VC2043 |
C. elegans |
C39B10.1(ok2813) X. Show Description
C39B10.1. External left primer: TGTGGACAACCAGGAGCATA. External right primer: GTGTTTCCGGGATTCACAAC. Internal left primer: TGAAGCATCAGTGAGGTAGAATG. Internal right primer: TCTTGTCCTGATCCTTCTAGGC. Internal WT amplicon: 1190 bp. Deletion size: 628 bp. Deletion left flank: AAATTTGTAAGATGCAACTCTCAGATTAAC. Deletion right flank: GTGACACTGTATATCAACGACGGAATGCAG. Insertion Sequence: TGGTCCATAGATTGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2133 |
C. elegans |
C11E4.7(gk3221) dhhc-1(gk1067) X. Show Description
This strain is homozygous for a deletion (gk1067) in F09B12.2, detectable by PCR using the following primers. External left primer: TGGTGGAGGTTTTCAAGGAG. External right primer: GCGTCATGGTGGGTAAAATC. Internal left primer: AAAGTGAACAGCGAAACGGT. Internal right primer: TAACTGGCAGCAGTGGTGAG. Internal WT amplicon: 1907 bp. Deletion size: 502 bp. Deletion left flank: TATAAGCCTGGCTGAAAGTTACGAATTTGG. Deletion right flank: AAAATTTGAATGAAATGTAAAGTTGAAGTA. Validation: gk1067 passed by diagnostic PCR, CGH. Other deletion (gk3221) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2148 |
C. elegans |
F23B12.4(ok2848) V/nT1 [qIs51] (IV;V). Show Description
F23B12.4. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2848 homozygotes (Dpy hermaphrodite, strongly Him, males more WT. Healthy gravid WT non-GFP segregants are recombinants and not true homozygotes). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCCGCATTTGAAAGTATGA. External right primer: AAGCAAAAAGCAATGCAGGT. Internal left primer: GCAGTTGAACATCAGGGAGG. Internal right primer: GGACGCCTACGCACAATACT. Internal WT amplicon: 1145 bp. Deletion size: 396 bp. Deletion left flank: TACTACTTGAAAATGCTTCGTTAAAAATGA. Deletion right flank: GGAACTTCTAACAACAATTATATTCGACTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2154 |
C. elegans |
F16B12.5(gk1009) X. Show Description
F16B12.5. External left primer: AATTGTACGGCGGAAAACTG. External right primer: ACCACGGTTGCATAGGACTC. Internal left primer: CTTGGCAAGACAAATGATCG. Internal right primer: CTGGACGGGTCAGTTTCAAT. Internal WT amplicon: 2766 bp. Deletion size: 1271 bp. Deletion left flank: GCATTTGGTCTCAATGAAAAAAAGAATCAG. Deletion right flank: TTAATTAGTACCACATTTAGGATGCAAAAA. Insertion Sequence: AAAAAGAAAACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2300 |
C. elegans |
F16B12.6(gk1118) X. Show Description
F16B12.6. Identified by PCR, validated by CGH. External left primer: CGATCACCAACAAACAATGC. External right primer: TACGTGACCCGTTGACAAAA. Internal left primer: CAGTTTAGAAATGCCTCGCC. Internal right primer: CGGACCGTCGTAAACAAACT. Internal WT amplicon: 2674 bp. Deletion size: 2358 bp. Deletion left flank: ATTGTGAAAACAAAAAAAAACAGATGAAGC. Deletion right flank: GCAATTCTTCAATCATTTCAGGTTTTCTAT. Insertion Sequence: AGATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC231 |
C. elegans |
C39B10(gk153) X. Show Description
C39B10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2336 |
C. elegans |
Y52B11A.9(gk1120) I. Show Description
This strain is homozygous for a deletion (gk1120) in Y52B11A.9, detectable by PCR using the following primers. External left primer: CAATCCCCTCTCTCATCCAA. External right primer: TATTTGCAACGACACTCCGA. Internal left primer: TGCATATGACGCTCTTCGTC. Internal right primer: TTCCAGCTTCTGCCAAATGT. Internal WT amplicon: 1563 bp. Deletion size: 405 bp. Deletion left flank: GGAGCTTTTCGGCTCAAATTATTGGAATAT. Deletion right flank: ACAAACTACAAAATTTCTAGCCTCTACCAA. Validation: gk1120 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2354 |
C. elegans |
T08G11.2(gk3172) I; pqn-90(gk1127) IV; T10B10.3(gk3173) X. Show Description
T10B10.3, T08G11.2, Y63F8A.8. The gk1127 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: ACAACCCGTGCAAGAAAAAC. External right primer: AAGTGGGACGGAACTGTTTG. Internal left primer: ACAATCGCGTCAGTAGGAGC. Internal right primer: CAGGGTTGTAGGACGTTGGT. Internal WT amplicon: 1894 bp. Deletion size: 1379 bp. Deletion left flank: CCGGTTTTTCTACCGCCATATGTCCCCTCC. Deletion right flank: GGTTGAGTTGCTTGTTGGCATGAACAACTT. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2511 |
C. elegans |
Y52B11A.2(ok3233) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y52B11A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3233 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCGAGCCTCACTCAAAACT. External right primer: AGTGGTCCATATCTCCGTCG. Internal left primer: GAAAATGTTCACGAAACGCA. Internal right primer: GGAGCAGAAAGAGGTGCTTC. Internal WT amplicon: 1301 bp. Deletion size: 675 bp. Deletion left flank: ACTAATAGAAAATTCAAAAATTGGGTGAGA. Deletion right flank: AAGATCCTAAAACTATTTTAAACTTCTTTT. Insertion Sequence: TAGATCCTAAAACAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2534 |
C. elegans |
nhr-281(gk1108) X. Show Description
F16B12.8, C24A1.3. External left primer: GCGTCCACAAAAGTGTCAGA. External right primer: GGTTTGAGAATTGCCGGATA. Internal left primer: CAACACCGTGGCATTTAGTG. Internal right primer: CCTTCACTGCACGCTAAACA. Internal WT amplicon: 1959 bp. Deletion size: 1071 bp. Deletion left flank: ACGAGGCTCAGATTGTTTATGAAATCAAAA. Deletion right flank: AAATAAAATGTGTTCTTTGGAGACAGAATA. Insertion Sequence: TTATAGGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2536 |
C. elegans |
W02B12.11(ok3260) II. Show Description
W02B12.11. External left primer: AAAAGACCGGACAACCACTG. External right primer: AACCTACATCAACTTCGGCG. Internal left primer: CAGCCGGATTTCTTTTCTGA. Internal right primer: CCGTTTCCTCTTCACATGCT. Internal WT amplicon: 1242 bp. Deletion size: 481 bp. Deletion left flank: ATTTACAGCCGGATTTCTTTTCTGATCCCC. Deletion right flank: CAGCGCCGAAGAGGACGGATCTTGTCCAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2538 |
C. elegans |
C08B11.3(gk1041)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C08B11.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk1041 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATCTCGATCGACACTTCGCT. External right primer: TAACATATCGACGTTGGGCA. Internal left primer: ACGGCTCGTCTGTTCTGATT. Internal right primer: AATTGACGGATCCACCTGAG. Internal WT amplicon: 2394 bp. Deletion size: 561 bp. Deletion left flank: GATCAATCTGAAATTCATTTTTCAAATTAT. Deletion right flank: TGCAAAATCGATTTCGTTCGGCAATCCAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2539 |
C. elegans |
noah-2(ok3197) IV/nT1 [qIs51] (IV;V). Show Description
F52B11.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3197 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCTTAGGCACAGACGTAGG. External right primer: CACTGAGAGCGAGACGACTG. Internal left primer: GCACTGCTTCTTCCTGCTTC. Internal right primer: CAGAGAAGCTCGGTGGAGTC. Internal WT amplicon: 1129 bp. Deletion size: 806 bp. Deletion left flank: TGAATCCCAATTCGGAGGAATGGCTCTCTG. Deletion right flank: AGGAGAAGCTTTCGGCTATCATTCGAGTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC259 |
C. elegans |
pak-2(ok332) V. Show Description
C45B11.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2666 |
C. elegans |
ceh-6(ok3388) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K02B12.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3388 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTCTTTCTTCCAGCTTGCC. External right primer: TAGGGCCAGAAAATTGAACG. Internal left primer: AAATGTAGAATTGGGCGAGC. Internal right primer: GGTAGGCGCACATACCATTT. Internal WT amplicon: 1129 bp. Deletion size: 405 bp. Deletion left flank: TCTGAATAATTTCAGGTCGTTCAACTTCCT. Deletion right flank: AAAATGGTATGTGCGCCTACCAATTGAAAA. Insertion Sequence: AAAAGGATTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2676 |
C. elegans |
M01B12.5(gk1101) I. Show Description
M01B12.5. External left primer: CGCCAATCCTGGTTTAAATG. External right primer: AGAACCTCTTTTGCGGGTTT. Internal left primer: ATTCCCACGCAAATAAATGG. Internal right primer: TCGAGCTGATCGTGCTACTG. Internal WT amplicon: 2467 bp. Deletion size: 575 bp. Deletion left flank: GGGAATAAATTCAATTTTTTTTCATTTTTT. Deletion right flank: ATTTTTTAAAATAAAAATATTAAATGTTTT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2763 |
C. elegans |
myrf-1(ok3445)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F59B10.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3445 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCCGTAGTTTCGGTTATGCC. External right primer: AGCTTTGCTGGTATTGACGG. Internal left primer: TCAAGGACATAAAGAGCTGACA. Internal right primer: GTCAGCAACAGGCAATCAGA. Internal WT amplicon: 1381 bp. Deletion size: 636 bp. Deletion left flank: GAAGACAAGCGGCCATAATGGAAACCAAGG. Deletion right flank: ACAGGGCTCCTCCATTTCGTTGCCATCCAA. Insertion Sequence: GCTCCTACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2775 |
C. elegans |
cct-2(ok3438)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T21B10.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3438 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGATCCTGAAGTCAATCGGT. External right primer: CAGCAACCTCTCCTTTCTCG. Internal left primer: TCCTCAAAGAAGCCGAGAAA. Internal right primer: AATGAACAAACCGATTCCCA. Internal WT amplicon: 1112 bp. Deletion size: 633 bp. Deletion left flank: AAGATTCTCATTGCCAACACACCAATGGAC. Deletion right flank: GACTCGGCTGAACTTGTCACAAGACTCCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC30222 |
C. elegans |
Whole-genome sequenced strain. Show Description
Do not bleach! NOTE: VC30222 does not grow well on E. coli OP50, but does grow well on plates of OP50 mixed with other E. coli strains. It has been grown successfully on HB101 and X1666, and on plates containing unknown bacterial contaminants. Avoid egg-prepping onto OP50 plates. Million Mutation Project strain. This strain was isolated after ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
VC3054 |
C. elegans |
F52B11.2(ok3718) IV/nT1 [qIs51] (IV;V). Show Description
F52B11.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3718 homozygotes (early- to mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTCCTGAAATATGGCGGAGA. External right primer: TCTTCTGGCCCTTCAACAGT. Internal left primer: ACACGAAGCACTGGCTTTTT. Internal right primer: GTCCGACAGTCCGTTCGT. Internal WT amplicon: 1267 bp. Deletion size: 518 bp. Deletion left flank: AATGTATTATTTTCCATTTTCCGAATTTTT. Deletion right flank: CGGATTCAAGGGCACCGAACCGTATCCAGT. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC315 |
C. elegans |
+/eT1 III; mrck-1(ok586)/eT1 V. Show Description
K08B12.5. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok586 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC3279 |
C. elegans |
C01B12.2(gk3198) II. Show Description
This strain is homozygous for a deletion (gk3198) in C01B12.2, detectable by PCR using the following primers. External left primer: TCAAAAATTTGCGAAACGTG. External right primer: AGGGAGTGAGCGAGAAACAA. Internal left primer: CTACATTGGTCCGACCCCTA. Internal right primer: ATGAGCTTTGCCCTGAAAGA. Internal WT amplicon: 1379 bp. Deletion size: 941 bp. Deletion left flank: AAGTTAAGCAATTTACTCAAATTATTTCAG. Deletion right flank: TGAATTTCGCAATAAAACTTTTTGGAAATT. Insertion Sequence: ATTTTT. Validation: gk3198 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC3288 |
C. elegans |
myrf-1(gk3366)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F59B10.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3366 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATCCATTTGAATCCTCGCTG. External right primer: AGCTTCCGATACAATGCCAC. Internal left primer: GTACCGGTGATTCGCTTTGT. Internal right primer: GAGCCGATCGTAAACCACAT. Internal WT amplicon: 1767 bp. Deletion size: 761 bp. Deletion left flank: TTACAAGATGGATTGAAGCATTTTTCAAGT. Deletion right flank: CGAATATCGGATGGATTGATTATTCGGCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC3326 |
C. elegans |
W02B12.12(gk3362) II. Show Description
Homozygous viable, carrying a deletion in W02B12.12. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC3364 |
C. elegans |
F37B12.3(gk3365)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F37B12.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3365 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAAATTTGCGTCAAAGTACGGT. External right primer: CCTATACACCTCTCATGCCTCC. Internal left primer: GGGTACCGTATTTTAGCGCA. Internal right primer: CCTGACGAATTGCCATCTTT. Internal WT amplicon: 2539 bp. Deletion size: 983 bp. Deletion left flank: GTGACAAGTTAAAGCGAATGGACCGAACAA. Deletion right flank: TGGAATTTAATAAAAATGTGTGGCTGTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC3365 |
C. elegans |
C02B10.5(gk3509) IV/nT1 [qIs51] (IV;V). Show Description
C02B10.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3509 homozygotes (sterile, eggs don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAATCCACAGAACCG. External right primer: TTGCGGTAGCTTAGGCAGAT. Internal left primer: CCTGAGTCATCTCCTGCACA. Internal right primer: AGAGCGGGATCTGGAAAAAT. WT internal amplicon: 2056 bp. Deletion size: approximately 600 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC337 |
C. elegans |
gcs-1(ok436)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F37B12.2. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- ok436 homozygotes (approximately L2 arrest). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC3477 |
C. elegans |
C02B10.5(gk3390) IV/nT1[qIs51] (IV;V). Show Description
C02B10.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3390 homozygotes (sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAATCCACAGAACCG. External right primer: TTGCGGTAGCTTAGGCAGAT. Internal left primer: CCTGAGTCATCTCCTGCACA. Internal right primer: AGAGCGGGATCTGGAAAAAT. Internal WT amplicon: 2056 bp. Deletion size: 775 bp. Deletion left flank: CGGCGGAGCAAGAGTATTATTATTTCACGT. Deletion right flank: GCTGGAGATGATGGCGAATTCTTCGAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC3680 |
C. elegans |
T23B12.11(gk3652) V; igcm-2(gk3654) X. Show Description
Homozygous viable. Splicing defect and nonsense allele identified by amplicon sequencing.
|
|
VC3742 |
C. elegans |
C52B11.5(gk3700[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 1047 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTATTTGGACAACGCTCTGTGCACAAATCA; Right flanking sequence: TGGCTTAACGAATGAAGATAATGGATTCAA. See WormBase Variation gk3700 for details.
|
|
VC3933 |
C. elegans |
R01B10.6(gk5008[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1561 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATAAAGGCAAAGTAGAAAATGACCAGCGAG; Right flanking sequence: ATAGGAAAACAAATATTGTTAAAAAATTTA. See WormBase Variation gk5008 for details.
|
|
VC399 |
C. elegans |
fntb-1(ok590) V/nT1 [qIs51] (IV;V). Show Description
F23B12.6. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and GFP- ok590 homozygotes (early larval arrest, probably L2). nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC4095 |
C. elegans |
srz-5(gk5186) II; R09H10.7(gk5187) IV; F54B11.7(gk5188) X. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5186 mutation is C->T, flanking sequences TCCGAGATATAGCAGAATTATGATCCAGGA and CAATTTTTTTGATTTAAAATCCATTTTTTG. The gk5187 mutation is G->A, flanking sequences AGATATGAGCGAAGATAAAGTTCTTATTAG and TAAGTAGCTTATTTTTTTAGAAAAAAACAT. The gk5188 mutation is C->T, flanking sequences GAAATCGCCAACATCAACCATTCAGTTAAA and AGCTTCTAACTGATATGGATACGGTGAAAG.
|
|
VC4194 |
C. elegans |
W02B12.12(gk5279[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 2228 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCCATGGCAAAGCAAGGCAATCGGTTGAT ; Right flanking sequence: TGTGGACTTTTTTTCGAGAAAAAAAATAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4251 |
C. elegans |
C44B11.1(gk5335[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2067 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCGATTTTCAATTTTATTTTTGGACCGGAA; Right flanking sequence: AACGGAACAGTGACACACTTCGAGCTTGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC437 |
C. elegans |
nhr-233(gk223) V. Show Description
Y32B12B.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC4607 |
C. elegans |
F59B10.3(gk5677[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
[NOTE: Please see RG5016 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2307 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GAGAAGAGGCGGAGGATTGCGGCGATATGT. Right flanking sequence: CGATTTTCTGTAAATATTTGCTCAAACCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC463 |
C. elegans |
rsp-2(ok639) II. Show Description
W02B12.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC505 |
C. elegans |
ace-1(ok663) X. Show Description
W09B12.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC526 |
C. elegans |
tir-1(gk264) III. Show Description
F13B10.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC538 |
C. elegans |
+/szT1 [lon-2(e678)] I; gar-1(gk269)/szT1 X. Show Description
C15B12.5a. Apparently lethal deletion balanced by lon-2-marked translocation. Heterozygotes are WT and segregate WT, arrested szT1 aneuploids, Lon-2 males (szT1 hemizygotes) and gk269 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC551 |
C. elegans |
nhr-233(ok770) V. Show Description
Y32B12B.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC602 |
C. elegans |
trp-2(gk298) III. Show Description
R06B10.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC652 |
C. elegans |
ant-1.4(gk300) IV. Show Description
T01B11.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC689 |
C. elegans |
dsl-4(ok1020) X. Show Description
F16B12.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC704 |
C. elegans |
vrk-1(ok1181)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F28B12.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1181 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC734 |
C. elegans |
fbxb-66(gk320) I. Show Description
Y40B1B.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC762 |
C. elegans |
Y54E10BR.1&arx-7(ok1118) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y54E10BR.1, M01B12.3. Homozygous lethal deletion chromosome balanced by bli-4- let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1118 homozygotes (early- to mid-larval arrest). Homozygous hT2[qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC802 |
C. elegans |
inso-1(gk344) X. Show Description
C52B11.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC894 |
C. elegans |
puf-9(ok1136) X. Show Description
W06B11.2. Gro, Unc, lethargic, often explodes at vulva. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|