More Fields
Strain Species Genotype
RB1903 C. elegans flp-19(ok2461) X. Show Description
M79.4. Homozygous. Outer Left Sequence: CGAGAACTGAAACAAACGCA. Outer Right Sequence: TGATTTGATGTGCGCAATTT. Inner Left Sequence: AACCCACACCTCAACTTTCG. Inner Right Sequence: ATTGAACCATGTCTGACCGT. Inner Primer PCR Length: 1139 bp. Deletion Size: 268 bp. Deletion left flank: GAGTTTATTTTTTATTAACAATTATCTTTG. Deletion right flank: AACAAAAACCCAACTAATTTTGTGTGTTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1904 C. elegans tag-266(ok2462) III. Show Description
W06E11.5. Homozygous. Outer Left Sequence: GCTCTTTTTCCGACACTTGC. Outer Right Sequence: CCTCGTCGTTTGACCATTTT. Inner Left Sequence: TCTCCTTTGTCGAGAATCTGAA. Inner Right Sequence: TCATGTCAGCCACACCATTT. Inner Primer PCR Length: 3192 bp. Deletion Size: 1425 bp. Deletion left flank: AAAGTAGATATATTTTTCAAAATTTTAAAG. Deletion right flank: TTGAAAATGTTTTAGAAAATTCATAAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1905 C. elegans hse-5(ok2463) III. Show Description
B0285.5. Homozygous. Outer Left Sequence: AAAAGTATCGGGAGTTGGGG. Outer Right Sequence: TTATGTTTTGCCCGTTTTCC. Inner Left Sequence: CCAGAGTCTTTTTGTGGCGT. Inner Right Sequence: AGTTCCCAAAGCAACGTGAC. Inner Primer PCR Length: 3193 bp. Deletion Size: 1427 bp. Deletion left flank: AAAAGATGGTTCAACATTTGAATTATACAC. Deletion right flank: ACCAAAAAATCGACAGCCCTGATCAGGCTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1906 C. elegans mes-1(ok2467) X. Show Description
F54F7.5. Homozygous. Outer Left Sequence: CAGAAACCATTTCCCTCGAA. Outer Right Sequence: CTGAAGACACTTGCTCAGCG. Inner Left Sequence: CCACAGTCGAAGGTTTGGAT. Inner Right Sequence: TGGCAAAAGAATCATGGTCA. Inner Primer PCR Length: 3220 bp. Deletion Size: 1722 bp. Deletion left flank: GGCACAATATCAATCAGATTCTGACAAAAA. Deletion right flank: CGGTACGTGATTTAGTTGTTTTTTTTTCTC. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1907 C. elegans K03E5.1(ok2468) I. Show Description
K03E5.1. Homozygous. Outer Left Sequence: TTAGCGAGGGTCGAAGACAT. Outer Right Sequence: AAAATCTGACAAACGTGCCC. Inner Left Sequence: TTTAGCTTTGCACACGATGC. Inner Right Sequence: TTTCCTAACGAGACCCAACG. Inner Primer PCR Length: 2967 bp. Deletion Size: 1739 bp. Deletion left flank: TTGGGTGCGAAATCCGTGGCCTAATTTTCT. Deletion right flank: TAGTTTGATGAATACACCAGATTTGACGTG. Insertion Sequence: CT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1908 C. elegans mlk-1(ok2471) V. Show Description
K11D12.10. Homozygous. Outer Left Sequence: CAGCCACTGCTCTTTCATCA. Outer Right Sequence: TGGCAACCCCAAGAAAAATA. Inner Left Sequence: TTTGAGTCTCGCTTGTTCCA. Inner Right Sequence: TTTCTATGCGGTGCATTTCA. Inner Primer PCR Length: 3205 bp. Deletion Size: 2971 bp. Deletion left flank: CTCATCGGCATTGTCGACTGAAAGTTTATT. Deletion right flank: ATTAGCTCAATTTTTTGCAAAACTAACTTG. Insertion Sequence: CATGATCTTTATGCGGGAAGTGGTGATATAAATCGAAAAAATCGGCATTCCATCGCGCC GGAAACCAAAGCAAGACGGTTAAAGCATCATAAACCAAAAAAAGCCGACATAACGGGTC CGACAGAAGTGAAACATATATTGTCTGTGCAAAAGGATGATAAAAATTTTAGAGTTAAA AGTAAGTTATATGGTTTAATATTCAATAAAATTGAAAGTTTTTTTGCATGCGTCATTTG GTATAGTAGAAACAATAATTTGAAATAAATATTAAACGTAAAATCAAGATTGCATGCTA GGGTTTCCATGGTAGGCAGGCGTGACCTAGTGCCTGCCTGAAAACTGCCGACCACATGC CTCTTTTCTACATTTTGGCAGAAATTTCAGGCAGGCGTTTTGGCGCCTACATGGAAGCC CAATAGCATGCAATTGTTCGTTCCGTTTACTTCTCATATGAAACTTATCTGCTAAATTA ATATTAACATAGGATATTTTTGAGTCGAAAACAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1909 C. elegans gcy-19(ok2472) II. Show Description
C17F4.6. Homozygous. Outer Left Sequence: AATATCTCGGGCTTTTGCCT. Outer Right Sequence: AAAACGTCTGGAACGTGACC. Inner Left Sequence: AAATTTCACAGCACCGGAAC. Inner Right Sequence: AATAGATGCGGAATGGCAAA. Inner Primer PCR Length: 3073 bp. Deletion Size: 1376 bp. Deletion left flank: TTACTTAATATGAGCATTTCCATTTTTCGA. Deletion right flank: CTGGCGACGTTTCATGGGCTTCTTCTCCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1910 C. elegans tbx-9(ok2473) III. Show Description
T07C4.6 Homozygous. Outer Left Sequence: ttcaattttccagtcgaccc. Outer Right Sequence: caacattttcggaccgtctt. Inner Left Sequence: gtttgcttgtttggaaggga. Inner Right Sequence: gaggtgagatggggtgaaga. Inner Primer PCR Length: 3003. Deletion size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1911 C. elegans ins-27(ok2474) I. Show Description
ZC334.11. Homozygous. Outer Left Sequence: TGTTCAAAACGCACTTGGAG. Outer Right Sequence: TCAAAGCCCCATAACTTTGC. Inner Left Sequence: ATATTACCGCTGGTTGCTCC. Inner Right Sequence: CAAGCTTCAGCGCATAAACA. Inner Primer PCR Length: 1324 bp. Deletion Size: 461 bp. Deletion left flank: TCTACGTAGATCAAACCGACATGGGACAGC. Deletion right flank: AACTGATGAGAATAAAACAATTGTTAAGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1912 C. elegans W05H7.3(ok2485) X. Show Description
W05H7.3 Homozygous. Outer Left Sequence: cttttcaaccggttttgcat. Outer Right Sequence: cgactaagagagcccgtgtc. Inner Left Sequence: ttcctgtgagaaaaatcccg. Inner Right Sequence: gatgagccaagcttagtggc. Inner Primer PCR Length: 2915. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1913 C. elegans msh-2(ok2486) I. Show Description
H26D21.2. Homozygous. Outer Left Sequence: ACCATTTTGGCAACTTGGAG. Outer Right Sequence: GCGAAACCAATTCACCGTAT. Inner Left Sequence: CAACTCCCTCGAAAACCTTG. Inner Right Sequence: TCCCTGCAGGACCATTTTAC. Inner Primer PCR Length: 3099 bp. Deletion Size: 1772 bp. Deletion left flank: CCCGGCTGTTCAGCGAGTTTTCCCATCTCA. Deletion right flank: AATTATTCGATTTCTCTGAAATTAAATTAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1914 C. elegans aqp-9(ok2487) I. Show Description
K07A1.16 Homozygous. Outer Left Sequence: gggaaaatcttgcgtttgaa. Outer Right Sequence: ctggacggaagattgtggat. Inner Left Sequence: cccacaaactctactccccc. Inner Right Sequence: tttaaaagctcaaactcaagaacc. Inner Primer PCR Length: 1134. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1915 C. elegans ins-3(ok2488) II. Show Description
ZK75.3. Homozygous. Outer Left Sequence: GTCCCACTTCGATGCAATTT. Outer Right Sequence: GGAGGCTCTTTACTCGCCTT. Inner Left Sequence: CTATTGCACAACAACACCCG. Inner Right Sequence: TTCTTCCCTGTCTGCCATTT. Inner Primer PCR Length: 3189 bp. Deletion Size: 1449 bp. Deletion left flank: ACTATCATTAACTTTTCAAAATGTTAGTTT. Deletion right flank: AATAATGAAAAGTGCAAGAACAACGGAGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1916 C. elegans pgp-8(ok2489) X. Show Description
T21E8.3 Homozygous. Outer Left Sequence: atccagagcacttgtcgctt. Outer Right Sequence: ggaagtgtttttgctttcgg. Inner Left Sequence: ttgaccaccagacagctgag. Inner Right Sequence: ggacaaacccaggaacttga. Inner Primer PCR Length: 3296. Deletion size: about 2100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1917 C. elegans dnj-28(ok2490) I. Show Description
Y54E10BL.4. Homozygous. Outer Left Sequence: AAAACCGAGGCACAAAGAGA. Outer Right Sequence: AATCGATGTTCAATCGCTCC. Inner Left Sequence: CCGGAAATGCGTTATTTGTC. Inner Right Sequence: GTTAGGTATTTCGCGCCCTT. Inner Primer PCR Length: 3131 bp. Deletion Size: 2116 bp. Deletion left flank: AGTTAGACAGTAATTTCAAAAAAGTTAGTT. Deletion right flank: ATATGGCAGACGAGGAGTATGATATGGGTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1918 C. elegans sedl-1(ok2497) X. Show Description
W05H7.3. Homozygous. Outer Left Sequence: CTTTTCAACCGGTTTTGCAT. Outer Right Sequence: CGACTAAGAGAGCCCGTGTC. Inner Left Sequence: TTCCTGTGAGAAAAATCCCG. Inner Right Sequence: GATGAGCCAAGCTTAGTGGC. Inner Primer PCR Length: 2915 bp. Deletion Size: 1236 bp. Deletion left flank: AAACTAAATTCAGAAAATATTTTTGGCTTC. Deletion right flank: TATTCAGAAATCAACTGGGCTGATGATACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1919 C. elegans W07E6.3(ok2498) II. Show Description
W07E6.3 Homozygous. Outer Left Sequence: caccagatctcacgacgaaa. Outer Right Sequence: ccgttttcgaaattaagcca. Inner Left Sequence: gaaaaatccgattctggggt. Inner Right Sequence: aaatttcttcgggcacgtta. Inner Primer PCR Length: 3191. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1920 C. elegans mig-10(ok2499) III. Show Description
F10E9.6. Homozygous. Outer Left Sequence: AACACATGGCATTGCAAAAA. Outer Right Sequence: GCAACAGAAGGTGTACGCTG. Inner Left Sequence: TGATATCCGGACAGAGAGGG. Inner Right Sequence: CCAAGGAGTCGGTGATTTGT. Inner Primer PCR Length: 3015 bp. Deletion Size: 2263 bp. Deletion left flank: ACCCACATACCTTATACTTTATCCGAAAAT. Deletion right flank: GTGCTTGAGATATCAATCTAGATGGTTCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1922 C. elegans F46H5.4(ok2501) X. Show Description
F46H5.4. Homozygous. Outer Left Sequence: AAACGCAACTCGGAAAAATG. Outer Right Sequence: CTACACGAATGCTTGCTGGA. Inner Left Sequence: TCAATTCCTGGTAATGGTGAGA. Inner Right Sequence: TGTTTCTCTGGTTCATTCATGG. Inner Primer PCR Length: 3072 bp. Deletion Size: 2420 bp. Deletion left flank: GTTCAGCCATGTTAAGAAGCCAAGTTATTC. Deletion right flank: ATGATTTGAGCTGAATGTAGCAGATTTCAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1923 C. elegans ckr-1(ok2502) I. Show Description
T23B3.4. Homozygous. Outer Left Sequence: TTTCAAAAACCCTGGTACGG. Outer Right Sequence: AAATCGCCATTGAAATACGC. Inner Left Sequence: TGAGTTGGAGATGAAGGGCT. Inner Right Sequence: GATCCTCACAATCCTCGGAA. Inner Primer PCR Length: 2705 bp. Deletion Size: 1289 bp. Deletion left flank: CTTTGGAATTGGATGTCTAGTTTTTTTAGT. Deletion right flank: CAGTGGGGAGCTGAGATAAAAACAGAATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1924 C. elegans F45H10.4(ok2503) II. Show Description
F45H10.4 Homozygous. Outer Left Sequence: aacgaacgagttcaattggc. Outer Right Sequence: ggccaccgatttttcctatt. Inner Left Sequence: taaagcaatttccccacagg. Inner Right Sequence: ttacggccacatagcaaaaa. Inner Primer PCR Length: 3175. Deletion size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1925 C. elegans C49G9.1(ok2504) I. Show Description
C49G9.1. Homozygous. Outer Left Sequence: TTTTAAGCCATAACACCCGC. Outer Right Sequence: ATGCATCGACGAATACACCA. Inner Left Sequence: CCAGGAAATTGTCAACACGA. Inner Right Sequence: ATCCCTTCCTCCACATCTCA. Inner Primer PCR Length: 1210 bp. Deletion Size: 385 bp. Deletion left flank: TAAGGATTTGATAATTTCATGAAAATTAAA. Deletion right flank: ATCCAAATTTTTTTTTTCCAAAATTTTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1926 C. elegans T02G5.3&mmaa-1(ok2512) II. Show Description
T02G5.1, T02G5.13. Homozygous. Outer Left Sequence: TGATTGGTGCACTGGTCATT. Outer Right Sequence: AATCACGATACCTTGGACGC. Inner Left Sequence: TCGTTTCGAAATTCGTCCTC. Inner Right Sequence: ATGCCTGGTGACGACTACCT. Inner Primer PCR Length: 2798 bp. Deletion Size: 1381 bp. Deletion left flank: GTTTATACTCTGGAAAAAGTTACAAAATCA. Deletion right flank: GTGGGATCAATTGTTAAAACTGCAACTTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1927 C. elegans C38D4.4(ok2513) III. Show Description
C38D4.4. Homozygous. Outer Left Sequence: ACAAGAGGTGGAAGAGCCAA. Outer Right Sequence: CTATCCTTATCCGACGGCAA. Inner Left Sequence: AAGAAACGGCTGCGGTAATA. Inner Right Sequence: TGATAGCTTCTAGACACTCATTATC. Inner Primer PCR Length: 3063 bp. Deletion Size: 1751 bp. Deletion left flank: TATTTGTCCTTATTTATTTTATTATTTGAA. Deletion right flank: AATTGACCGAAATCTACGATAAGCATTTCG. Insertion Sequence: CCGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1928 C. elegans exoc-8(ok2523) I. Show Description
Y105E8B.2. Homozygous. Outer Left Sequence: CTACCGACTGAGCTATCCGC. Outer Right Sequence: AAATTTCATGGCGTTTTTGG. Inner Left Sequence: TTTCGCAAAATGCACAACAT. Inner Right Sequence: GCCCCAGTCAACGTTAAAGA. Inner Primer PCR Length: 2583 bp. Deletion Size: 1474 bp. Deletion left flank: TTAAAAATGAACAAATTTTTTGGAAAATCT. Deletion right flank: TCACAGTTTGCCGTTTTCCTCGAATAGTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1929 C. elegans inx-21(ok2524) I. Show Description
Y47G6A.1. Homozygous. Outer Left Sequence: AAAGTGGCACCGAGAAGTTG. Outer Right Sequence: TCAACGAACTCGAATCATCG. Inner Left Sequence: CTCGCCTCAAAACCAATGTT. Inner Right Sequence: CGTCGATACTGTGGAACGAG. Inner Primer PCR Length: 3086 bp. Deletion Size: 1960 bp. Deletion left flank: ATATTATGGGGACGCAGAAAAATTCGCATT. Deletion right flank: CTAATTTTGTTTATATTGATGAGAAAACAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1930 C. elegans spr-3(ok2525) X. Show Description
C07A12.5. Homozygous. Outer Left Sequence: CCCATTTTCAAATTCCATCG. Outer Right Sequence: GCAAGCATCAAAACTGACGA. Inner Left Sequence: GCGAAAAGAGTGCGGTCTAC. Inner Right Sequence: GATGGGAAGGGAAGGGAATA. Inner Primer PCR Length: 2752 bp. Deletion Size: 595 bp. Deletion left flank: CCGCCAGTTTTGGAAGTGTAGTACTCGCAT. Deletion right flank: GTCTACCATATTTTGTCACACCGTGTCAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1931 C. elegans feh-1&nhr-239(ok2526) III. Show Description
Y54F10AM.1, Y54F10AM.2. Homozygous. Outer Left Sequence: ACAACATCCACCATCCACCT. Outer Right Sequence: ATAACCTTATGCCCAAGCCA. Inner Left Sequence: TTTTCAGATTCTAGGCCGTCA. Inner Right Sequence: GAGCCTAAGCCTAAGCCCAC. Inner Primer PCR Length: 3094 bp. Deletion Size: 2350 bp. Deletion left flank: CAAATTAGACTTAGGCTTTAAATTGTTTGT. Deletion right flank: AAACCGGCAAATTGATTTGCCGAATTTGCC. Insertion Sequence: TTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1932 C. elegans ZK418.8(ok2535) III. Show Description
ZK418.8 Homozygous. Outer Left Sequence: aaaaccggtgaagtttgagg. Outer Right Sequence: catttgcgaaatgggaaagt. Inner Left Sequence: ttttcgagctacaacgacttttt. Inner Right Sequence: attgcgagcccatttgttat. Inner Primer PCR Length: 3125. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1933 C. elegans F56D12.5(ok2536) II. Show Description
F56D12.5 Homozygous. Outer Left Sequence: aatatcgcaacggtgtctgg. Outer Right Sequence: tctagcagaccaatttgggg. Inner Left Sequence: gttcttgcaggtatccccat. Inner Right Sequence: cagcagcacaattcattcaaa. Inner Primer PCR Length: 3037. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1934 C. elegans W07B8.4(ok2537) V. Show Description
W07B8.4 Homozygous. Outer Left Sequence: caatggggtttcaaagcaat. Outer Right Sequence: gccgattttcagttagcctg. Inner Left Sequence: catgtattcctcgggattcg. Inner Right Sequence: ttcgctctgattcacttcca. Inner Primer PCR Length: 3069. Deletion size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1935 C. elegans gcy-20(ok2538) V. Show Description
F21H7.9. Homozygous. Outer Left Sequence: TTGCGACAGCGTATTTTCTG. Outer Right Sequence: TTCGAATTTTCGACCAAAGC. Inner Left Sequence: ACCAGACTCACCTTGGCAAC. Inner Right Sequence: GCTCTGAAAGTCTCGCTGCT. Inner Primer PCR Length: 3244 bp. Deletion Size: 1321 bp. Deletion left flank: GGTCATTTTGGTGGAAGTTGAGGGGCCACT. Deletion right flank: TGAGTGTCTGATTCTATGGTCTTTAATTAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1936 C. elegans M28.4(ok2539) II. Show Description
M28.4 Homozygous. Outer Left Sequence: agcgattccaaaatcactgg. Outer Right Sequence: tgcctggtaggcagaaaagt. Inner Left Sequence: cgctggattgttggttatca. Inner Right Sequence: gtcattggaattggaggtgg. Inner Primer PCR Length: 3023. Deletion size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1937 C. elegans rgs-7(ok2540) X. Show Description
F56B6.2. Homozygous. Outer Left Sequence: ACAGCGCAAGGTAGGTCAAT. Outer Right Sequence: ATCCCCAACAAAATTGGTCA. Inner Left Sequence: GAGTGTCGTCTGCTGGTTCA. Inner Right Sequence: CAGTTTCTCACCTCATCGCA. Inner Primer PCR Length: 3326 bp. Deletion Size: 1491 bp. Deletion left flank: CGTTGCCTTTCATTGCCCACGCACCCGCTA. Deletion right flank: CAGATTCAATGTTGAACACTTATCTGAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1938 C. elegans Y116A8B.5(ok2541) IV. Show Description
Y116A8B.5 Homozygous. Outer Left Sequence: aaaataccggcgtcactgtc. Outer Right Sequence: atggctatttggagtggcaa. Inner Left Sequence: agctgaagcgtcagaaggac. Inner Right Sequence: ggtttggggaaagtgtcaac. Inner Primer PCR Length: 3290. Deletion size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1939 C. elegans C50A2.2(ok2542) IV. Show Description
C50A2.2. Homozygous. Outer Left Sequence: AAAATCGTCGTCGAAACCTG. Outer Right Sequence: CTGACGCAAAATTGCAGAAA. Inner Left Sequence: ACAACGAACCGAGCCGAT. Inner Right Sequence: GTGCGTATTGGGAAGGTAGC. Inner Primer PCR Length: 3005 bp. Deletion Size: 1982 bp. Deletion left flank: ATTTAGTGTGACTAGGTTACTGTAGCACCA. Deletion right flank: CGTCAGATTGTGTTTACCAACAAAAAAAAT. Insertion Sequence: GACTTTTTTCTGCAATTTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1940 C. elegans F55D12.5(ok2543) I. Show Description
F55D12.5 Homozygous. Outer Left Sequence: accatttgcctgttctcctg. Outer Right Sequence: actacaacagcaacccgtcc. Inner Left Sequence: aatcgcactcaggttgttga. Inner Right Sequence: tccaaccacaactaccacg. Inner Primer PCR Length: 1181. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1941 C. elegans rbr-2(ok2544) IV. Show Description
ZK593.4. Homozygous. Outer Left Sequence: GAGGGGAAGATGAGTGTCCA. Outer Right Sequence: GCATGTCAGTGTTGATTCGG. Inner Left Sequence: TGCGTTGCTTGTAATGAAGG. Inner Right Sequence: TGAGCATGCTTCAAGACCAC. Inner Primer PCR Length: 3298 bp. Deletion Size: 1311 bp. Deletion left flank: CGAGTCGAGTAGGAAGTGGATTTCCTCGAA. Deletion right flank: GAGCAAAAGATGCTATCTATCGAGAACAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1942 C. elegans ace-2(ok2545) I. Show Description
Y44E3A.2. Homozygous. Outer Left Sequence: GATGCGGATTTTCGAGTTGT. Outer Right Sequence: ACTTGCCTGCCTAGCAGTGT. Inner Left Sequence: ATGATTCGATGCTTCCCTTG. Inner Right Sequence: ATTCATGAGCACCGATCTCC. Inner Primer PCR Length: 3182 bp. Deletion Size: 1470 bp. Deletion left flank: TCAGCAAAATCAATAAGAGAGCAAGTAAAA. Deletion right flank: GTGTTAGAGAGTGATAATTGGAAAATTGAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1943 C. elegans Y11D7A.8(ok2550) IV. Show Description
Y11D7A.8. Homozygous. Outer Left Sequence: ACGTTATGTCAGATTGCCCC. Outer Right Sequence: CAGAATGAGCCAAACAAGCA. Inner Left Sequence: CCACGATGCCACTAAAAGGT. Inner Right Sequence: AGTCTTTCCATCCGATTCCA. Inner Primer PCR Length: 2844 bp. Deletion Size: 1143 bp. Deletion left flank: ACATCTTTCATTTAATGTTTCGGAATTGCA. Deletion right flank: TTTCATCTATAATTTCAGCATATAGGAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1944 C. elegans M01E5.2(ok2552) I. Show Description
ok2552. Homozygous. Outer Left Sequence: CAAAGATTGTGGCGGAAAAT. Outer Right Sequence: CGGTAGCTGATTTTCGTGGT. Inner Left Sequence: GTTACACCTTTTCCTGGCGA. Inner Right Sequence: CTAAAATTCTGCGGAAACCG. Inner Primer PCR Length: 2997 bp. Deletion Size: 2279 bp. Deletion left flank: ATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAA AATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAA AAATAGATTGTTACACGAAAAAATAGATTGTTAC. Deletion right flank: CAAAAAACTGTGAAAATTCACTTCAACTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1945 C. elegans C10F3.7&fut-8(ok2558) V. Show Description
C10F3.6, C10F3.7. Homozygous. Outer Left Sequence: CAGTCAAAGGTGGCAACTCA. Outer Right Sequence: CGAAAATTGAAGCCCATTTG. Inner Left Sequence: TTGGTGCGAGAAGAACACAG. Inner Right Sequence: CATCAACTCCCACCAAATCC. Inner Primer PCR Length: 2789 bp. Deletion Size: 2239 bp. Deletion left flank: TCTCTACCGTTCATATACTTACCCCATCGA. Deletion right flank: GTAGCAAATGCGGTAATTGCACAATAGGTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1946 C. elegans C30F12.7(ok2559) I. Show Description
C30F12.7. Homozygous. Outer Left Sequence: GGGTGTTCTTGCACCTGAAT. Outer Right Sequence: TTTGAATTTCCTTTGCCCTG. Inner Left Sequence: AGATGTTCATGAAAACGCCC. Inner Right Sequence: GATTGGTCATGGGGCTCTAA. Inner Primer PCR Length: 2691 bp. Deletion Size: 2003 bp. Deletion left flank: TAGGTTCCCATGCTTGAAAATATAAAGTCT. Deletion right flank: TGTGGGTTTATAAAACTTAATGAAAAACGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1947 C. elegans Y106G6A.2(ok2561) I. Show Description
Y106G6A.2. Homozygous. Outer Left Sequence: TTCGGCTGACATGAAGACTG. Outer Right Sequence: CTTCAACAGCAAATGCCTGA. Inner Left Sequence: CGAAGGGTATGGGGAGAAAT. Inner Right Sequence: GGGGAACGAAACCCATAAGT. Inner Primer PCR Length: 2400 bp. Deletion Size: 1281 bp. Deletion left flank: GTGCGCCTTTAGAGTACTTTAGTTTCAAAC. Deletion right flank: AACCGGGTTATTGTCGATTCAATATTCATG. [NOTE (11-18-2015) A user has reported that this strain was heterozygous for ok2561 by PCR analysis.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1949 C. elegans tra-2(ok2563) II. Show Description
C15F1.3 Homozygous. Outer Left Sequence: aaccagaaaagtcgccttga. Outer Right Sequence: tccacatcaagcatccagaa. Inner Left Sequence: ttggtgtgatggcaaagatg. Inner Right Sequence: atgcattcctgcgattcttc. Inner Primer PCR Length: 3370. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1950 C. elegans F38A6.3(ok2564) V. Show Description
F38A6.3 Homozygous. Outer Left Sequence: aatcttgacgtcctctggga. Outer Right Sequence: acggaggtatgaggacaacg. Inner Left Sequence: tggaagacaatcggaaaagg. Inner Right Sequence: taaatcggagccagatccac. Inner Primer PCR Length: 2977. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1951 C. elegans gcc-1(ok2565) X. Show Description
C15C7.2 Homozygous. Outer Left Sequence: ttaaaaatgctgagggtggc. Outer Right Sequence: caatgggcaaagacgagaat. Inner Left Sequence: tggcaaatatcattgcagga. Inner Right Sequence: cggtgacgagagagtcacaa. Inner Primer PCR Length: 2903. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1952 C. elegans B0207.10(ok2568) I. Show Description
B0207.10 Homozygous. Outer Left Sequence: agtgatatgtgatgtggccg. Outer Right Sequence: accgtaaccccctttttcac. Inner Left Sequence: ttggcgagaacgttcaataa. Inner Right Sequence: tgtgttctctgtccccacaa. Inner Primer PCR Length: 1200. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1954 C. elegans Y48E1B.13(ok2570) II. Show Description
Y48E1B.13 Homozygous. Outer Left Sequence: ttcattttcacggccacata. Outer Right Sequence: tgaaaagtgccattgtttgg. Inner Left Sequence: tatgcagttttccaacgacg. Inner Right Sequence: atataccatgtgcccgcttc. Inner Primer PCR Length: 2793. Deletion size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1955 C. elegans T27A3.6(ok2571) I. Show Description
T27A3.6 Homozygous. Outer Left Sequence: atgtgggaattggcgataaa. Outer Right Sequence: tccggttcactgacttttcc. Inner Left Sequence: ggttgtatctacgggagcca. Inner Right Sequence: ttgcatttttctagccgctt. Inner Primer PCR Length: 2177. Deletion size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807