More Fields
Strain Species Genotype
VC1179 C. elegans F08B12.1(gk545) X. Show Description
F08B12.1. External left primer: CTCCTCCTACACCCTCTCCC. External right primer: CGCTAAGCTTGTGTTGGTCA. Internal left primer: GAAGCCGCTAGAAGAACGTG. Internal right primer: ATTTAGGTACGCGCGAGAAA. Internal WT amplicon: 2016 bp. Deletion size: 569 bp. Deletion left flank: CCTTATAAATCCGCGGAGCAATACAAATGT. Deletion right flank: ATCTTCGCAAATCAACTCAGCAAACACTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1336 C. elegans vha-6(ok1825)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
VW02B12L.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1825 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAGCAGAATGGCTCGAACT. External right primer: TCATCCATCATTCCAGAGCA. Internal left primer: GGAACTCGACCCAATGAAGA. Internal right primer: GGTGGCGGTCTGATATTGAT. Internal WT amplicon: 3301 bp. Deletion size: 982 bp. Deletion left flank: GGCTTGACGAGAAGCATAACTGGAACAGAT. Deletion right flank: GGAGCTGGATTAACTTCTCGATAGTTGGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1359 C. elegans K02B12.3(ok1827) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K02B12.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1827 homozygotes (probable embryonic/early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAATGGAGAAGGATGGACCC. External right primer: TGGAACAAGAACCGGAAAAC. Internal left primer: TGAGAAATAGTGAAGCGCGA. Internal right primer: CTATTTGAACACCCGCCAAT. Internal WT amplicon: 2550 bp. Deletion size: 1420 bp. Deletion left flank: AAAATTCGGATTTAATTATTTAGATAGAAG. Deletion right flank: CCACGTGTTCTCGTTGAAAATCGCTTTCGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1441 C. elegans ceh-6(gk665) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K02B12.1. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk665 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAGACAGACGAATGCAACGA. External right primer: GTGCCTTCTTTTTCCAACCA. Internal left primer: ACAGAAGAAAGGGCGGAAAT. Internal right primer: CAACTTCCAACTGCTTTGGG. Internal WT amplicon: 2295 bp. Deletion size: 1525 bp. Deletion left flank: GAAGGTACATTAGTGAATAGGAAAATAATA. Deletion right flank: AGACATTGATGCTGTAGAATTGTGAAGATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1481 C. elegans ceh-6(gk679) I. Show Description
K02B12. External left primer: GAGACAGACGAATGCAACGA. External right primer: GTGCCTTCTTTTTCCAACCA. Internal left primer: ACAGAAGAAAGGGCGGAAAT. Internal right primer: CAACTTCCAACTGCTTTGGG. Internal WT amplicon: 2295 bp. Deletion size: 508 bp. Deletion left flank: AGCGGTCTTTCTGCGTCTCGTCTAGCCACC. Deletion right flank: GTTACGTATTGACAACCTGGTGAAAAATCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1484 C. elegans K09B11.2(ok1967) IV/nT1 [qIs51] (IV;V). Show Description
K09B11.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1967 homozygotes (late larval arrest or sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGCAACTAACGGCTTTGC. External right primer: TTGCTCGATTCACACGAAAC. Internal left primer: TGGAGGAATTGTTGCAGTGA. Internal right primer: CCGGAAGGTTGTAGTCGTTG. Internal WT amplicon: 4083 bp. Deletion size: 1709. Deletion left flank: TTAGCTGGAGCGAATAACGATCGGAAAGTT. Deletion right flank: AAATATAACATTTTACAGTTTTCGTTTCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1543 C. elegans sea-1(gk1023) II. Show Description
F19B10.9. External left primer: ACCGTCACGAATGAGGTTTC. External right primer: CTCTTGCCGACTTCGTTTTC. Internal left primer: TGCCTGAGCAATTTCCTTCT. Internal right primer: TTATATTTGCGGTGCTGTGC. Internal WT amplicon: 2319 bp. Deletion size: 2143 bp. Deletion left flank: GGAATGTTGCCTGAGCAATTTCCTTCTTTT. Deletion right flank: GCTAGAATTGTAGGCAATTGTCGATTTCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1557 C. elegans nhr-86(gk717) V. Show Description
Y40B10A.8. External left primer: AACCCAAAAGTTGCATGAGG. External right primer: AAAATTGGCCAGAAATGACG. Internal left primer: TCTGGCTTGATTTCTCGCTT. Internal right primer: CGCATGAGAACTGCAAGAAG. Internal WT amplicon: 1750 bp. Deletion size: 445 bp. Deletion left flank: AAAATTCAAAAAATTTTCTAAGTTTTATAT. Deletion right flank: AATAATTATTTTAACTCACTCGCAGTAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1579 C. elegans ebp-2(gk737) II. Show Description
VW02B12L.3. External left primer: AAACCATGTATGGGAACCGA. External right primer: GGAGTCGGCTTGTTTCAGAG. Internal left primer: AAACTTCTGCTCAAGAGGCG. Internal right primer: TAATGTGGAAATCGATGGCA. Internal WT amplicon: 1627 bp. Deletion size: 541 bp. Deletion left flank: TTCGCCCTTCCACCATTGTGGTGAGACTTC. Deletion right flank: CGTCTGGAGCCGCGTACTGTCAGCTCACTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1607 C. elegans nlr-1(tm2050) IV/nT1 [qIs51] (IV;V). Show Description
F20B10.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP tm2050 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAGTTCTGTGACGTCCCAGT. External right primer: GTCGGCGTTAGATGACTATG. Internal left primer: TACGGCAAAGTGAATGGCTT. Internal right primer: ACAGCTGATCTACCACACTC. Internal WT amplicon: 1775 bp. Deletion size: 1078 bp. Deletion left flank: CAATGAGTTAATTTCCAACAAAATTATTTT. Deletion right flank: GTAAGTGAGTACCGAACTGCTCCGGGCTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1613 C. elegans T15B12.1(gk751) III. Show Description
T15B12.1. External left primer: AAAAATTGCCAGAATCGTCG. External right primer: CAAAGGCGGTTTGTGAAAAT. Internal left primer: ATTGGCAATCTCCGTTCATC. Internal right primer: GTTAACAGCCAGATGCTCCC. Internal WT amplicon: 1544 bp. Deletion size: 622 bp. Deletion left flank: TGTGTTCTTTTGATTAATTGATATGCATTC. Deletion right flank: ACACTTCCAAATCGTCCAAATATCGGAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1614 C. elegans ebp-2(gk756) II. Show Description
VW02B12L.3. External left primer: AAACCATGTATGGGAACCGA. External right primer: GGAGTCGGCTTGTTTCAGAG. Internal left primer: AAACTTCTGCTCAAGAGGCG. Internal right primer: TAATGTGGAAATCGATGGCA. Internal WT amplicon: 1627 bp. Deletion size: 885 bp. Deletion left flank: CCACTGTTAACCATAGGAAATGCACTGATT. Deletion right flank: GACCGGTGGCTGCCGCTCCGCCAAAGCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1682 C. elegans T10B10.3(ok2184) X. Show Description
T10B10.3. External left primer: TATGGGGAAAATTGGGACAA. External right primer: TAGACATTTGGGCAATGCAA. Internal left primer: ATCATCATCAAGCTTTGCCC. Internal right primer: ACCGCACAACATATGACGAA. Internal WT amplicon: 2804 bp. Deletion size: 2484 bp. Deletion left flank: AAGCCGTTCCAGCTCCTTATCGAATCGGAC. Deletion right flank: TCACTTTGTTTACATATCCTTCGACCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1691 C. elegans sea-1(gk799) II. Show Description
F19B10.9. External left primer: ACCGTCACGAATGAGGTTTC. External right primer: CTCTTGCCGACTTCGTTTTC. Internal left primer: TGCCTGAGCAATTTCCTTCT. Internal right primer: TTATATTTGCGGTGCTGTGC. Internal WT amplicon: 2319 bp. Deletion size: 668 bp. Deletion left flank: AGGAAGAGGACGGCCGGGAGGTGGATTGCA. Deletion right flank: ACGCTAAAATTGTCTGGAAAACTGCCAACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC177 C. elegans syx-4&ant-1.4(ok372)/mIs11 IV. Show Description
T01B11.3, T01B11.4. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] IV. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim GFP signal in pharynx, and segregate WT with dim GFP, WT with brighter GFP (mIs11 homozygotes), and non-GFP sterile ok372 homozygotes. Pick dim GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1819 C. elegans slo-2(ok2214) X. Show Description
F08B12.3. External left primer: CCGAAGTTAAATATCCGCCA. External right primer: AAGGACCCCAATTTTCCACT. Internal left primer: ATGAACGGCATATGAGAGCC. Internal right primer: TCGCCAGAAAATTGAAAACA. Internal WT amplicon: 3098 bp. Deletion size: 1008 bp. Deletion left flank: TAAATCATGCACTGGTCTGTAGTATGCTCG. Deletion right flank: CTTCTGAAAGAATGTATGTAATCATCGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1911 C. elegans C01B12.2(gk1032) II. Show Description
C01B12.2. External left primer: AGACGCCATGATTTTCAACC. External right primer: AACCGTAATGGGACAGCTTG. Internal left primer: GAACCTGCGGTTCAAACAAT. Internal right primer: AGGGAGTGAGCGAGAAACAA. Internal WT amplicon: 2259 bp. Deletion size: 561 bp. Deletion left flank: AAACGTGGTTTTGCCCGAGTTCTCTGAAAC. Deletion right flank: AAGCAATTTACTCAAATTATTTCAGTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2043 C. elegans C39B10.1(ok2813) X. Show Description
C39B10.1. External left primer: TGTGGACAACCAGGAGCATA. External right primer: GTGTTTCCGGGATTCACAAC. Internal left primer: TGAAGCATCAGTGAGGTAGAATG. Internal right primer: TCTTGTCCTGATCCTTCTAGGC. Internal WT amplicon: 1190 bp. Deletion size: 628 bp. Deletion left flank: AAATTTGTAAGATGCAACTCTCAGATTAAC. Deletion right flank: GTGACACTGTATATCAACGACGGAATGCAG. Insertion Sequence: TGGTCCATAGATTGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2133 C. elegans C11E4.7(gk3221) dhhc-1(gk1067) X. Show Description
This strain is homozygous for a deletion (gk1067) in F09B12.2, detectable by PCR using the following primers. External left primer: TGGTGGAGGTTTTCAAGGAG. External right primer: GCGTCATGGTGGGTAAAATC. Internal left primer: AAAGTGAACAGCGAAACGGT. Internal right primer: TAACTGGCAGCAGTGGTGAG. Internal WT amplicon: 1907 bp. Deletion size: 502 bp. Deletion left flank: TATAAGCCTGGCTGAAAGTTACGAATTTGG. Deletion right flank: AAAATTTGAATGAAATGTAAAGTTGAAGTA. Validation: gk1067 passed by diagnostic PCR, CGH. Other deletion (gk3221) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2148 C. elegans F23B12.4(ok2848) V/nT1 [qIs51] (IV;V). Show Description
F23B12.4. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2848 homozygotes (Dpy hermaphrodite, strongly Him, males more WT. Healthy gravid WT non-GFP segregants are recombinants and not true homozygotes). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCCGCATTTGAAAGTATGA. External right primer: AAGCAAAAAGCAATGCAGGT. Internal left primer: GCAGTTGAACATCAGGGAGG. Internal right primer: GGACGCCTACGCACAATACT. Internal WT amplicon: 1145 bp. Deletion size: 396 bp. Deletion left flank: TACTACTTGAAAATGCTTCGTTAAAAATGA. Deletion right flank: GGAACTTCTAACAACAATTATATTCGACTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2154 C. elegans F16B12.5(gk1009) X. Show Description
F16B12.5. External left primer: AATTGTACGGCGGAAAACTG. External right primer: ACCACGGTTGCATAGGACTC. Internal left primer: CTTGGCAAGACAAATGATCG. Internal right primer: CTGGACGGGTCAGTTTCAAT. Internal WT amplicon: 2766 bp. Deletion size: 1271 bp. Deletion left flank: GCATTTGGTCTCAATGAAAAAAAGAATCAG. Deletion right flank: TTAATTAGTACCACATTTAGGATGCAAAAA. Insertion Sequence: AAAAAGAAAACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2300 C. elegans F16B12.6(gk1118) X. Show Description
F16B12.6. Identified by PCR, validated by CGH. External left primer: CGATCACCAACAAACAATGC. External right primer: TACGTGACCCGTTGACAAAA. Internal left primer: CAGTTTAGAAATGCCTCGCC. Internal right primer: CGGACCGTCGTAAACAAACT. Internal WT amplicon: 2674 bp. Deletion size: 2358 bp. Deletion left flank: ATTGTGAAAACAAAAAAAAACAGATGAAGC. Deletion right flank: GCAATTCTTCAATCATTTCAGGTTTTCTAT. Insertion Sequence: AGATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC231 C. elegans C39B10(gk153) X. Show Description
C39B10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2336 C. elegans Y52B11A.9(gk1120) I. Show Description
This strain is homozygous for a deletion (gk1120) in Y52B11A.9, detectable by PCR using the following primers. External left primer: CAATCCCCTCTCTCATCCAA. External right primer: TATTTGCAACGACACTCCGA. Internal left primer: TGCATATGACGCTCTTCGTC. Internal right primer: TTCCAGCTTCTGCCAAATGT. Internal WT amplicon: 1563 bp. Deletion size: 405 bp. Deletion left flank: GGAGCTTTTCGGCTCAAATTATTGGAATAT. Deletion right flank: ACAAACTACAAAATTTCTAGCCTCTACCAA. Validation: gk1120 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2354 C. elegans T08G11.2(gk3172) I; pqn-90(gk1127) IV; T10B10.3(gk3173) X. Show Description
T10B10.3, T08G11.2, Y63F8A.8. The gk1127 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: ACAACCCGTGCAAGAAAAAC. External right primer: AAGTGGGACGGAACTGTTTG. Internal left primer: ACAATCGCGTCAGTAGGAGC. Internal right primer: CAGGGTTGTAGGACGTTGGT. Internal WT amplicon: 1894 bp. Deletion size: 1379 bp. Deletion left flank: CCGGTTTTTCTACCGCCATATGTCCCCTCC. Deletion right flank: GGTTGAGTTGCTTGTTGGCATGAACAACTT. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2511 C. elegans Y52B11A.2(ok3233) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y52B11A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3233 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCGAGCCTCACTCAAAACT. External right primer: AGTGGTCCATATCTCCGTCG. Internal left primer: GAAAATGTTCACGAAACGCA. Internal right primer: GGAGCAGAAAGAGGTGCTTC. Internal WT amplicon: 1301 bp. Deletion size: 675 bp. Deletion left flank: ACTAATAGAAAATTCAAAAATTGGGTGAGA. Deletion right flank: AAGATCCTAAAACTATTTTAAACTTCTTTT. Insertion Sequence: TAGATCCTAAAACAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2534 C. elegans nhr-281(gk1108) X. Show Description
F16B12.8, C24A1.3. External left primer: GCGTCCACAAAAGTGTCAGA. External right primer: GGTTTGAGAATTGCCGGATA. Internal left primer: CAACACCGTGGCATTTAGTG. Internal right primer: CCTTCACTGCACGCTAAACA. Internal WT amplicon: 1959 bp. Deletion size: 1071 bp. Deletion left flank: ACGAGGCTCAGATTGTTTATGAAATCAAAA. Deletion right flank: AAATAAAATGTGTTCTTTGGAGACAGAATA. Insertion Sequence: TTATAGGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2536 C. elegans W02B12.11(ok3260) II. Show Description
W02B12.11. External left primer: AAAAGACCGGACAACCACTG. External right primer: AACCTACATCAACTTCGGCG. Internal left primer: CAGCCGGATTTCTTTTCTGA. Internal right primer: CCGTTTCCTCTTCACATGCT. Internal WT amplicon: 1242 bp. Deletion size: 481 bp. Deletion left flank: ATTTACAGCCGGATTTCTTTTCTGATCCCC. Deletion right flank: CAGCGCCGAAGAGGACGGATCTTGTCCAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2538 C. elegans C08B11.3(gk1041)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C08B11.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk1041 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATCTCGATCGACACTTCGCT. External right primer: TAACATATCGACGTTGGGCA. Internal left primer: ACGGCTCGTCTGTTCTGATT. Internal right primer: AATTGACGGATCCACCTGAG. Internal WT amplicon: 2394 bp. Deletion size: 561 bp. Deletion left flank: GATCAATCTGAAATTCATTTTTCAAATTAT. Deletion right flank: TGCAAAATCGATTTCGTTCGGCAATCCAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2539 C. elegans noah-2(ok3197) IV/nT1 [qIs51] (IV;V). Show Description
F52B11.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3197 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCTTAGGCACAGACGTAGG. External right primer: CACTGAGAGCGAGACGACTG. Internal left primer: GCACTGCTTCTTCCTGCTTC. Internal right primer: CAGAGAAGCTCGGTGGAGTC. Internal WT amplicon: 1129 bp. Deletion size: 806 bp. Deletion left flank: TGAATCCCAATTCGGAGGAATGGCTCTCTG. Deletion right flank: AGGAGAAGCTTTCGGCTATCATTCGAGTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC259 C. elegans pak-2(ok332) V. Show Description
C45B11.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2666 C. elegans ceh-6(ok3388) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K02B12.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3388 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTCTTTCTTCCAGCTTGCC. External right primer: TAGGGCCAGAAAATTGAACG. Internal left primer: AAATGTAGAATTGGGCGAGC. Internal right primer: GGTAGGCGCACATACCATTT. Internal WT amplicon: 1129 bp. Deletion size: 405 bp. Deletion left flank: TCTGAATAATTTCAGGTCGTTCAACTTCCT. Deletion right flank: AAAATGGTATGTGCGCCTACCAATTGAAAA. Insertion Sequence: AAAAGGATTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2676 C. elegans M01B12.5(gk1101) I. Show Description
M01B12.5. External left primer: CGCCAATCCTGGTTTAAATG. External right primer: AGAACCTCTTTTGCGGGTTT. Internal left primer: ATTCCCACGCAAATAAATGG. Internal right primer: TCGAGCTGATCGTGCTACTG. Internal WT amplicon: 2467 bp. Deletion size: 575 bp. Deletion left flank: GGGAATAAATTCAATTTTTTTTCATTTTTT. Deletion right flank: ATTTTTTAAAATAAAAATATTAAATGTTTT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2763 C. elegans myrf-1(ok3445)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F59B10.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3445 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCCGTAGTTTCGGTTATGCC. External right primer: AGCTTTGCTGGTATTGACGG. Internal left primer: TCAAGGACATAAAGAGCTGACA. Internal right primer: GTCAGCAACAGGCAATCAGA. Internal WT amplicon: 1381 bp. Deletion size: 636 bp. Deletion left flank: GAAGACAAGCGGCCATAATGGAAACCAAGG. Deletion right flank: ACAGGGCTCCTCCATTTCGTTGCCATCCAA. Insertion Sequence: GCTCCTACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2775 C. elegans cct-2(ok3438)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T21B10.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3438 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGATCCTGAAGTCAATCGGT. External right primer: CAGCAACCTCTCCTTTCTCG. Internal left primer: TCCTCAAAGAAGCCGAGAAA. Internal right primer: AATGAACAAACCGATTCCCA. Internal WT amplicon: 1112 bp. Deletion size: 633 bp. Deletion left flank: AAGATTCTCATTGCCAACACACCAATGGAC. Deletion right flank: GACTCGGCTGAACTTGTCACAAGACTCCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC30222 C. elegans Whole-genome sequenced strain. Show Description
Do not bleach! NOTE: VC30222 does not grow well on E. coli OP50, but does grow well on plates of OP50 mixed with other E. coli strains. It has been grown successfully on HB101 and X1666, and on plates containing unknown bacterial contaminants. Avoid egg-prepping onto OP50 plates. Million Mutation Project strain. This strain was isolated after ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC3054 C. elegans F52B11.2(ok3718) IV/nT1 [qIs51] (IV;V). Show Description
F52B11.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3718 homozygotes (early- to mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTCCTGAAATATGGCGGAGA. External right primer: TCTTCTGGCCCTTCAACAGT. Internal left primer: ACACGAAGCACTGGCTTTTT. Internal right primer: GTCCGACAGTCCGTTCGT. Internal WT amplicon: 1267 bp. Deletion size: 518 bp. Deletion left flank: AATGTATTATTTTCCATTTTCCGAATTTTT. Deletion right flank: CGGATTCAAGGGCACCGAACCGTATCCAGT. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC315 C. elegans +/eT1 III; mrck-1(ok586)/eT1 V. Show Description
K08B12.5. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok586 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3279 C. elegans C01B12.2(gk3198) II. Show Description
This strain is homozygous for a deletion (gk3198) in C01B12.2, detectable by PCR using the following primers. External left primer: TCAAAAATTTGCGAAACGTG. External right primer: AGGGAGTGAGCGAGAAACAA. Internal left primer: CTACATTGGTCCGACCCCTA. Internal right primer: ATGAGCTTTGCCCTGAAAGA. Internal WT amplicon: 1379 bp. Deletion size: 941 bp. Deletion left flank: AAGTTAAGCAATTTACTCAAATTATTTCAG. Deletion right flank: TGAATTTCGCAATAAAACTTTTTGGAAATT. Insertion Sequence: ATTTTT. Validation: gk3198 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3288 C. elegans myrf-1(gk3366)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F59B10.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3366 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATCCATTTGAATCCTCGCTG. External right primer: AGCTTCCGATACAATGCCAC. Internal left primer: GTACCGGTGATTCGCTTTGT. Internal right primer: GAGCCGATCGTAAACCACAT. Internal WT amplicon: 1767 bp. Deletion size: 761 bp. Deletion left flank: TTACAAGATGGATTGAAGCATTTTTCAAGT. Deletion right flank: CGAATATCGGATGGATTGATTATTCGGCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3326 C. elegans W02B12.12(gk3362) II. Show Description
Homozygous viable, carrying a deletion in W02B12.12. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3364 C. elegans F37B12.3(gk3365)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F37B12.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3365 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAAATTTGCGTCAAAGTACGGT. External right primer: CCTATACACCTCTCATGCCTCC. Internal left primer: GGGTACCGTATTTTAGCGCA. Internal right primer: CCTGACGAATTGCCATCTTT. Internal WT amplicon: 2539 bp. Deletion size: 983 bp. Deletion left flank: GTGACAAGTTAAAGCGAATGGACCGAACAA. Deletion right flank: TGGAATTTAATAAAAATGTGTGGCTGTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3365 C. elegans pygo-1(gk3509) IV/nT1 [qIs51] (IV;V). Show Description
C02B10.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3509 homozygotes (sterile, eggs don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAATCCACAGAACCG. External right primer: TTGCGGTAGCTTAGGCAGAT. Internal left primer: CCTGAGTCATCTCCTGCACA. Internal right primer: AGAGCGGGATCTGGAAAAAT. WT internal amplicon: 2056 bp. Deletion size: approximately 600 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC337 C. elegans gcs-1(ok436)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F37B12.2. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- ok436 homozygotes (approximately L2 arrest). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3477 C. elegans pygo-1(gk3390) IV/nT1[qIs51] (IV;V). Show Description
C02B10.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3390 homozygotes (sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAATCCACAGAACCG. External right primer: TTGCGGTAGCTTAGGCAGAT. Internal left primer: CCTGAGTCATCTCCTGCACA. Internal right primer: AGAGCGGGATCTGGAAAAAT. Internal WT amplicon: 2056 bp. Deletion size: 775 bp. Deletion left flank: CGGCGGAGCAAGAGTATTATTATTTCACGT. Deletion right flank: GCTGGAGATGATGGCGAATTCTTCGAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3680 C. elegans T23B12.11(gk3652) V; igcm-2(gk3654) X. Show Description
Homozygous viable. Splicing defect and nonsense allele identified by amplicon sequencing.
VC3742 C. elegans C52B11.5(gk3700[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 1047 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTATTTGGACAACGCTCTGTGCACAAATCA; Right flanking sequence: TGGCTTAACGAATGAAGATAATGGATTCAA. See WormBase Variation gk3700 for details.
VC3933 C. elegans R01B10.6(gk5008[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1561 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATAAAGGCAAAGTAGAAAATGACCAGCGAG; Right flanking sequence: ATAGGAAAACAAATATTGTTAAAAAATTTA. See WormBase Variation gk5008 for details.
VC399 C. elegans fntb-1(ok590) V/nT1 [qIs51] (IV;V). Show Description
F23B12.6. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and GFP- ok590 homozygotes (early larval arrest, probably L2). nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4095 C. elegans srz-5(gk5186) II; R09H10.7(gk5187) IV; F54B11.7(gk5188) X. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5186 mutation is C->T, flanking sequences TCCGAGATATAGCAGAATTATGATCCAGGA and CAATTTTTTTGATTTAAAATCCATTTTTTG. The gk5187 mutation is G->A, flanking sequences AGATATGAGCGAAGATAAAGTTCTTATTAG and TAAGTAGCTTATTTTTTTAGAAAAAAACAT. The gk5188 mutation is C->T, flanking sequences GAAATCGCCAACATCAACCATTCAGTTAAA and AGCTTCTAACTGATATGGATACGGTGAAAG.