| ZB1031 |
C. elegans |
crt-1(bz50) V. Show Description
Point mutation in G102E. No easily detected phenotype, selected for suppression of mec-4(d)-induced degeneration caused by ectopic expression of mec-4(u231) in the ventral nerve cord. Bent-head.
|
|
| ZB1057 |
C. elegans |
bzIs18. Show Description
bzIs18 [mec-4p::Yc2.12 + lin-15(+)].
|
|
| ZB1098 |
C. elegans |
glt-4(bz69) II. Show Description
Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.
|
|
| ZB1099 |
C. elegans |
glt-5(bz70) II. Show Description
Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.
|
|
| ZB1102 |
C. elegans |
glt-3(bz34) IV; nuIs5 V. Show Description
nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. Reference: Mano & Driscoll (2009) J Neurochem 108(6):1373-84.
|
|
| ZB1106 |
C. elegans |
glt-3(bz34) IV; glt-1(ok206) X. Show Description
Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.
|
|
| ZB1108 |
C. elegans |
bzEx?. Show Description
bzEx? [glt-3::GFP + rol-6(su1006)]. Rollers. Maintain by picking rollers. Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.
|
|
| ZB1110 |
C. elegans |
bzEx?. Show Description
bzEx? [glt-4::GFP + rol-6(su1006)]. Rollers. Maintain by picking rollers. Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.
|
|
| ZB1748 |
C. elegans |
Y32H12A.8(tm422) III. Show Description
|
|
| ZT33 |
C. elegans |
cec-8(fj63) III. Show Description
No apparent phenotype. The chromodomain protein CEC-8 is phylogenetically similar to CEC-5 and CEC-4. fj63 is a 14-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-8 (Y55B1BR.3). The fj63 deletion can be detected by PCR with the following primers: GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|