Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB1127 C. elegans Y54G2A.2(ok1144) IV. Show Description
Y54G2A.2. Homozygous. Outer Left Sequence: TTGTGGTGGAGATACCCCAT. Outer Right Sequence: CGCGGGAATTCAAACATAAT. Inner Left Sequence: GCGAGTTTAGAAATGCTCGG. Inner Right Sequence: CTTTTCATATTCAGGCCCCA. Inner Primer PCR Length: 2962 bp. Deletion Size: 483 bp. Deletion left flank: TTTCGTCCCGTAAATCTACACAGTAATCCC. Deletion right flank: CAAAAAATTATAATTTGTCTTCTTCTTTCA. Insertion Sequence: GGAAAAGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4464 C. elegans atln-1(gk5537[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4161 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AATTCTCCATTATCCGGATTCTCGTGGCGT; Right flanking sequence: TGGAACGGTTGGAATCTGATTTGCAGGTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
OCF108 C. elegans unc-119(ed3) III; atln-1(ocf102[atln-1::GFP::3xFLAG]) IV; ocfIs2. Show Description
ocfIs2 [pie-1p:mCherry::sp12::pie-1 3'UTR + unc-119(+)]. GFP::3xFlag tag inserted at C-terminus of endogenous atln-1 locus. ocf102 guide: CCGCTGATGGACTCAGAAAA. Reference: Maheshwari R, et al. Curr Biol. 2023 Mar 13;33(5):791-806.e7. doi: 10.1016/j.cub.2022.12.059. PMID: 36693370.
OCF116 C. elegans unc-119(ed3) his-72(erb77[his-72::linker::mTurquoise2]) III; atln-1(ocf101[atln-1::3xFLAG::AID*]) IV; ojIs23. Show Description
ojIs23 [pie-1p::GFP::spcs-1 + unc-119(+)]. mTurqoise2 tag with linker sequence inserted into C-terminus of endogenous his-72 locus. GFP::AID* degron tag inserted at C-terminus of endogenous atln-1 locus. ocf101 guide: CCGCTGATGGACTCAGAAAA. Reference: Maheshwari R, et al. Curr Biol. 2023 Mar 13;33(5):791-806.e7. doi: 10.1016/j.cub.2022.12.059. PMID: 36693370.
OCF162 C. elegans ebp-2(or1954[ebp-2::mKate2]) II; unc-119(ed3) his-72(erb77[his-72::linker::mTurquoise2]) III; atln-1(ocf101[atln-1::3xFLAG::AID*]) ieSi38 IV; ocfIs2. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. ocfIs2 [pie-1p:mCherry::sp12::pie-1 3'UTR + unc-119(+)]. mKate2 tag inserted into C-terminus of endogenous ebp2 locus. mTurqoise2 tag with linker sequence inserted into C-terminus of endogenous his-72 locus. GFP::AID* degron tag inserted at C-terminus of endogenous atln-1 locus. ocf101 guide: CCGCTGATGGACTCAGAAAA. Reference: Maheshwari R, et al. Curr Biol. 2023 Mar 13;33(5):791-806.e7. doi: 10.1016/j.cub.2022.12.059. PMID: 36693370.
OCF164 C. elegans spd-5(vie26[GFP::spd-5::loxP]) I; unc-119(ed3) his-72(erb77[his-72::linker::mTurquoise2]) III; atln-1(ocf101[atln-1::3xFLAG::AID*]) ieSi38 IV; ocfIs2. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. ocfIs2 [pie-1p:mCherry::sp12::pie-1 3'UTR + unc-119(+)]. GFP tag inserted into N-terminus of endogenous spd-5 locus. mTurqoise2 tag with linker sequence inserted into C-terminus of endogenous his-72 locus. GFP::AID* degron tag inserted at C-terminus of endogenous atln-1 locus. ocf101 guide: CCGCTGATGGACTCAGAAAA. Reference: Maheshwari R, et al. Curr Biol. 2023 Mar 13;33(5):791-806.e7. doi: 10.1016/j.cub.2022.12.059. PMID: 36693370.
OCF165 C. elegans spd-5(vie26[GFP::spd-5::loxP]) I; unc-119(ed3) his-72(erb77[his-72::linker::mTurquoise2]) III; atln-1(ocf101[atln-1::3xFLAG::AID*]) IV; ocfIs2. Show Description
ocfIs2 [pie-1p:mCherry::sp12::pie-1 3'UTR + unc-119(+)]. GFP tag inserted into N-terminus of endogenous spd-5 locus. mTurqoise2 tag with linker sequence inserted into C-terminus of endogenous his-72 locus. GFP::AID* degron tag inserted at C-terminus of endogenous atln-1 locus. ocf101 guide: CCGCTGATGGACTCAGAAAA. Reference: Maheshwari R, et al. Curr Biol. 2023 Mar 13;33(5):791-806.e7. doi: 10.1016/j.cub.2022.12.059. PMID: 36693370.
OCF167 C. elegans tac-1(or1955[GFP::tac-1]) II; unc-119(ed3) his-72(erb77[his-72::linker::mTurquoise2]) III; atln-1(ocf101[atln-1::3xFLAG::AID*]) ieSi38 IV; ocfIs2. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. ocfIs2 [pie-1p:mCherry::sp12::pie-1 3'UTR + unc-119(+)]. GFP tag inserted into N-terminus of endogenous tac-1 locus. mTurqoise2 tag with linker sequence inserted into C-terminus of endogenous his-72 locus. GFP::AID* degron tag inserted at C-terminus of endogenous atln-1 locus. ocf101 guide: CCGCTGATGGACTCAGAAAA. Reference: Maheshwari R, et al. Curr Biol. 2023 Mar 13;33(5):791-806.e7. doi: 10.1016/j.cub.2022.12.059. PMID: 36693370.
OCF172 C. elegans unc-119(ed3) his-72(erb77[his-72::linker::mTurquoise2]) III; atln-1(ocf101[atln-1::3xFLAG::AID*]) ieSi38 IV; ltIs78; ocfIs2. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. ltIs78 [pie-1p::GFP::TEV::Stag::air-1 spliced coding + unc-119(+)]. ocfIs2 [pie-1p:mCherry::sp12::pie-1 3'UTR + unc-119(+)]. mTurqoise2 tag with linker sequence inserted into C-terminus of endogenous his-72 locus. GFP::AID* degron tag inserted at C-terminus of endogenous atln-1 locus. ocf101 guide: CCGCTGATGGACTCAGAAAA. Reference: Maheshwari R, et al. Curr Biol. 2023 Mar 13;33(5):791-806.e7. doi: 10.1016/j.cub.2022.12.059. PMID: 36693370.
OCF183 C. elegans unc-119(ed3) his-72(erb77[his-72::linker::mTurquoise2] III; ieSi38 IV; atln-1(ocf101[atln-1::3xFLAG::AID*]) IV; ltIs25; ocfIs2. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. ltIs25 [pie-1p::GFP::tba-2 + unc-119(+)]. ItIs25 is a translation fusion of GFP to unspliced genomic tba-2/C47B2.3. ocfIs2 [pie-1p:mCherry::sp12::pie-1 3'UTR + unc-119(+)]. mTurquoise2 tag with linker inserted at C-terminus of endogenous his-72 locus. 3xFLAG::AID* tag inserted at C-terminus of endogenous atln-1 locus. mCherry::SP12 is a stable germline and embryonic expression of ER and NE marker. ocf101 guide: CCGCTGATGGACTCAGAAAA. Reference: Maheshwari R, et al. Curr Biol. 2023 Mar 13;33(5):791-806.e7. doi: 10.1016/j.cub.2022.12.059. PMID: 36693370.
RG5118 C. elegans atln-1(gk5537[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC25 [unc-5(tm9708)] IV. Show Description
Maintain by picking wild-type GFP+. Apparent homozygous sterile deletion balanced over tmC25. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ heterozgyotes, GFP+ gk5537 homozygotes (slow-growing, larval arrest/lethality), and GFP- Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VC4464 and FX30257. gk5537 is a deletion of 4161 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking sequence: AATTCTCCATTATCCGGATTCTCGTGGCGT; Right flanking sequence: TGGAACGGTTGGAATCTGATTTGCAGGTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.