F21F3.1. Homozygous. Outer Left Sequence: TCTCCACATCCTCATCTCCC. Outer Right Sequence: CGGTGGCCTAGAAAAACAAA. Inner Left Sequence: CGTTGAAAATGTATGAGCCG. Inner Right Sequence: TGGAGGTGCAGGTTCTACAG. Inner Primer PCR Length: 1269 bp. Deletion Size: 572 bp. Deletion left flank: GTGTTTTTTGTGTGTGAGTGTGTGTGTGTG. Deletion right flank: GACTATTCAACCCCAGCAAAGAAATCGGTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W04A4.4. Homozygous. Outer Left Sequence: AAGTAACATGCTCATCCCCG. Outer Right Sequence: TTGAATGCATGAGTTGCTCC. Inner Left Sequence: TTTGTTCCCCTATTCGCATC. Inner Right Sequence: GCCAAAAGGCTATCCTATGATCT. Inner Primer PCR Length: 3177 bp. Deletion Size: 1678 bp. Deletion left flank: GTAGAAAAAAATACCGTTTTTTGTTTGAAG. Deletion right flank: CCCAAATTGCTCTTGTTGATCCTTACAGAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F47G4.7. Homozygous. Outer Left Sequence: AAACAGGAAAGGGGGAGAGA. Outer Right Sequence: AAGCCTTCAGATTCAAGCGA. Inner Left Sequence: CGACAAAGAGATGGGGAGAA. Inner Right Sequence: CGCACTCCAGGTCATAGACA. Inner Primer PCR Length: 3240 bp. Deletion Size: 1093 bp. Deletion left flank: GAGCGTAGACTAGGGTTTCCGTCTGCAAAT. Deletion right flank: GAACTCAACTTCTCTGTGGAATGTGTAAAG. Insertion Sequence: CAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M7.2 Homozygous. Outer Left Sequence: aaatggcgccaagagatatg. Outer Right Sequence: tcacgcaattttgagttcgt. Inner Left Sequence: attgtcaggctgctggatct. Inner Right Sequence: cgattcaataattttcgggg. Inner Primer PCR Length: 2292. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F39B2.2. Homozygous. Outer Left Sequence: GAAATGCGTACTCGCACTGA. Outer Right Sequence: GGAAAAGTTCGAGGGGAAAG. Inner Left Sequence: ACGGATTTATTCGGATGGGT. Inner Right Sequence: TACCGGGGAGAGTAAACTGG. Inner Primer PCR Length: 1301 bp. Deletion Size: 480 bp. Deletion left flank: CTTGTCCGAGAGGACTACACAGTTAGCCTT. Deletion right flank: CCGTTCGTTTCACCACCAAAGTTCACATGG. Insertion Sequence: TGCAAACGCGCTCCACT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y66H1B.2. Homozygous. Outer Left Sequence: AGCGAGTCCAGTGTCGATTT. Outer Right Sequence: CGCTTACCGAAAATGCAAGT. Inner Left Sequence: GACGTCCTGGGAAGAACTTG. Inner Right Sequence: TCCAAAACTTTAAACCGCCA. Inner Primer PCR Length: 3218 bp. Deletion Size: 1763 bp. Deletion left flank: TTAAAAATATTGAGTTTCAACAATTTTACA. Deletion right flank: ATCGCGTAGACTCCTGGTTCTGTTGGAGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1248.15. Homozygous. Outer Left Sequence: GTACATGCAATGAGACCGGA. Outer Right Sequence: GTTTTCATGGAAGAGGCCAA. Inner Left Sequence: GAAGGTACATTCGTCATCCGA. Inner Right Sequence: ACCACGTGTTCCATGGTCTT. Inner Primer PCR Length: 1119 bp. Deletion Size: 577 bp. Deletion left flank: AAGAGTGATCTCGTCTGCTAGTGGGATCGA. Deletion right flank: AGCCGTTTATCTGAATCTGTTGCTCTGTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26A3.6. Homozygous. Outer Left Sequence: TCATCGCTTCTACGTGCATC. Outer Right Sequence: ATAATTGGAAGGGTTTCCCG. Inner Left Sequence: TAGCCCCCTACACCTCACAG. Inner Right Sequence: TAAATCGGCACCTGCTTTC. Inner Primer PCR Length: 1222 bp. Deletion Size: 350 bp. Deletion left flank: TATATAAATAAGACACAACTGGCGTCGATT. Deletion right flank: ATAATCAGCTGCTTCACGAAGCGATGGATT. Insertion Sequence: TCGTGAAAGCAGCTGATTACGAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C02C6.3. Homozygous. Outer Left Sequence: CGTGTCTCTTCACATGCGTT. Outer Right Sequence: AAGTGAGGGAAAAGCAGCAA. Inner Left Sequence: CATTTGCTGAAAAACGCTGA. Inner Right Sequence: GCTGGCAGGTGGTTAAATGT. Inner Primer PCR Length: 2605 bp. Deletion Size: 1841 bp. Deletion left flank: TTTTCAAATAGACGATTTAACCTCTTAATA. Deletion right flank: AATTTTGGGTTGGGTCTTGGTTTAATATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K10B2.1 Homozygous. Outer Left Sequence: cgttttcatcgttttccgtt. Outer Right Sequence: attttatgggccaccatctg. Inner Left Sequence: caccgagcttcaacaactca. Inner Right Sequence: ctcttcgtctacgtcgcctc. Inner Primer PCR Length: 2567. Deletion size: about 1100 bp. [NOTE (08/24/2021): A user has reported that their stock of RB1981 received directly from RB appears to be heterozygous. Not known if that is also the case for CGC stock.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K09F5.2. Homozygous. Outer Left Sequence: AGCGTGAGCTCAAGGAGAAG. Outer Right Sequence: AGCTTCGTATCCACGACGAC. Inner Left Sequence: ACAAGGATGCTGAGACCACC. Inner Right Sequence: GCTACTGGCTCAACGGAGAA. Inner Primer PCR Length: 3252 bp. Deletion Size: 1797 bp. Deletion left flank: AAGGAAGCCATTGATGCCCTCAGACTTCTT. Deletion right flank: CGTGAAGTTCAACTCTCTCTTACCTCTACC. Insertion Sequence: CTTTCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K05F1.5. Homozygous. Outer Left Sequence: CTCACATTCACCCAGTGTGC. Outer Right Sequence: AACATCCCAACCACGAACTC. Inner Left Sequence: TTGGTGAGTACACCCTGAACA. Inner Right Sequence: TATTGCAAGTTGTTTTGCGG. Inner Primer PCR Length: 3142 bp. Deletion Size: 1240 bp. Deletion left flank: CCATTTGTCGTCAGGAACATTGGCTAGAAA. Deletion right flank: TGCACATATCTTCTGTTAAATTGTCCTTTT. Insertion Sequence: CATATTTTTTGTTAAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F08H9.5. Homozygous. Outer Left Sequence: TTATCCGGACAATCCGTAGC. Outer Right Sequence: AAAGCAATCCGGTCAATACG. Inner Left Sequence: ACTTCAATACACCGGATGGC. Inner Right Sequence: ACTTTGTGCCAGCCAACTTT. Inner Primer PCR Length: 2163 bp. Deletion Size: 1295 bp. Deletion left flank: TTATAAAAGAAAAATTGTATTTTTTTGAAA. Deletion right flank: TTTATTATGTGAATGCTCCAACTGGATTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C48B4.1. Homozygous. Outer Left Sequence: TTTCCCCAACACAAACCATT. Outer Right Sequence: TGACGTGGATGGCTTAAACA. Inner Left Sequence: CCAATGGTGCCATTTCTTCT. Inner Right Sequence: ATGAAGTAACCAAGCGGTGG. Inner Primer PCR Length: 3288 bp. Deletion Size: 1509 bp. Deletion left flank: TACGAACAGCTGAATATCGAATTGAAATAG. Deletion right flank: AGTTCCGTTTGGGCATAAGTTCCAATGATC. Insertion Sequence: GTTCCAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y111B2A.19 Homozygous. Outer Left Sequence: attttcggtaatttgccggt. Outer Right Sequence: aaaattacgctccgcctctt. Inner Left Sequence: tctgccagtttgctggaaat. Inner Right Sequence: tgcgcgacgctacttataga. Inner Primer PCR Length: 3222. Deletion size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y40C5A.4. Homozygous. Outer Left Sequence: CAGAAGCGTTTTGCTGTGAC. Outer Right Sequence: TTTTTGTGGGTGTGATTGGA. Inner Left Sequence: TGGGTCAACGATAAGATCCC. Inner Right Sequence: TTGCACTCATCAGTATTGTTCAC. Inner Primer PCR Length: 3131 bp. Deletion Size: 1099 bp. Deletion left flank: TGTGCAACATCTCGTTATGAGATAACAAAA. Deletion right flank: AAAAAGTATATTAGGGCAGGAATATGGGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK617.3. Homozygous. Outer Left Sequence: TGCTGCACCTAACAATCAGC. Outer Right Sequence: CAAGCGAACAGCAGTCACAT. Inner Left Sequence: GCTTGAATTTTTGACTGTGGC. Inner Right Sequence: GTTGTCGAATTATTGCGGCT. Inner Primer PCR Length: 1167 bp. Deletion Size: 285 bp. Deletion left flank: GGTAATCTCTAGTTGTCTTCCAGTTTCAGT. Deletion right flank: CTCGGAAGTTGAGAACGTGGCGGCCACGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T06C10.4. Homozygous. Outer Left Sequence: CCTATGATCCAAGCCCTCAA. Outer Right Sequence: AAAACTTGACGACTGGTGGG. Inner Left Sequence: TCCAATTAACGTTTATGACCGA. Inner Right Sequence: GCATGATGACGTGGATTTTG. Inner Primer PCR Length: 1168 bp. Deletion Size: 682 bp. Deletion left flank: CCCATCTCACTAATTATACGCCTAAATCTT. Deletion right flank: ACATTCGATTCGGAAAACGAAGAGTCGATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F49E10.3. Homozygous. Outer Left Sequence: GAAGGCGGAGTCATAGCATC. Outer Right Sequence: TGAAGGACTGGAAAACAGGC. Inner Left Sequence: ATGAGAAGAAGGGGGTGGAG. Inner Right Sequence: TTGGGTAGCGACCAATCTGT. Inner Primer PCR Length: 1302 bp. Deletion Size: 548 bp. Deletion left flank: TCCTATTTTTTCTATTTTTTATATTTTTCA. Deletion right flank: TGCAAACACCTTGATTACCAAGAACAAAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26F2.1 Homozygous. Outer Left Sequence: attttcgaaacgccaagcta. Outer Right Sequence: tgagcaacagtttcaggacg. Inner Left Sequence: tcatttgagcttgttgctgg. Inner Right Sequence: gcggagggtaagagatttttg. Inner Primer PCR Length: 3101. Deletion size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C44B9.1 Homozygous. Outer Left Sequence: acaccctggcacactttttc. Outer Right Sequence: ggatacattttcccgctcaa. Inner Left Sequence: taattttgcttgcttccgct. Inner Right Sequence: aatcaccgtccttctggaaa. Inner Primer PCR Length: 3150. Deletion size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06B3.3 Homozygous. Outer Left Sequence: ggcaaagatcacaattccgt. Outer Right Sequence: tgggaatgggaagagatttg. Inner Left Sequence: aaggcttcgcatctcttgg. Inner Right Sequence: tgcaaggtaccattaaccga. Inner Primer PCR Length: 1208. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C32H11.12. Homozygous. Outer Left Sequence: TTCCGTGATCACAATTGACC. Outer Right Sequence: GGTTAACCTCCCCAATTCGT. Inner Left Sequence: TGTGTCCCGAGTAACAACCA. Inner Right Sequence: ATTGTCGTCACTTTTCGGCA. Inner Primer PCR Length: 1260 bp. Deletion Size: 401 bp. Deletion left flank: CCATGAACAGTGGATAATCGATGAGCTTAT. Deletion right flank: TTCTGGAGCCTGAATAGAACTATATTTAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F35E2.1. Homozygous. Outer Left Sequence: TGCGGATCTTGTTGTCTGAG. Outer Right Sequence: ATGGAACTTGTTCGGGTGAG. Inner Left Sequence: AAGGCGTATGTCCGAAGATG. Inner Right Sequence: CAATTGATTTGTAGACTGATTGGAA. Inner Primer PCR Length: 1374 bp. Deletion Size: 311 bp. Deletion left flank: ACTCTCTCATAGTTTATAGTGTGGGAAAGT. Deletion right flank: TTTGGGAAACATCCACATAAAGCTGTATCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25E5.3, F25E5.10. Homozygous. Outer Left Sequence: CGAGGGAACAACTCCAGAAG. Outer Right Sequence: CTTGTTCGCAGTGTTGCAGT. Inner Left Sequence: TGTCCACATATGAGTCTGCCA. Inner Right Sequence: TGAACGACAATCTGGACATGA. Inner Primer PCR Length: 3023 bp. Deletion Size: 1520 bp. Deletion left flank: CAGCTTCAAGCAACATGTGGACGTAACACA. Deletion right flank: CATGGAACTTACTCACGGCGGCACCTCCAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W08D2.7. Homozygous. Outer Left Sequence: CAGCTCACACATCTGCTGGT. Outer Right Sequence: AGAGCATCATCGTTTCCCAG. Inner Left Sequence: CGTCTCCAATCAAAGCACTG. Inner Right Sequence: CACTTTTTCTTTCGGCTTTCA. Inner Primer PCR Length: 3060 bp. Deletion Size: 1554 bp. Deletion left flank: CTTAAAATATTTTTAACTTCAGAATGGGTC. Deletion right flank: AAAGAATTATTCAAATTCAACGAGAACCCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W06B11.4. Homozygous. Outer Left Sequence: TGAAGCTAATGCTGAACCGA. Outer Right Sequence: CAGTACAAACGGCTGCACAT. Inner Left Sequence: TTGTGGCCTAAAATGCAAAA. Inner Right Sequence: TCATGCTTGTTTTTCTACCGA. Inner Primer PCR Length: 1280 bp. Deletion Size: 487 bp. Deletion left flank: GTAGTTTTCTAAAATTTTATTGTTAACAGT. Deletion right flank: AGATAAGATGTTTTGCAGATACAGCGAGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T02E9.2. Homozygous. Outer Left Sequence: AGACCCTCCGTACCTGGTTT. Outer Right Sequence: CTTTGAATGGCAGTGTGACG. Inner Left Sequence: AAGCTCGGAAGCGTGCTG. Inner Right Sequence: CTATTGCATAACCGCCCATC. Inner Primer PCR Length: 1207 bp. Deletion Size: 424 bp. Deletion left flank: CGATTCCTGAGCTGTAGCAACTTCCGCGAC. Deletion right flank: CGGAATAGCATTCTGGAAATAGAATCAACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C39B10.1 Homozygous. Outer Left Sequence: tgtggacaaccaggagcata. Outer Right Sequence: gtgtttccgggattcacaac. Inner Left Sequence: tgaagcatcagtgaggtagaatg. Inner Right Sequence: tcttgtcctgatccttctaggc. Inner Primer PCR Length: 1189. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C39B10.1 Homozygous. Outer Left Sequence: tgtggacaaccaggagcata. Outer Right Sequence: gtgtttccgggattcacaac. Inner Left Sequence: tgaagcatcagtgaggtagaatg. Inner Right Sequence: tcttgtcctgatccttctaggc. Inner Primer PCR Length: 1189. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13B10.1. Homozygous. Outer Left Sequence: CGGGAGATAGAAGGCATCTG. Outer Right Sequence: ACGGGGCTTAATTTCCTCAT. Inner Left Sequence: AAACCTTCGAAAATCGAGCA. Inner Right Sequence: CTGCCAGTCCTGTTGCTCTT. Inner Primer PCR Length: 1356 bp. Deletion Size: 354 bp. Deletion left flank: ATTTGTGAGCATTTGGTAGGTGTAAACAGA. Deletion right flank: GGAGGCCACTTCTTTTAATGCTTGGATTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13B12.6 Homozygous. Outer Left Sequence: cgaacgatgctacgagatga. Outer Right Sequence: aacacggaaaaatcaaacgg. Inner Left Sequence: ctggttgtcttgctgtccaa. Inner Right Sequence: aaaggataccgccgaaaaat. Inner Primer PCR Length: 1294. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y75B12B.2 Homozygous. Outer Left Sequence: acttccggattgttgacctg. Outer Right Sequence: agctcatccgtgtgcttctt. Inner Left Sequence: gtgaagagctggcaacaatg. Inner Right Sequence: tgattcccgctctattaccg. Inner Primer PCR Length: 1175. Deletion size: about 600 bp. cyn-7 was formerly known as cyp-7. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55B11.1 Homozygous. Outer Left Sequence: acttgcgcacaaacattcag. Outer Right Sequence: ccaaaaagtcaatgcagggt. Inner Left Sequence: gcattgtttcatcgtttcca. Inner Right Sequence: cagtttcacgcaattgatttt. Inner Primer PCR Length: 1211. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T01B10.2 Homozygous. Outer Left Sequence: tctgccacagtatttgctgc. Outer Right Sequence: gcgaatccaatgagaaggag. Inner Left Sequence: tatgatgacctcccaaagcc. Inner Right Sequence: cgctgctgaatacacaccat. Inner Primer PCR Length: 1246. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01B12.3 Homozygous. Outer Left Sequence: aaccatttccctcatttcca. Outer Right Sequence: tcatcatcctctcccaaagg. Inner Left Sequence: tcactcgatgttgcttcttctt. Inner Right Sequence: gagaagcacttcggcaactt. Inner Primer PCR Length: 1105. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13B12.4 Homozygous. Outer Left Sequence: gcgtcgactggtcaattttt. Outer Right Sequence: tcttcgcaatgcaaaagcta. Inner Left Sequence: agcaagcacaaaactcatgc. Inner Right Sequence: cgacaaaaaccacggattcta. Inner Primer PCR Length: 1126. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15B10.2 Homozygous. Outer Left Sequence: tcaccgatccagttgcatta. Outer Right Sequence: aacccaacagtatccctcca. Inner Left Sequence: taatgcttgttgctcatccg. Inner Right Sequence: acacgcaacgcagttttatt. Inner Primer PCR Length: 1136. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F31B12.2 Homozygous. Outer Left Sequence: gcggcaattattgggattta. Outer Right Sequence: tcagtggtcaaattggtgga. Inner Left Sequence: caaccgaacatcaaattctcaa. Inner Right Sequence: agttttgtggagggttgcag. Inner Primer PCR Length: 1328. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y55B1BR.2 Homozygous. Outer Left Sequence: gtggcgtcagagtgtctcaa. Outer Right Sequence: taatcctaaggcaaagccca. Inner Left Sequence: ggtggagagacgcagagttc. Inner Right Sequence: ccaaagcctaagcctgagc. Inner Primer PCR Length: 1323. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57B10.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B12.8 Homozygous. Outer Left Sequence: CGAGAACCTGCTTTTCAAGG. Outer Right Sequence: CAATCTTGTGCTACTGCCGA. Inner Left Sequence: ATTTGCTGCGAACCTTGACT. Inner Right Sequence: GCCGCGAATCATTGTATTTC. Inner Primer PCR Length: 2690. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C44B12.7. Homozygous. Outer Left Sequence: GGTCAGCGGTGTAACTTGGT. Outer Right Sequence: CATAACCGGGATATCGGATG. Inner Left Sequence: TCAAGTTGCCGGAAGTTTTT. Inner Right Sequence: TGAATAAAGCCTCCCAGTCG. Inner primer WT PCR product: 2120. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y76B12C.2. Homozygous. Outer Left Sequence: ATTGGCAAAAGGTGAACGTC. Outer Right Sequence: CAGTTTCAAAGCATTTCGCA. Inner Left Sequence: CGGAAGATGAATGGGAAGAA. Inner Right Sequence: GACAAGCGACTCGTCTAGGG. Inner primer WT PCR product: 2715. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15B12.5 Homozygous. Outer Left Sequence: TGCAAATTTGAAAATGCCAA. Outer Right Sequence: CAAGTTCCGCACATCTCTGA. Inner Left Sequence: CGATTGGTAAAAGTTGGGGA. Inner Right Sequence: GTTTCCCTCGCCATATCAGA. Inner Primer WT PCR product: 3158. Deletion size: 1264 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R01B10.5 Homozygous. Outer Left Sequence: CGTTATTAAAAGGCACCCGA. Outer Right Sequence: CCATGTCATCATTGTCTGGC. Inner Left Sequence: TCTTTGGAAATTCGGGTGAC. Inner Right Sequence: GCCATCATGTCTCGGATTCT. Inner Primer PCR Length: 2994. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T20B12.6. Homozygous. Outer Left Sequence: TTCTGTGGTGGCTGCTAGTG. Outer Right Sequence: AAAGCGACAAGAAACATCCG. Inner Left Sequence: TGCTACAGACGATGCGAAAG. Inner Right Sequence: CAATTGAAAGCAAGTTGCGA. Inner Primer WT PCR product: 2807. Deletion size: 1390 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 1668 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve644 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tacgcaaacatgacacctgacgacatttca ; Right flanking sequence: GTGGGAAATTCGCTCCAAAACACGAAGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile, slight Dpy. Deletion of 1939 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 slight Dpy sterile adults (ve648 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: acggttaattgaaaatgctccgcccccgaa ; Right flanking sequence: GTTGGGATGCTTCAAAAAGTCGGACAAAAT. sgRNA #1: cctaacgagagccatggttc; sgRNA #2: GTCCGTCACTTGAAGCAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous sterile. Deletion of 1965 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults(ve673 homozygotes) and non-GFP Unc animals (hIn1[unc-54(h1040)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: ggaaTCACTTGGTCACTTGTGTAGTATCAC ; Right flanking sequence: aggaatatcacgaaaaaatgcgaaatttgg. sgRNA #1: GCATTTGAATGGAGCGGAGC; sgRNA #2: ccaaaaatgcaatttcagcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.