Reference WBG 10(2) 140-141 and WBG 8(2) 52. Caenorhabditis elegans wild isolate. (Tc1 pattern VII).

Heterozygotes are WT and segregate WT heterozygote, Uncs (unc-32 homozygotes), and Steriles (dcr-1 homozygotes).

sEx10538 [rCes C36B1.12::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx12068 [rCesK07B1.5b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sIs12736 [rCesC35B1.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sIs13297 [rCes T27B1.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14336 [rCesC36B1.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14344 [rCes K07B1.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx15347 [rCes F53B1.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

Dpy.

Intersexual self-fertile XX hermaphrodites with Smg (protruding vulva) phenotype. Grows poorly, does best at 20C. Class B1 allele of tra-1 combined with smg-2(NMD), useful for selection of modifiers. Reference: Zarkower et al. (1994) PMID: 7520378

Dose-dependent sensitivity (developmental arrest) to pladienolide B and herboxidiene (modulators of pre-mRNA splicing). sftb-1(cer144[S1090A, A1095T, I1096V, F1101Y]) contains four missense mutations reproducing the HEAT repeat 15 of the human SF3B1 protein. Ten silent mutations increase primer specificity for PCR genotyping. Primers used for genotyping: (WT For: GAGCTGCAATTAATACATTTGGATTT) (WT Rev: AAACTCGCATTCCTTCACAT) (cer144 For: GGTACTATTCTGTGGCGTCT) (cer144 Rev: GTAACCGAAAGTGTTCACAGTT) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.

mir-1829.3 pre-miRNA & F39B1.3 deletion allele in which mir-1829.3 pre-miRNA & F39B1.3 was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

Antarctic nematode isolated from Ross Island, Antarctica in 1988. Panagrolaimus sp. DAW1 formerly known as Panagrolaimus davidi or P. davidi CB1. Survives freezing at -80 °C, including extensive intracellular freezing. Reference: Raymond MR, Wharton DA, Marshall CJ (2014) Antarc Sci 26:15-22.

Temperature sensitive. Embryonic lethal at 25C (tight); arrests at first cleavage. Gondadogenesis defective. Will grow at 15C or 20C. Maternal effect (m,m).

krIs14 [hsp-16.48p::MosTransposase + lin-15(+) + unc-122p::GFP] V. Recessive Unc. unc-5(lib1) is a CRISPR/Cas9 engineered mutant carrying the Intersister/Intrachromatid Repair Assay (ICR Assay) cassette inserted into the endogenous unc-5 locus. Briefly, ICR assay cassette includes two tandem GFP cassettes: the upstream using the myo-3 (body wall) promoter with a truncated GFP coding sequence, and the down-stream using the myo-2 (pharynx) promoter with GFP coding sequence interrupted by a Mos1 Drosophila transposon. Excision of Mos1 yields a single DSB, which if repaired by intersister or intrachromatid recombination, then will yield GFP+ progeny. The krIs14 insertion carrying heat-shock inducible Mos1 transposase is marked with coelomocyte GFP expression. Reference: Toraason E, et al. Current Biology 2021. https://doi.org/10.1016/j.cub.2021.03.008

raEx208 [T05G5.1p::M02B1.3(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

tmEx4487 [unc-18(+) + myo-2p::Venus]. Break points: In(F53B1.2 unc-18 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2.1..8.5) Lon Mec (Unc). Pick fluorescent non-Unc to maintain array. Males carrying the array (Venus in pharynx) can mate. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.

Break points: In(F53B1.2 unc-18 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2.1..8.5) Lon Unc Mec. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.

Biotin auxotrophic E. coli strain is kan resistant and grows fine on LB. This mutant strain produces significantly less biotin and can therefore be used to reduce background in TurboID experiments. Also known as MG1655 bioB::kan and STL110 (J. Cronen, U. of Illinois). References: Sanchez AD & Feldman JL. STAR Protoc. 2021 Dec 2;2(4):100986. doi: 10.1016/j.xpro.2021.100986. PMID: 34927095. Ortega-Cuellar D., et al. J Nutrigenet Nutrigenomics. 2010;3(1):18-30. doi: 10.1159/000318054. PMID: 20798549

Halicephalobus mephisto wild isolate. Grow at 37C: can survive higher temperatures than C. elegans. Useful model organism for studying heat tolerance; has expanded Hsp70 and AIG1 gene families. Has approximately 1.15% snp heterozygosity. Parthenogenetic reproduction so it cannot be out-crossed. References: Borgonie G, et al. Nature. 2011 Jun 2;474(7349):79-82. Weinstein DJ, et al. Nat Commun. 2019 Nov 21;10(1):5268.

A 150 bp deletion in F44A2.2 corresponding to base pairs #27451-27600 in the published C. elegans cosmid F44A2 sequence (Genbank accession #U41993). The predicted protein F44A2.2 is called "nshab1", which is homologous to potassium voltage-gated channel subfamily B, member 2.

abcIs3 [pie-1p::ebp-2::GFP + unc-119(+)]. Superficially wild-type. Maternal expression of EBP-2::GFP microtubule end-binding protein. In early embryos, EBP-2 encodes an EB1-like protein (end-binding) that locates to the growing tips of microtubules (not detected on depolymerizing microtubules). A strong fluorescent signal localizes to the centrosome due to high concentration of polymerizing microtubule ends. References: Gusnowski EM, Srayko M. J Cell Biol. 2011 Aug 8;194(3):377-86. Tegha-Dunghu J, et al. Methods Mol Biol. 2014;1136:103-16.

abcIs3 [pie-1p::ebp-2::GFP + unc-119(+)]. Embryonic-lethal at 25ºC due to dominant gain-of-function mutation mei-1(ct46), and Uncoordinated due to unc-13 mutation. Maternal expression of EBP-2::GFP microtubule end-binding protein. EBP-2 encodes an EB1-like protein (end-binding) that, in early embryos, locates to the growing tips of microtubules. A strong fluorescent signal localizes to the centrosomes of early embryos due to a high concentration of polymerizing microtubules. mei-1(ct46)-based ectopic microtubule severing causes mitotic spindle defects in the early embryo. References: Gusnowski EM, Srayko M. J Cell Biol. 2011 Aug 8;194(3):377-86. Tegha-Dunghu J, et al. Methods Mol Biol. 2014;1136:103-16.

wdIs3[del-1::GFP + dpy-20(+)]. del-1 is expressed in the VB motor neurons beginning the the L2 larval stage. By the end of L2, del-1::GFP is also visible in a few VA motor neurons at the anterior end of the nerve cord. Expression of del-1::GFP in the VAs progresses in a wave from anterior to posterior, with all VAs expressing del-1::GFP by the adult stage. Thus, del-1::GFP is not expressed in the VAs during the L2 period in which unc-4 functions in those cells to establish synaptic inputs but is expressed in the VAs after they have been wired into the ventral cord circuit. del-1::GFP is also expressed in five neurons (VB1, VB2, SABVR, SABVL, VA1) in the retrovesicular ganglion at the anterior end of the ventral nerve cord. During the mid-L2 larval stage, del-1::GFP expression in the ventral nerve cord is largely restricted to the VB class of motor neurons.

Unc-lethargic and kinker. Throws abnormal males-fused rays 4 and 6.

C36B1.10. Homozygous. Outer Left Sequence: ACAGAGTCGTCTGCTCGGAT. Outer Right Sequence: TCCCTTGGTCTCTGAATCGT. Inner Left Sequence: CGATCTCTTTGGAAACTCGC. Inner Right Sequence: ACCGATGTCTGTTGAAAGCC. Inner Primer WT PCR Product: 3303. Deletion size: 1202 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57B1.2 Heterozygotes are WT and GFP+. Outer Left Sequence: tgattcccaggaaccaaaaa. Outer Right Sequence: tctgtgcctgccaaatcata. Inner Left Sequence: aaaacgaaaacggcactttg. Inner Right Sequence: aattacaattccgcacaggc. Inner Primer PCR Length: 2136. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14B1.4 Homozygous. Outer Left Sequence: acgctgaagacgaggatgat. Outer Right Sequence: aatatcggcaattacgcagg. Inner Left Sequence: attgtgtgttcgctgtgcat. Inner Right Sequence: cgtatttgctctcggtcgat. Inner Primer PCR Length: 2239. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R07B1.3. Homozygous. Outer Left Sequence: TGCAATTGATCACTGGGAAA. Outer Right Sequence: TACCCCAGCTTAAGGCATTG. Inner Left Sequence: GCTTTTTGGCCAATTTTCAA. Inner Right Sequence: ACTGACACCGTTCCCTTGAC. Inner Primer PCR Length: 3169 bp. Deletion Size: 1278 bp. Deletion left flank: CACTATAGCGAAGTAGATAATGATGCGGGA. Deletion right flank: CTTTCACTAGTTCATTTATTGAAAACTGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C03B1.5. Homozygous. Outer Left Sequence: GCGTGTAATCATGCAAATCG. Outer Right Sequence: TTGCATCTTCACAGGCTCAC. Inner Left Sequence: TTGCACGTCCACAATGAAAT. Inner Right Sequence: TGAAAATTGAACACAGGCCA. Inner Primer PCR Length: 2279 bp. Deletion Size: 1310 bp. Deletion left flank: GGCGATACTTCTCTATTCCTTATGAAGGAC. Deletion right flank: TTCTCAAGGGAGAGAATCCGTTCAAAAAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F39B1.1. Homozygous. Outer Left Sequence: ACATGGAACATTTCGGTGGT. Outer Right Sequence: AACGCAACGTCACTCTTGTG. Inner Left Sequence: GCCGATCTCCAATACCAAGA. Inner Right Sequence: CTGCTGCATCGAAAGTCGTA. Inner Primer PCR Length: 3242 bp. Deletion Size: 1597 bp. Deletion left flank: CGCATGTCATCGTCACGCTGGAAAGCATCA. Deletion right flank: TAACACTTACATAAAGGTCCAATGGAATCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C36B1.12 Homozygous. Outer Left Sequence: ttccatttggtggttggatt. Outer Right Sequence: gatatcgccaagtcccagaa. Inner Left Sequence: aggctccagatgcgaataga. Inner Right Sequence: catgagcattgggaactgaa. Inner Primer PCR Length: 3358. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W03B1.2. Homozygous. Outer Left Sequence: ATGGCAATTGCGTATAAGGC. Outer Right Sequence: CTAGTGATGGCGCAGTTGAA. Inner Left Sequence: CAAAGACCTTGTCTGAACCTGA. Inner Right Sequence: AAACAGCACTGCTTCCAACC. Inner Primer PCR Length: 3025 bp. Deletion Size: 2350 bp. Deletion left flank: TGAGGATCCGGAATGAGAGCAGAAACCAGC. Deletion right flank: GAAGGAGTACGAGAACGAGTCAAAGAACAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F53B1.2. Homozygous. Outer Left Sequence: ATGCTCTTTTCGCCCCTTAT. Outer Right Sequence: GCTCCAAATGTGGAATGCTT. Inner Left Sequence: GACCTATACCGGCAGATCCA. Inner Right Sequence: TCATGCTTCATACCCTGGCT. Inner Primer PCR Length: 1108 bp. Deletion Size: 383 bp. Deletion left flank: AGAAACGAGCTGAAACTATTTATGCGACGC. Deletion right flank: TGGCCAAGTCGTCAGATGGCACATCAACAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R07B1.2 Homozygous. Outer Left Sequence: accctaaacgacattcgcac. Outer Right Sequence: aactatgcatgtgcatccca. Inner Left Sequence: aaacatctcaaaaatgcccg. Inner Right Sequence: gctcacgctaccatttcctc. Inner Primer PCR Length: 2100. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59B1.9 Homozygous. Outer Left Sequence: acatgtagacgtcgatggca. Outer Right Sequence: cagaatgagccgcaacaata. Inner Left Sequence: gtttccaaacgcacacattg. Inner Right Sequence: cgtgggcggtagaggtaaat. Inner Primer PCR Length: 1100. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F37B1.1 Homozygous. Outer Left Sequence: gcgacgattcatggtctttt. Outer Right Sequence: ctctccctcccctcaatttc. Inner Left Sequence: caaactccccaggtgtgact. Inner Right Sequence: ggagattttcgaaacgactttg. Inner Primer PCR Length: 1156. Deletion size: about 600 bp. ttggtcagctcccattcctc [ 603 bp deletion] caagttatctaggcacgagg -- Wild type ttggtcagctcccattcctc ------------------ caagttatctaggcacgagg -- ok2980 Sequence shown is on the minus strand. Deletion starts in the second exon and removes the downstream part of that exon, the 3'-UTR, and approximately 0.1 kb of downstream flanking sequence. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07C6.4. Homozygous. Outer Left Sequence: AATTCTCTGCTCGTCGGAAA. Outer Right Sequence: TCAATATGCACACAGCGACA. Inner Left Sequence: TCGAGGCCGAAGATAAGGAT. Inner Right Sequence: GCTTTTTAGGCTTTCTCGTGG. Inner Primer PCR Length: 1144 bp. Deletion Size: 480 bp. Deletion left flank: ATCTCTGGTTAGCTGGTCAAGATACCACTT. Deletion right flank: TTGGAAATCTTATCCTGCGATATGACATTA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F37B1.1. Homozygous. Outer Left Sequence: GCGACGATTCATGGTCTTTT. Outer Right Sequence: CTCTCCCTCCCCTCAATTTC. Inner Left Sequence: CAAACTCCCCAGGTGTGACT. Inner Right Sequence: GGAGATTTTCGAAACGACTTTG. Inner Primer PCR Length: 1157 bp. Deletion Size: 555 bp. Deletion left flank: TCATTAACCTTCTCACGGAGCGCTGCAAGC. Deletion right flank: AGTTATACAAATACCACTAAAAATGTTTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

PDB1.1 Homozygous. Outer Left Sequence: tgtgttcgtttcagtctcgc. Outer Right Sequence: atgaaaaccaaaatgcgctc. Inner Left Sequence: acggaatatgctccctgatg. Inner Right Sequence: gcccacaaagaagatatgcaa. Inner Primer PCR Length: 1113. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

PDB1.1. Homozygous. Outer Left Sequence: TGTGTTCGTTTCAGTCTCGC. Outer Right Sequence: ATGAAAACCAAAATGCGCTC. Inner Left Sequence: ACGGAATATGCTCCCTGATG. Inner Right Sequence: GCCCACAAAGAAGATATGCAA. Inner Primer PCR Length: 1114 bp. Deletion Size: 343 bp. Deletion left flank: TTCGCTGAAATATCATTCATTTAGAATGTA. Deletion right flank: GATGTTACCGTAAACGCGCTATCAGAATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C03B1.12 Homozygous. Outer Left Sequence: caattttggttggagaggga. Outer Right Sequence: tcacattcaactcgcgtagc. Inner Left Sequence: cgtaaagtcatcgtacgggc. Inner Right Sequence: gctctgctctcgtagcacaa. Inner Primer PCR Length: 1217. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07B1.3. Homozygous. Outer Left Sequence: AGTCCTGAACGGAGCTTTGA. Outer Right Sequence: TACAATGGCAGCAGCAAGTC. Inner Left Sequence: TCGCACATTGGTTTGTTGTT. Inner Right Sequence: AACGGCATGAGTTAGCCAAT. Inner primer WT PCR product: 2995. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Mes. Deletion of 858 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 viable adults that produce progeny most of which are sterile (ve777 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TTTTCTTGAGCTTCATCGTCATCGAATCCG ; Right flanking sequence: TGGATTATCCATttttgaactgaaaattca. sgRNA #1: AAAATTATCAGCGAGGGAGA; sgRNA #2: AATAAGTCGATTTCTTTAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2219 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTTCTTCCTTATTCATCAATATTTGTGG ; Right flanking sequence: CGCGTTAGATCACGAAATTGTCACACTGAA. cyp-33B1 sgRNA #1: CGGCGAAGAGGATTACCACC; cyp-33B1 sgRNA #2: ACATTTATATGGAATGACAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10703 [ceh-26::TGF(10B1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ceh-6(mg60) is lethal. Maintain by picking WT and check that it throws 1/4 Dpys. mg60 is a 1.3 kb deletion that removes part of the conserved POU-specific domain. PCR with primers PCR6-5 GAA-TTC-ATG-AAA-TCG-GAG-GCG-T (->) and PCR6-3 GTG-AGA-AGT-GAA-GAG-GAT-TGT-A (<-) yields a band of about 1.6 kb instead of 280 bp as in N2. Backcrossed more than 10 times; in addition, the left arm of LG I was recombined with lin-28 to remove the mutator locus.

T14B1.1. Superficially wild type. External left primer: TTTGGGGACATACAAGAGGG. External right primer: TCTCGCAAATAAGGCCATTC. Internal left primer: AGGAGAGGGGAGAAATGGTG. Internal right primer: TGTAATCTTTACCCGCCCAC. Internal WT amplicon: 2121 bp. Deletion size: 1117 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14B1.4, C14B1.5. Slow-growing, small broods. Deletion removes 3' end of C14B1.4, 5' end of C14B1.5. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807