predicted truncated protein of 46 amino acids. Derived by out-crossing parental strain PHX1027 (Suny Biotech) with N2 six times. Reference: Hoffman CL, et al. mBio. 2020 Mar 3;11(2):e00060-20. PMID: 32127446
AY162 C. elegans mul-1(syb1027) IV; acEx162. Show Description
acEx162 [mul-1p::mul-1::SL2::GFP + myo-2p::mCherry]. Pick mCherry+ to maintain. GFP expression in the intestine. acEx162 transgene rescues mul-1(lf). mul-1(syb1027) [IV:4121342..4123166] is a CRISPR/Cas9 ∼1,650-bp deletion mutant of isoforms A and B (565 bp and 952 bp deleted, with generated termination codon), leaving a predicted truncated protein of 46 amino acids. Reference: Hoffman CL, et al. mBio. 2020 Mar 3;11(2):e00060-20. PMID: 32127446
BB19 C. elegans adr-1(tm668) I. Show Description
Reduced lifespan, chemotaxis defective, co-suppression of transgenes in somatic cells. Maintain under normal conditions. Reference: Hundley HA, et al. RNA. 2008 Oct;14(10):2050-60.
BC10103 C. elegans dpy-5(e907) I; sEx10103. Show Description
sEx10103 [rCesF52B10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC10154 C. elegans dpy-5(e907) I; sEx10154. Show Description
sEx10154 [rCes T05B11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC10170 C. elegans dpy-5(e907) I; sEx10170. Show Description
sEx10170 [rCes R06B10.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC10399 C. elegans dpy-5(e907) I; sEx10399. Show Description
sEx10399 [rCes C05B10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC10433 C. elegans dpy-5(e907) I; sEx10433. Show Description
sEx10433[rCesT21B10.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC10495 C. elegans dpy-5(e907) I; sEx10495. Show Description
sEx10495 [rCesT22B11.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC10749 C. elegans dpy-5(e907) I; sEx10749. Show Description
sEx10749 [rCes F08B12.3b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC10751 C. elegans dpy-5(e907) I; sEx10751. Show Description
sEx10751[rCesC44B11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC10917 C. elegans dpy-5(e907) I; sEx10917. Show Description
sEx10917 [rCes Y43B11AR.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC11019 C. elegans dpy-5(e907) I; sEx11019. Show Description
sEx11019 [rCesC44B12.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC11078 C. elegans dpy-5(e907) I; sEx11078. Show Description
sEx11078 [rCes C02B10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC11198 C. elegans dpy-5(e907) I; sEx11198. Show Description
sEx11198 [rCesT23B12.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC11318 C. elegans dpy-5(e907) I; sEx11318. Show Description
sEx11318 [rCes T21B10.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC11336 C. elegans dpy-5(e907) I; sEx11336. Show Description
sEx11336 [rCesT10B11.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).