More Fields
Strain Species Genotype
RB1931 C. elegans feh-1&nhr-239(ok2526) III. Show Description
Y54F10AM.1, Y54F10AM.2. Homozygous. Outer Left Sequence: ACAACATCCACCATCCACCT. Outer Right Sequence: ATAACCTTATGCCCAAGCCA. Inner Left Sequence: TTTTCAGATTCTAGGCCGTCA. Inner Right Sequence: GAGCCTAAGCCTAAGCCCAC. Inner Primer PCR Length: 3094 bp. Deletion Size: 2350 bp. Deletion left flank: CAAATTAGACTTAGGCTTTAAATTGTTTGT. Deletion right flank: AAACCGGCAAATTGATTTGCCGAATTTGCC. Insertion Sequence: TTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1932 C. elegans ZK418.8(ok2535) III. Show Description
ZK418.8 Homozygous. Outer Left Sequence: aaaaccggtgaagtttgagg. Outer Right Sequence: catttgcgaaatgggaaagt. Inner Left Sequence: ttttcgagctacaacgacttttt. Inner Right Sequence: attgcgagcccatttgttat. Inner Primer PCR Length: 3125. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1933 C. elegans F56D12.5(ok2536) II. Show Description
F56D12.5 Homozygous. Outer Left Sequence: aatatcgcaacggtgtctgg. Outer Right Sequence: tctagcagaccaatttgggg. Inner Left Sequence: gttcttgcaggtatccccat. Inner Right Sequence: cagcagcacaattcattcaaa. Inner Primer PCR Length: 3037. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1934 C. elegans W07B8.4(ok2537) V. Show Description
W07B8.4 Homozygous. Outer Left Sequence: caatggggtttcaaagcaat. Outer Right Sequence: gccgattttcagttagcctg. Inner Left Sequence: catgtattcctcgggattcg. Inner Right Sequence: ttcgctctgattcacttcca. Inner Primer PCR Length: 3069. Deletion size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1935 C. elegans gcy-20(ok2538) V. Show Description
F21H7.9. Homozygous. Outer Left Sequence: TTGCGACAGCGTATTTTCTG. Outer Right Sequence: TTCGAATTTTCGACCAAAGC. Inner Left Sequence: ACCAGACTCACCTTGGCAAC. Inner Right Sequence: GCTCTGAAAGTCTCGCTGCT. Inner Primer PCR Length: 3244 bp. Deletion Size: 1321 bp. Deletion left flank: GGTCATTTTGGTGGAAGTTGAGGGGCCACT. Deletion right flank: TGAGTGTCTGATTCTATGGTCTTTAATTAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1936 C. elegans M28.4(ok2539) II. Show Description
M28.4 Homozygous. Outer Left Sequence: agcgattccaaaatcactgg. Outer Right Sequence: tgcctggtaggcagaaaagt. Inner Left Sequence: cgctggattgttggttatca. Inner Right Sequence: gtcattggaattggaggtgg. Inner Primer PCR Length: 3023. Deletion size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1937 C. elegans rgs-7(ok2540) X. Show Description
F56B6.2. Homozygous. Outer Left Sequence: ACAGCGCAAGGTAGGTCAAT. Outer Right Sequence: ATCCCCAACAAAATTGGTCA. Inner Left Sequence: GAGTGTCGTCTGCTGGTTCA. Inner Right Sequence: CAGTTTCTCACCTCATCGCA. Inner Primer PCR Length: 3326 bp. Deletion Size: 1491 bp. Deletion left flank: CGTTGCCTTTCATTGCCCACGCACCCGCTA. Deletion right flank: CAGATTCAATGTTGAACACTTATCTGAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1938 C. elegans Y116A8B.5(ok2541) IV. Show Description
Y116A8B.5 Homozygous. Outer Left Sequence: aaaataccggcgtcactgtc. Outer Right Sequence: atggctatttggagtggcaa. Inner Left Sequence: agctgaagcgtcagaaggac. Inner Right Sequence: ggtttggggaaagtgtcaac. Inner Primer PCR Length: 3290. Deletion size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1939 C. elegans C50A2.2(ok2542) IV. Show Description
C50A2.2. Homozygous. Outer Left Sequence: AAAATCGTCGTCGAAACCTG. Outer Right Sequence: CTGACGCAAAATTGCAGAAA. Inner Left Sequence: ACAACGAACCGAGCCGAT. Inner Right Sequence: GTGCGTATTGGGAAGGTAGC. Inner Primer PCR Length: 3005 bp. Deletion Size: 1982 bp. Deletion left flank: ATTTAGTGTGACTAGGTTACTGTAGCACCA. Deletion right flank: CGTCAGATTGTGTTTACCAACAAAAAAAAT. Insertion Sequence: GACTTTTTTCTGCAATTTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1940 C. elegans F55D12.5(ok2543) I. Show Description
F55D12.5 Homozygous. Outer Left Sequence: accatttgcctgttctcctg. Outer Right Sequence: actacaacagcaacccgtcc. Inner Left Sequence: aatcgcactcaggttgttga. Inner Right Sequence: tccaaccacaactaccacg. Inner Primer PCR Length: 1181. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1941 C. elegans rbr-2(ok2544) IV. Show Description
ZK593.4. Homozygous. Outer Left Sequence: GAGGGGAAGATGAGTGTCCA. Outer Right Sequence: GCATGTCAGTGTTGATTCGG. Inner Left Sequence: TGCGTTGCTTGTAATGAAGG. Inner Right Sequence: TGAGCATGCTTCAAGACCAC. Inner Primer PCR Length: 3298 bp. Deletion Size: 1311 bp. Deletion left flank: CGAGTCGAGTAGGAAGTGGATTTCCTCGAA. Deletion right flank: GAGCAAAAGATGCTATCTATCGAGAACAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1942 C. elegans ace-2(ok2545) I. Show Description
Y44E3A.2. Homozygous. Outer Left Sequence: GATGCGGATTTTCGAGTTGT. Outer Right Sequence: ACTTGCCTGCCTAGCAGTGT. Inner Left Sequence: ATGATTCGATGCTTCCCTTG. Inner Right Sequence: ATTCATGAGCACCGATCTCC. Inner Primer PCR Length: 3182 bp. Deletion Size: 1470 bp. Deletion left flank: TCAGCAAAATCAATAAGAGAGCAAGTAAAA. Deletion right flank: GTGTTAGAGAGTGATAATTGGAAAATTGAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1943 C. elegans Y11D7A.8(ok2550) IV. Show Description
Y11D7A.8. Homozygous. Outer Left Sequence: ACGTTATGTCAGATTGCCCC. Outer Right Sequence: CAGAATGAGCCAAACAAGCA. Inner Left Sequence: CCACGATGCCACTAAAAGGT. Inner Right Sequence: AGTCTTTCCATCCGATTCCA. Inner Primer PCR Length: 2844 bp. Deletion Size: 1143 bp. Deletion left flank: ACATCTTTCATTTAATGTTTCGGAATTGCA. Deletion right flank: TTTCATCTATAATTTCAGCATATAGGAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1944 C. elegans M01E5.2(ok2552) I. Show Description
ok2552. Homozygous. Outer Left Sequence: CAAAGATTGTGGCGGAAAAT. Outer Right Sequence: CGGTAGCTGATTTTCGTGGT. Inner Left Sequence: GTTACACCTTTTCCTGGCGA. Inner Right Sequence: CTAAAATTCTGCGGAAACCG. Inner Primer PCR Length: 2997 bp. Deletion Size: 2279 bp. Deletion left flank: ATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAA AATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAA AAATAGATTGTTACACGAAAAAATAGATTGTTAC. Deletion right flank: CAAAAAACTGTGAAAATTCACTTCAACTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1945 C. elegans C10F3.7&fut-8(ok2558) V. Show Description
C10F3.6, C10F3.7. Homozygous. Outer Left Sequence: CAGTCAAAGGTGGCAACTCA. Outer Right Sequence: CGAAAATTGAAGCCCATTTG. Inner Left Sequence: TTGGTGCGAGAAGAACACAG. Inner Right Sequence: CATCAACTCCCACCAAATCC. Inner Primer PCR Length: 2789 bp. Deletion Size: 2239 bp. Deletion left flank: TCTCTACCGTTCATATACTTACCCCATCGA. Deletion right flank: GTAGCAAATGCGGTAATTGCACAATAGGTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1946 C. elegans C30F12.7(ok2559) I. Show Description
C30F12.7. Homozygous. Outer Left Sequence: GGGTGTTCTTGCACCTGAAT. Outer Right Sequence: TTTGAATTTCCTTTGCCCTG. Inner Left Sequence: AGATGTTCATGAAAACGCCC. Inner Right Sequence: GATTGGTCATGGGGCTCTAA. Inner Primer PCR Length: 2691 bp. Deletion Size: 2003 bp. Deletion left flank: TAGGTTCCCATGCTTGAAAATATAAAGTCT. Deletion right flank: TGTGGGTTTATAAAACTTAATGAAAAACGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1947 C. elegans Y106G6A.2(ok2561) I. Show Description
Y106G6A.2. Homozygous. Outer Left Sequence: TTCGGCTGACATGAAGACTG. Outer Right Sequence: CTTCAACAGCAAATGCCTGA. Inner Left Sequence: CGAAGGGTATGGGGAGAAAT. Inner Right Sequence: GGGGAACGAAACCCATAAGT. Inner Primer PCR Length: 2400 bp. Deletion Size: 1281 bp. Deletion left flank: GTGCGCCTTTAGAGTACTTTAGTTTCAAAC. Deletion right flank: AACCGGGTTATTGTCGATTCAATATTCATG. [NOTE (11-18-2015) A user has reported that this strain was heterozygous for ok2561 by PCR analysis.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1949 C. elegans tra-2(ok2563) II. Show Description
C15F1.3 Homozygous. Outer Left Sequence: aaccagaaaagtcgccttga. Outer Right Sequence: tccacatcaagcatccagaa. Inner Left Sequence: ttggtgtgatggcaaagatg. Inner Right Sequence: atgcattcctgcgattcttc. Inner Primer PCR Length: 3370. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1950 C. elegans F38A6.3(ok2564) V. Show Description
F38A6.3 Homozygous. Outer Left Sequence: aatcttgacgtcctctggga. Outer Right Sequence: acggaggtatgaggacaacg. Inner Left Sequence: tggaagacaatcggaaaagg. Inner Right Sequence: taaatcggagccagatccac. Inner Primer PCR Length: 2977. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1951 C. elegans gcc-1(ok2565) X. Show Description
C15C7.2 Homozygous. Outer Left Sequence: ttaaaaatgctgagggtggc. Outer Right Sequence: caatgggcaaagacgagaat. Inner Left Sequence: tggcaaatatcattgcagga. Inner Right Sequence: cggtgacgagagagtcacaa. Inner Primer PCR Length: 2903. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1952 C. elegans B0207.10(ok2568) I. Show Description
B0207.10 Homozygous. Outer Left Sequence: agtgatatgtgatgtggccg. Outer Right Sequence: accgtaaccccctttttcac. Inner Left Sequence: ttggcgagaacgttcaataa. Inner Right Sequence: tgtgttctctgtccccacaa. Inner Primer PCR Length: 1200. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1954 C. elegans Y48E1B.13(ok2570) II. Show Description
Y48E1B.13 Homozygous. Outer Left Sequence: ttcattttcacggccacata. Outer Right Sequence: tgaaaagtgccattgtttgg. Inner Left Sequence: tatgcagttttccaacgacg. Inner Right Sequence: atataccatgtgcccgcttc. Inner Primer PCR Length: 2793. Deletion size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1955 C. elegans T27A3.6(ok2571) I. Show Description
T27A3.6 Homozygous. Outer Left Sequence: atgtgggaattggcgataaa. Outer Right Sequence: tccggttcactgacttttcc. Inner Left Sequence: ggttgtatctacgggagcca. Inner Right Sequence: ttgcatttttctagccgctt. Inner Primer PCR Length: 2177. Deletion size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1956 C. elegans C47B2.7(ok2572) I. Show Description
C47B2.7 Homozygous. Outer Left Sequence: ttggcgcgaaattacttttt. Outer Right Sequence: ttggaagctaaaaagccgac. Inner Left Sequence: caatatttagcgcgaaaccaa. Inner Right Sequence: aaaaaggctccaaaccttga. Inner Primer PCR Length: 1183. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1957 C. elegans W03G11.2(ok2574) X. Show Description
W03G11.2 Homozygous. Outer Left Sequence: aacccaagatggatgcaaaa. Outer Right Sequence: tctgtggagcatcaggatca. Inner Left Sequence: tcttcatcgggtatgtgcttt. Inner Right Sequence: atcccagtggttttgacgtg. Inner Primer PCR Length: 3140. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1958 C. elegans T07D4.1(ok2575) II. Show Description
T07D4.1. Homozygous. Outer Left Sequence: TTGGTTGGATCAGAAAGTGATG. Outer Right Sequence: GATTGCATGGTAAGACAGTGGA. Inner Left Sequence: ACCATTACGAATAGCATTGGCT. Inner Right Sequence: TTGTTCTGCTCTCGACATGTTT. Inner Primer PCR Length: 2673 bp. Deletion Size: 1767 bp. Deletion left flank: GTACAAGTGTTTGAAAAACCCTATAAGTAG. Deletion right flank: TTTTAACATCCACTTCACTTTGATTCCTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1959 C. elegans F35H12.2(ok2576) X. Show Description
F35H12.2 Homozygous. Outer Left Sequence: cccaacaccttcagtcaggt. Outer Right Sequence: acctccatcctcaacacagg. Inner Left Sequence: ggaatactgggttttccgct. Inner Right Sequence: ggaagggacacacggaagta. Inner Primer PCR Length: 3288. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1960 C. elegans F42A8.1(ok2579) II. Show Description
F42A8.1 Homozygous. Outer Left Sequence: caacgtgattatttgccacg. Outer Right Sequence: ttccaaacccaatttgaacc. Inner Left Sequence: tccagacgtattcctttccaa. Inner Right Sequence: aaatcaacttgtccaagggc. Inner Primer PCR Length: 1291. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1961 C. elegans C06G3.7(ok2580) IV. Show Description
C06G3.7 Homozygous. Outer Left Sequence: gccgagacaacaagaaggtt. Outer Right Sequence: tcatacatcacacgacgcaa. Inner Left Sequence: tcgatttttcacagaaattgttaag. Inner Right Sequence: gagaaaaaccaaagagcagca. Inner Primer PCR Length: 3009. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1962 C. elegans mlt-10(ok2581) II. Show Description
C09E8.3. Homozygous. Outer Left Sequence: AGGTTAAATTCCGAGTCGCC. Outer Right Sequence: TTTAGGTCGCTACTCAGCGG. Inner Left Sequence: AGGCAGAGATGGAAGACGAG. Inner Right Sequence: AAAATGCGGTTTATTGAACTGA. Inner Primer PCR Length: 3023 bp. Deletion Size: 1771 bp. Deletion left flank: CCACAAATCTCCCAGTACAAAGTACAAATT. Deletion right flank: TCCGAGTTGCTCGCCGAGCCGACATCGTCT. Insertion Sequence: C. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1963 C. elegans col-61(ok2582) I. Show Description
C01H6.1. Homozygous. Outer Left Sequence: CATTTTGTCCCTTCTTCCGA. Outer Right Sequence: ATTAAACGTGGCAAAGCACC. Inner Left Sequence: GAAGGTGTCTTCCTCCCCTC. Inner Right Sequence: AAATTGTGGCCAACTTCCAG. Inner Primer PCR Length: 2583 bp. Deletion Size: 1697 bp. Deletion left flank: AGTGAATTCAGTGTCCCAATGGAACGAGAA. Deletion right flank: GAGCCCATCCATAACGTGACGAAACAAAGG. Insertion Sequence: GCTCGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1964 C. elegans K04G2(ok2584) I. Show Description
K04G2. Homozygous. Outer Left Sequence: AGGGGAAACAATGCATTCAG. Outer Right Sequence: CCAACAAGACAAGAATCGCA. Inner Left Sequence: TGAGAGTGAGAAGGACATGGAA. Inner Right Sequence: TGTGGAGCTCACGAAACACT. Inner Primer PCR Length: 1099 bp. Deletion Size: 387 bp. Deletion left flank: AATTGTTTTAAATCAGTTAAGCAAGCAGGT. Deletion right flank: GAAAAGTAGTCAAATACTTTATTTTACAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1965 C. elegans Y105E8A.12(ok2585) I. Show Description
Y105E8A.12 Homozygous. Outer Left Sequence: cccgatcatcccaagattta. Outer Right Sequence: gctccaatgcgaatttgttt. Inner Left Sequence: ccaaatttgtactcgacccg. Inner Right Sequence: catcgattttgggaatcagg. Inner Primer PCR Length: 3158. Deletion size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1966 C. elegans R11A5.4(ok2586) I. Show Description
R11A5.4. Homozygous. Outer Left Sequence: TGGGGGATCAAGTCAAGGTA. Outer Right Sequence: GGATCCCGAATGCAGAGATA. Inner Left Sequence: TGGGTTAGGAGTTGGTGGAG. Inner Right Sequence: ACGTCGTTCATCAAACGTCA. Inner Primer PCR Length: 2625 bp. Deletion Size: 1961 bp. Deletion left flank: ATAATTTTTTTCAGGGAGACTTCCATCTTC. Deletion right flank: ATTTTTTATTTGAAACGCATCTATTGTTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1967 C. elegans aqp-4(ok2587) V. Show Description
F40F9.9. Homozygous. Outer Left Sequence: TTTAAATACTTCCCCGCACG. Outer Right Sequence: GTTCCAGCACAATCACATGG. Inner Left Sequence: GTTTGTGCTTTGCTCAACGA. Inner Right Sequence: TTGCCAAAGACAACGAACTG. Inner Primer PCR Length: 2660 bp. Deletion Size: 1180 bp. Deletion left flank: GACCTAAAACACTGTTCTATTTCACACTTT. Deletion right flank: AGGCTCCTTTTACAGTCACACGTATGGGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1968 C. elegans C23H3.5(ok2588) II. Show Description
C23H3.5. Homozygous. Outer Left Sequence: AGCCCAAGCCAATTATCCTT. Outer Right Sequence: AACACGAACTTTGAATCGCC. Inner Left Sequence: TGGACATGTCAGATTTGGGA. Inner Right Sequence: TAATCTTGGGAAGTGGGCAA. Inner Primer PCR Length: 3031 bp. Deletion Size: 1218 bp. Deletion left flank: TTTTAGGTCAATCCTGTTCATCAATACCTG. Deletion right flank: TTGTCGGAAAATATCAATTCCGGCAATTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1969 C. elegans C32B5.13(ok2589) II. Show Description
C32B5.13. Homozygous. Outer Left Sequence: CTCACCTGAGCCGTTCTTTC. Outer Right Sequence: GTCCGGCCACATACAAGAGT. Inner Left Sequence: AAACTTGCTCTCAGTTGCCC. Inner Right Sequence: GGACCGAAGACGTCTCAAAC. Inner Primer PCR Length: 2981 bp. Deletion Size: 1120 bp. Deletion left flank: TTCAACCAAAATATATCTTACAAGCCCATA. Deletion right flank: GCATAGGATGCATTGCACTATCCCTGATCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1970 C. elegans F33D11.10(ok2590) I. Show Description
F33D11.10. Homozygous. Outer Left Sequence: CATTTCGTCGATTTGTGTCG. Outer Right Sequence: TTTTCGCCGTATTATCTCGG. Inner Left Sequence: ACAAAGTTGATGGCGACTCC. Inner Right Sequence: GGAAATTTACGCGACTCGAC. Inner Primer PCR Length: 1348 bp. Deletion Size: 583 bp. Deletion left flank: AGAATAGTACAGCCTGTGTGATGGTAAGAG. Deletion right flank: GGAAATTGAAAAAGTCGCAGTCTTTCCGGT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1971 C. elegans F57F4.4(ok2599) V. Show Description
F57F4.4 Homozygous. Outer Left Sequence: acagcagcatccggtaattc. Outer Right Sequence: aggactttgcgacagcatct. Inner Left Sequence: tgttcaaattacggcaaacg. Inner Right Sequence: acggagctctcttgtacgga. Inner Primer PCR Length: 3086. Deletion size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1972 C. elegans F21F3.1(ok2600) I. Show Description
F21F3.1. Homozygous. Outer Left Sequence: TCTCCACATCCTCATCTCCC. Outer Right Sequence: CGGTGGCCTAGAAAAACAAA. Inner Left Sequence: CGTTGAAAATGTATGAGCCG. Inner Right Sequence: TGGAGGTGCAGGTTCTACAG. Inner Primer PCR Length: 1269 bp. Deletion Size: 572 bp. Deletion left flank: GTGTTTTTTGTGTGTGAGTGTGTGTGTGTG. Deletion right flank: GACTATTCAACCCCAGCAAAGAAATCGGTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1973 C. elegans W04A4.4(ok2601) I. Show Description
W04A4.4. Homozygous. Outer Left Sequence: AAGTAACATGCTCATCCCCG. Outer Right Sequence: TTGAATGCATGAGTTGCTCC. Inner Left Sequence: TTTGTTCCCCTATTCGCATC. Inner Right Sequence: GCCAAAAGGCTATCCTATGATCT. Inner Primer PCR Length: 3177 bp. Deletion Size: 1678 bp. Deletion left flank: GTAGAAAAAAATACCGTTTTTTGTTTGAAG. Deletion right flank: CCCAAATTGCTCTTGTTGATCCTTACAGAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1974 C. elegans smd-1(ok2602) I. Show Description
F47G4.7. Homozygous. Outer Left Sequence: AAACAGGAAAGGGGGAGAGA. Outer Right Sequence: AAGCCTTCAGATTCAAGCGA. Inner Left Sequence: CGACAAAGAGATGGGGAGAA. Inner Right Sequence: CGCACTCCAGGTCATAGACA. Inner Primer PCR Length: 3240 bp. Deletion Size: 1093 bp. Deletion left flank: GAGCGTAGACTAGGGTTTCCGTCTGCAAAT. Deletion right flank: GAACTCAACTTCTCTGTGGAATGTGTAAAG. Insertion Sequence: CAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1975 C. elegans klc-1(ok2609) IV. Show Description
M7.2 Homozygous. Outer Left Sequence: aaatggcgccaagagatatg. Outer Right Sequence: tcacgcaattttgagttcgt. Inner Left Sequence: attgtcaggctgctggatct. Inner Right Sequence: cgattcaataattttcgggg. Inner Primer PCR Length: 2292. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1976 C. elegans uev-1(ok2610) I. Show Description
F39B2.2. Homozygous. Outer Left Sequence: GAAATGCGTACTCGCACTGA. Outer Right Sequence: GGAAAAGTTCGAGGGGAAAG. Inner Left Sequence: ACGGATTTATTCGGATGGGT. Inner Right Sequence: TACCGGGGAGAGTAAACTGG. Inner Primer PCR Length: 1301 bp. Deletion Size: 480 bp. Deletion left flank: CTTGTCCGAGAGGACTACACAGTTAGCCTT. Deletion right flank: CCGTTCGTTTCACCACCAAAGTTCACATGG. Insertion Sequence: TGCAAACGCGCTCCACT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1977 C. elegans Y66H1B.2(ok2611) IV. Show Description
Y66H1B.2. Homozygous. Outer Left Sequence: AGCGAGTCCAGTGTCGATTT. Outer Right Sequence: CGCTTACCGAAAATGCAAGT. Inner Left Sequence: GACGTCCTGGGAAGAACTTG. Inner Right Sequence: TCCAAAACTTTAAACCGCCA. Inner Primer PCR Length: 3218 bp. Deletion Size: 1763 bp. Deletion left flank: TTAAAAATATTGAGTTTCAACAATTTTACA. Deletion right flank: ATCGCGTAGACTCCTGGTTCTGTTGGAGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1978 C. elegans ZK1248.15(ok2612) II. Show Description
ZK1248.15. Homozygous. Outer Left Sequence: GTACATGCAATGAGACCGGA. Outer Right Sequence: GTTTTCATGGAAGAGGCCAA. Inner Left Sequence: GAAGGTACATTCGTCATCCGA. Inner Right Sequence: ACCACGTGTTCCATGGTCTT. Inner Primer PCR Length: 1119 bp. Deletion Size: 577 bp. Deletion left flank: AAGAGTGATCTCGTCTGCTAGTGGGATCGA. Deletion right flank: AGCCGTTTATCTGAATCTGTTGCTCTGTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1979 C. elegans del-3(ok2613) I. Show Description
F26A3.6. Homozygous. Outer Left Sequence: TCATCGCTTCTACGTGCATC. Outer Right Sequence: ATAATTGGAAGGGTTTCCCG. Inner Left Sequence: TAGCCCCCTACACCTCACAG. Inner Right Sequence: TAAATCGGCACCTGCTTTC. Inner Primer PCR Length: 1222 bp. Deletion Size: 350 bp. Deletion left flank: TATATAAATAAGACACAACTGGCGTCGATT. Deletion right flank: ATAATCAGCTGCTTCACGAAGCGATGGATT. Insertion Sequence: TCGTGAAAGCAGCTGATTACGAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1980 C. elegans C02C6.3(ok2614) X. Show Description
C02C6.3. Homozygous. Outer Left Sequence: CGTGTCTCTTCACATGCGTT. Outer Right Sequence: AAGTGAGGGAAAAGCAGCAA. Inner Left Sequence: CATTTGCTGAAAAACGCTGA. Inner Right Sequence: GCTGGCAGGTGGTTAAATGT. Inner Primer PCR Length: 2605 bp. Deletion Size: 1841 bp. Deletion left flank: TTTTCAAATAGACGATTTAACCTCTTAATA. Deletion right flank: AATTTTGGGTTGGGTCTTGGTTTAATATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1981 C. elegans lin-23(ok2615) II. Show Description
K10B2.1 Homozygous. Outer Left Sequence: cgttttcatcgttttccgtt. Outer Right Sequence: attttatgggccaccatctg. Inner Left Sequence: caccgagcttcaacaactca. Inner Right Sequence: ctcttcgtctacgtcgcctc. Inner Primer PCR Length: 2567. Deletion size: about 1100 bp. [NOTE (08/24/2021): A user has reported that their stock of RB1981 received directly from RB appears to be heterozygous. Not known if that is also the case for CGC stock.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1982 C. elegans vit-1(ok2616) X. Show Description
K09F5.2. Homozygous. Outer Left Sequence: AGCGTGAGCTCAAGGAGAAG. Outer Right Sequence: AGCTTCGTATCCACGACGAC. Inner Left Sequence: ACAAGGATGCTGAGACCACC. Inner Right Sequence: GCTACTGGCTCAACGGAGAA. Inner Primer PCR Length: 3252 bp. Deletion Size: 1797 bp. Deletion left flank: AAGGAAGCCATTGATGCCCTCAGACTTCTT. Deletion right flank: CGTGAAGTTCAACTCTCTCTTACCTCTACC. Insertion Sequence: CTTTCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807