More Fields
Strain Species Genotype
VC2049 C. elegans Y48A6C.1(gk955) III. Show Description
Y48A6C.1. External left primer: GGGTTTTCAGCCATTTTTCA. External right primer: AATTTCAATCAGAAACGCGG. Internal left primer: TTGTATCGATTAATCCCGGC. Internal right primer: TTTCGTCCGAACCGTTAGTC. Internal WT amplicon: 2443 bp. Deletion size: 1549 bp. Deletion left flank: CCATTTTTCAGCAAAAATGCACTGACTCTG. Deletion right flank: CGTAAATTTTTTCGGGTTTTTAAACTCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2050 C. elegans T08G5.7(gk956) V. Show Description
T08G5.7. External left primer: CATCGCCTCAATCAGTCAAA. External right primer: TGTTGCCCCCTAATTTGTTG. Internal left primer: TTTCTTGCCTCCCTCTTGAA. Internal right primer: CAGTTTCCGTTTCGAAGCTC. Internal WT amplicon: 1279 bp. Deletion size: 581 bp. Deletion left flank: CAATCGTGTCACCTTATCATTCACATTTCT. Deletion right flank: GGCTGAAGTTGATCAATTCCGAATTCAGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2051 C. elegans nhr-185(gk957) V. Show Description
F47C10.1. External left primer: TCATTCTGGCAGGAAATTCA. External right primer: GGCGTAACGAAGTCCGATAA. Internal left primer: TCCGGTTAGTCCTGCAATTC. Internal right primer: CTGCTACCCATGTCGAGTGA. Internal WT amplicon: 2231 bp. Deletion size: 847 bp. Deletion left flank: AGCTGAGCCCGGTAGATGTCGGACCACTAA. Deletion right flank: GAGGTATAAATAAAAGTCTATAAGAAAGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2052 C. elegans Y116A8C.19(gk958) IV. Show Description
Y116A8C.19. External left primer: GAAAAGCTCAATTTTTGCCG. External right primer: TCGCCTTCTTTTTACAGCGT. Internal left primer: CGACGTGCTATCGAACTTGA. Internal right primer: CTCCGGAATCTAGCAACCAA. Internal WT amplicon: 957 bp. Deletion size: 210 bp. Deletion left flank: CAAAGAACTGTTTTATAGTTACGATGAGTT. Deletion right flank: GAAAACTGATCTCCGTCATAAGATCCTGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2053 C. elegans wip-1(ok2435) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R144.4. Homozygous sterile or near-sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2435 homozygotes (grotty, Unc, with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACGTATTCCGAAGTGCGAC. External right primer: CCATGAAGAAACCCAGGAAA. Internal left primer: TCAGAAAGATTGTTCCGGTTTT. Internal right primer: GGGGGATTGACGGACTATTT. Internal WT amplicon: 3053 bp. Deletion size: 1544 bp. Deletion left flank: AAATAAGACGGTAAAGAATTTTATCAGAAT. Deletion right flank: TCAGTTCCAAGCTCAAAACCGACTCCACCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2062 C. elegans T08G5.7(gk986) V. Show Description
T08G5.7. External left primer: CATCGCCTCAATCAGTCAAA. External right primer: TGTTGCCCCCTAATTTGTTG. Internal left primer: TTTCTTGCCTCCCTCTTGAA. Internal right primer: CAGTTTCCGTTTCGAAGCTC. Internal WT amplicon: 1279 bp. Deletion size: 646 bp. Deletion left flank: TATTGAAAAATCCCGATTTTCGTAGAATTT. Deletion right flank: CCAGGAGGAAGGTACAAATGCCCTGTGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2063 C. elegans Y17G7B.22(gk1012) II. Show Description
Y17G7B.22. External left primer: CCCGTAGTTCATCGATTGCT. External right primer: AAAAAGAATACCACCGGCCT. Internal left primer: ATCTGTTGCCTTCTGTTGGG. Internal right primer: TCGCAGGAGTTTGGGTACTT. Internal WT amplicon: 2119 bp. Deletion size: 1795 bp. Deletion left flank: AAAGACGAAATTGAGAAGAAAATTGCTGAG. Deletion right flank: TTTTGGTGCTTCAAAAAACATCAAAAAATA. Insertion Sequence: AAAATTTGATACTTTTTGATGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2067 C. elegans C43H6.7(gk985) X. Show Description
C43H6.7. External left primer: ATCTTCATATTTGACCGGCG. External right primer: TCCATTCTGCTTCGTCACTG. Internal left primer: ACCATCACCAGAAGAATGCC. Internal right primer: GGTCAAAGCTGCGAACTCAT. Internal WT amplicon: 2524 bp. Deletion size: 438 bp. Deletion left flank: GCTTTGTAGTAATGATATTGGATGTTGAAT. Deletion right flank: TTTTCGTAATTACTACAGTGTTCTCAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2068 C. elegans Y53C10A.15(gk914) I. Show Description
Y53C10A.15. External left primer: ATACAATGCGCCATGTTTGA. External right primer: CGGTGTGAATGGTCAATGAG. Internal left primer: ATTCCCACGTGGAGTCAGAA. Internal right primer: AAGTTGTTTGAAATGCCGCT. Internal WT amplicon: 2020 bp. Deletion size: 1162 bp. Deletion left flank: CGTCTCACCTGATTTCGCATGGTTAAGAAC. Deletion right flank: CTTCGAATCTTTTGACTGCTTCAATGTGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2069 C. elegans Y116A8C.20(gk913) IV. Show Description
Y116A8C.20. External left primer: ACGCTGTAAAAAGAAGGCGA. External right primer: TGAGCACGTTTTTGAAATGC. Internal left primer: AGCGGCTGAAGAGAAGTTTG. Internal right primer: GACTGACGCAGTGACAGGAA. Internal WT amplicon: 1414 bp. Deletion size: 378 bp. Deletion left flank: ATGGGCGGAGCTTCCCGATCAATAATTGAC. Deletion right flank: CAATTACCCTCCATCCCTTTCACATACATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2071 C. elegans F39B2.1(gk3174) I. Show Description
This strain is homozygous for a deletion (gk3174) in F39B2.1, detectable by PCR using the following primers. External left primer: CCGGTAGTAGCTTTCCCCTC. External right primer: AAGTCGCATAAGTCCATCGG. Internal left primer: ATATCAACCATCCAGCCAGC. Internal right primer: CGTCAGAATGGTACACAGCG. Internal WT amplicon: 2358 bp. Deletion size: approximately 450 bp. Validation: gk3174 passed by CGH. Left deleted probe: CATGGTCGCGACGAGGCTCAATCTGATCCATCACGCCAACTTTTGTTTAA. Right deleted probe: GATAGAATTCAACAGAATTTTTCGAGTGAGTAAGGATTTCTGGACAGTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2072 C. elegans grh-1(gk960) I. Show Description
Y48G8AR.1. External left primer: GTTTTCCTAAAGTTCGGCCC. External right primer: CCCTTTCACTTTTCACCGAA. Internal left primer: CATAAGCTCGATCCCAAAGC. Internal right primer: CTTTGAATCGCGGAATTTGT. Internal WT amplicon: 3012 bp. Deletion size: 786 bp. Deletion left flank: CAATGTCGATTGGCTCGTTTTTGAATTCTA. Deletion right flank: AATAGTTAAAGTCCAATTCATTGTTTATTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2073 C. elegans Y71A12B.8(gk983) I. Show Description
Y71A12B.8. External left primer: TCAGGTGAGATGTCTGCGTC. External right primer: CTCGGCAATGTTTTCCAAAT. Internal left primer: CTGCCATACCTGGACGATCT. Internal right primer: CCCTATCCTATGCCTACGCC. Internal WT amplicon: 2070 bp. Deletion size: 610 bp. Deletion left flank: GGTATTGGAATATTTGAAACTTGATTTGGT. Deletion right flank: TTATGCTTAGTCTTAAGCTTAGGCTTAGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2074 C. elegans C39D10.7(ok2758) X. Show Description
C39D10.7. External left primer: TTTGCATGTATCCACGGTGT. External right primer: TAAGCAGCGGAAACCATTTT. Internal left primer: GGGGCACATGAGGAAATAAG. Internal right primer: TTTCAAACAAAAATTCCCCC. Internal WT amplicon: 1179 bp. Deletion size: 691 bp. Deletion left flank: CAGATAACTTGTGATTTTGCACAGTCTAAC. Deletion right flank: TAGAGTTGTTGTGAAGATTGTTGATGTGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2081 C. elegans T26A8.4(gk917) IV/nT1 [qIs51] (IV;V). Show Description
T26A8.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk917 homozygotes (Dpyish, late larval arrest or sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCTTTGGCTCTTCTTGGAT. External right primer: TGTTTGCGCTGAGAGAGAGA. Internal left primer: GCTGAACTAATCCAGGCTGC. Internal right primer: TCCAACGTTCAAGATTCCAA. Internal WT amplicon: 1977 bp. Deletion size: 722 bp. Deletion left flank: TAATTATTATGGAAAAGTGATTTCGATTTT. Deletion right flank: AATTATTCCCATTTATTAATGCGTCAATAA. Insertion Sequence: TTGCTTACCTCCAGGGAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2082 C. elegans srab-2(gk686) V/nT1 [qIs51] (IV;V). Show Description
C04F5.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk686 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGTCAGACCCGCTTTGAGAA. External right primer: CAAACATGGTGCAAGACCAG. Internal left primer: CGAAGAATGCTTGCAAATGA. Internal right primer: TCCTTCGAGCCAGCTGTATT. Internal WT amplicon: 2299 bp. Deletion size: 1150 bp. Deletion left flank: AAGAAACTCTTTTGAGTTACCTCATTTTTT. Deletion right flank: TTTCTCCACGCTACTCCGACACATTATCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2083 C. elegans wrt-3(ok2608) II. Show Description
F38E11.7. External left primer: ATGGCCATTGACTCTTCTGG. External right primer: GAAGAAGACTTTGGGAGGGC. Internal left primer: TTACGCGCAAAATTTCCTCT. Internal right primer: TTCGCGGTCATTTTCATTTT. Internal WT amplicon: 1168 bp. Deletion size: 688 bp. Deletion left flank: GATTTGAGATAACTTGTTTTAGGGAAACTT. Deletion right flank: GGTTTTGAACACATTAATCGAACCACTCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2084 C. elegans ngn-1(ok2200) IV. Show Description
Y69A2AR.29. External left primer: ATTTCCGACGACGAACTGTC. External right primer: ATCTCCAGACTGGTGTTCCG. Internal left primer: CAAAGTTGGTGGCCTAGGAA. Internal right primer: ATTCTACCCGCATCATTTGC. Internal WT amplicon: 2637 bp. Deletion size: 2266 bp. Deletion left flank: TGACGACTTCTATTTGATGGCCTAACTTCC. Deletion right flank: AATTGTAAGGCTAATGAAGCAATGAAAAAA. Insertion Sequence: AGAGACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2085 C. elegans C06B8.7(ok2521) V. Show Description
C06B8.7. External left primer: TCACAGAGCGATGGTACTCG. External right primer: CCACCTCGAACCGTTTTCTA. Internal left primer: TGCAGATTCAAACCCATCAA. Internal right primer: TCCAACATTCCTTGCGTGTA. Internal WT amplicon: 1163 bp. Deletion size: 540 bp. Deletion left flank: AGCCAACGGCATGCTGGTTATGCTCACCTT. Deletion right flank: TGTGACTTAAGACTTTCTGGCAATGATTCT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2086 C. elegans nhr-237(gk1050) V. Show Description
Y46H3D.6. External left primer: TCGAATTGCATTTTGACAGC. External right primer: CGAAAAACAAGCAGCACAAA. Internal left primer: ACACGAATGCATAATTGCCA. Internal right primer: TACCGCCCAGTTTCAAGTTC. Internal WT amplicon: 2013 bp. Deletion size: 1085 bp. Deletion left flank: TCTGGGCTTCACTGATTGGGGTTAACGATT. Deletion right flank: CTTTATTAGACTCAAAGTTGTCTGAAAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2088 C. elegans xnp-1(ok1823) I. Show Description
B0041.7. External left primer: GAGTCATTCGAGCCAATGGT. External right primer: TCCGAAAAAGAAGAAGCCAA. Internal left primer: TTTACGCAGCAAATCAGCAG. Internal right primer: TCTGTTTGACGGGTACACCA. Internal WT amplicon: 3252 bp. Deletion size: 1353 bp. Deletion left flank: AAACGATAGACACGGAACAGAGATTGAGTG. Deletion right flank: CTTCTTCCTCTGCATCTTCTCTCATTACTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2091 C. elegans C09H10.7(ok2381)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C09H10.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2381 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAAATTTCCAGGTTCGTCGT. External right primer: TTCCTGTTCGAAACGAGGTT. Internal left primer: GTGGATGCTCCAACTGACAA. Internal right primer: TGACGATTTGAATGTCTGATACAA. Internal WT amplicon: 1330 bp. Deletion size: 456 bp. Deletion left flank: TTCAAAATGGAGTTTGATATCAAAAAAGTG. Deletion right flank: ATCAGAAGGAGAAGACGCATCGGATTTATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2093 C. elegans T15B7.2(ok2680) V/nT1 [qIs51] (IV;V). Show Description
T15B7.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2680 homozygotes (late larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCAGACGTATCTGGTTGCG. External right primer: AATGCAGCAGAGAGCGACTT. Internal left primer: ACAACGTGTTACAAATTTTAGGG. Internal right primer: GACTCCTCACGGATGACGAT. Internal WT amplicon: 1144 bp. Deletion size: 925 bp. Deletion left flank: TAATTTAAATTAATTTCAGATGGTCTGCAA. Deletion right flank: TATAAATAATAACACCAATATATGAGATTC. Insertion Sequence: ATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2099 C. elegans mat-3(ok2476)/sC1 [dpy-1(s2170)] III. Show Description
F10C5.1. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2476 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACTTTCGCCGTTTGATGTC. External right primer: CCGAAAATTAGCCGATTTGA. Internal left primer: TGATAAATGGTGTGCTCCGA. Internal right primer: GATTTATCCGTCAGCCGAAA. Internal WT amplicon: 2623 bp. Deletion size: 1324 bp. Deletion left flank: CTAAGGCCATAAAAATCAACAAAATCTAAA. Deletion right flank: TATTTAGCAGACCAAAGTTGGGTATCCAAT. Insertion Sequence: GAAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2100 C. elegans Y56A3A.2(ok2738) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y56A3A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2738 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTAAGCTCCGCCCATTTCT. External right primer: AACATCAATTTTGCCGGAAG. Internal left primer: GCTATTTCGCACTAAAATTGTTCA. Internal right primer: GAAGTTTCAATTCCGGCAAA. Internal WT amplicon: 1156 bp. Deletion size: 411 bp. Deletion left flank: ACGTTCGAATACACCTCCACCAGTCGGCAA. Deletion right flank: GTGCCAGAATTTGAATTTCCGGCAAATCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2101 C. elegans skp-1(ok2739) V. Show Description
F27F2.1. External left primer: TACGGATTGGAAAGCTCGAT. External right primer: AATGCTTCTGGCTTGTTGGT. Internal left primer: AACAAAATCTAACAGCCGCC. Internal right primer: TGAAAGATGCTCGCAAACAC. Internal WT amplicon: 3353 bp. Deletion size: 1242 bp. Deletion left flank: AGCACCTGCTCAATATATCAGATACACTCC. Deletion right flank: TTCATTTTTTCTAAATTTCGAACCGCCATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2102 C. elegans ril-1(ok2492) V/nT1 [qIs51] (IV;V). Show Description
C53A5.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2492 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGAATGAAGCGTTTGACGA. External right primer: GACGTGCCCTTGACCATAAT. Internal left primer: CAGCGAAAAACTTCGTTGAA. Internal right primer: CATAGTAGTAGGCGACACGGC. Internal WT amplicon: 2899 bp. Deletion size: 1269 bp. Deletion left flank: ACTGAAATTGTCATTATTTATTTTCTTCAT. Deletion right flank: ATGATCTTGCCGAATTCAGTTTATTGATCA. Insertion Sequence: TTTCTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2105 C. elegans arx-5(ok1990) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y37D8A.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1990 homozygotes (late larval arrest or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTGGATTTTTCTGCGTCTC. External right primer: GGCCAATATGCTTTTCGTGT. Internal left primer: GATACCGTGGCGTTTTTGTT. Internal right primer: CGGGTCTCAACACGAAAAAT. Internal WT amplicon: 2347 bp. Deletion size: 879 bp. Deletion left flank: ATAGAGATTTCGCGTATTTCGCGCACAACA. Deletion right flank: AAAAATCTGTTTTCGGTAGGAATGTTCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2107 C. elegans grd-12(ok2677) V. Show Description
F02D8.2. External left primer: ATCAATGTCCGCCAGCTTAC. External right primer: ATGTCCATCATGCACTCCAA. Internal left primer: CGGAATTATAATCCTCCGCA. Internal right primer: AGCCGGATACATTTGAGTTCT. Internal WT amplicon: 1104 bp. Deletion size: 597 bp. Deletion left flank: TCATATGCTATGCCAAAATACGCAGTTGCT. Deletion right flank: GGAAAGGTATTATTCACATATCTACTTATC. Insertion Sequence: TCCCAATATGCAATGGTTCCATATCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2109 C. elegans Y53F4B.4&Y53F4B.42(gk1068) II; T25B9.10(gk3262) IV; K04C1.5(gk3263) X. Show Description
This strain is homozygous for a deletion (gk1068) in Y53F4B.4 and Y53F4B.42, detectable by PCR using the following primers. External left primer: GGCAAAATTGTACGCATCCT. External right primer: CTTGTTTCGCTCGATTCACA. Internal left primer: TCTCGTTAGGTATTTGCGGC. Internal right primer: CGCAACTGCGTTAAATCGTA. Internal WT amplicon: 2605 bp. Deletion size: 557 bp. Deletion left flank: AATAGAAAATGCATTTTAAAATGCGAAAAA. Deletion right flank: CCCGATTTTTGACCGATGACACCAAAGTTT. Validation: gk1068 passed by CGH. Other deletions (gk3262, gk3263) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2110 C. elegans Y73B3A.5(gk982) X. Show Description
Y73B3A.5. External left primer: TTCGTCAAAGTCAGTCAGCG. External right primer: AGGGCACTTTTTGTCTGCAC. Internal left primer: GAGAGCGTGCCATATTGGAT. Internal right primer: ACTACTGACGCCCACACTCC. Internal WT amplicon: 2261 bp. Deletion size: 697 bp. Deletion left flank: TATGTTTTTCTAAAAGTAAGATTCATTTTC. Deletion right flank: GATTTTCTCGACGATTTTTGGATTTTCAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2111 C. elegans rha-2(ok2639) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C06E1.10. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2639 homozygotes (grotty sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGCCAATGTTTTTCCGAGT. External right primer: TTCCACTTCGTTCCAAAACC. Internal left primer: CGTGATTCTTGCTTCCGTTT. Internal right primer: GTTATCAAAGTTGACGCCCG. Internal WT amplicon: 1103 bp. Deletion size: 558 bp. Deletion left flank: TCTGGAAATTAGCTTTTTTATTCTATAAAT. Deletion right flank: AGAATGGCACCCGGTGGTAGAGTTTCATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2112 C. elegans Y71F9AL.17(ok2824) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y71F9AL.17. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2824 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTTTGACTTTTGCCCCCTT. External right primer: TCAGCAAGGATGTTGCTCTG. Internal left primer: AGCTGTCTGGAAATGTCCGT. Internal right primer: CTCCGTTACCCACAACCATT. Internal WT amplicon: 1146 bp. Deletion size: 766 bp. Deletion left flank: TGACAAGCTTATCCGTATTTCCAGTAACAA. Deletion right flank: AGCCGTGTTGATATTCTCGAGTTTGCGAAG. Insertion Sequence: GATACAAAAACGAGAGCTTCTCAAAGTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2114 C. elegans lpin-1(ok2761) V/nT1 [qIs51] (IV;V). Show Description
H37A05.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2761 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTACACACTCGGCGGTTTT. External right primer: TGTGTTAATTGGCACAGGGA. Internal left primer: TCAATTTCAACTGGATTCGATG. Internal right primer: AATCCTGCCACACTTTCAGG. Internal WT amplicon: 1279 bp. Deletion size: 518 bp. Deletion left flank: CTCGGTCTCAGCAGCGAGAACTGTAAGATC. Deletion right flank: GCTCTACGACAACCACATCGATTGCTCCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2115 C. elegans knl-3(ok2788) V/nT1 [qIs51] (IV;V). Show Description
T10B5.6. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2788 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTTTTCGGCAAACTGCAAG. External right primer: AAAAATTGGAATCGGCTTGA. Internal left primer: GCCATTTCTTTGTTTTCAACG. Internal right primer: AAGCCCTGCTTGATTTCCTC. Internal WT amplicon: 1147 bp. Deletion size: 642 bp. Deletion left flank: AACGACACCACATTCTCGGTCAGAGCCGCG. Deletion right flank: AAACTAAGCTCAAGTCAGCTATTGAAATCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2117 C. elegans rab-6.2(ok2254) X. Show Description
T25G12.4. External left primer: GGGGAAAGTGTTCACTGCAT. External right primer: GCGTTGCTTTTCGTCTTTTC. Internal left primer: TCTTTTCCGTGCCTTACACC. Internal right primer: TCCCCATCATTTTTCGTGAT. Internal WT amplicon: 2461 bp. Deletion size: 847 bp. Deletion left flank: TTATTTTGTCTCGTGTTCGTGTTCCTCTTG. Deletion right flank: ATGTAATCATCATGTTGGTCGGCAACAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2118 C. elegans asd-1(ok2299) III. Show Description
R74.5. External left primer: TGGATTGTGAAAACCCCCTA. External right primer: GATGCAGAGCCTGTGAGTGA. Internal left primer: TGCGCCCCCATAATAAATAA. Internal right primer: GCAGCGACTTGATTTTGTGA. Internal WT amplicon: 3250 bp. Deletion size: 1611 bp. Deletion left flank: TCTTTCAATCTTTCATTTCTAACCGATTTC. Deletion right flank: TCAGGTAAGGAAAATAGTGTTTCGTGATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2119 C. elegans K07A1.13(ok2573) III. Show Description
K07A1.13. External left primer: TTACGCGATGCGATTCAATA. External right primer: GACGACGGGCATCTGTAAAT. Internal left primer: CCAATTATTCCAATAAATACGAAAC. Internal right primer: GTGGTTTCATTCTCGTATCTCAG. Internal WT amplicon: 1198 bp. Deletion size: 516 bp. Deletion left flank: TCTCGTATCTTGCCATGTAGATGTAATGCA. Deletion right flank: AAAGTTTTGAGTTATTTCATATCGAGCGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2120 C. elegans W03G9.5(ok2325) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
W03G9.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2325 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTCTGCACATTTTTCTCG. External right primer: CCGTGAAATTCCCAGTGAAC. Internal left primer: GAAACTTGGAAAACCGCAAA. Internal right primer: GGATTTGCCGAAGATTCAAA. Internal WT amplicon: 2805 bp. Deletion size: 790 bp. Deletion left flank: ATTATTAATATTGAGCTCCCCCATGCCTGC. Deletion right flank: TTCCATTATTCCCGTCCTGAAAAAAAATGA. Insertion Sequence: TCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2122 C. elegans grl-23(ok2849) V. Show Description
E02A10.2. External left primer: TCGACCTTCTCGCTCTTTTC. External right primer: GAGGAGGAGGTGGAGGATGT. Internal left primer: CGACCTCATCTTCCTTCTTTTC. Internal right primer: CGCCAGTTAAGATGGTTTGG. Internal WT amplicon: 1228 bp. Deletion size: 583 bp. Deletion left flank: CTTGCGTCCACATCCACCACCGCATCCTCC. Deletion right flank: ACCTCCTCCTCCACCTGTAAATCAAATAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2123 C. elegans sri-14(ok2865) I. Show Description
M01G12.1. External left primer: CTGCTGCGTTTTTCGTATCA. External right primer: AAGAGCGAATGGATTTGGTG. Internal left primer: TCAGTCTGATCATTTTTCCTTCAA. Internal right primer: TGATTGGTCGGTCATTCAAA. Internal WT amplicon: 1166 bp. Deletion size: 532 bp. Deletion left flank: ACGTCGATTGCTTTTTGACTTCGCAGAAAT. Deletion right flank: ACAAAGTGGCACAACTATAAAAACGCCAGGAAGCACTATTTGCATGACTAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2124 C. elegans F40F9.7(gk993) V. Show Description
F40F9.7. External left primer: CCGTACAGCTGCATCAAAGA. External right primer: GTGTGGGTCGGTAATGGTTC. Internal left primer: ATCACTCGTCTTTACGCGCT. Internal right primer: ATCAACTCGCGATCCTTGTC. Internal WT amplicon: 2178 bp. Deletion size: 568 bp. Deletion left flank: ACATACAGAACATATAGAACATAACACACT. Deletion right flank: ACTCGTTAGTTTTGACCTTATCTTTTAGGG. Insertion Sequence: AAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2125 C. elegans tfg-1(ok2290)/hIn1 [unc-101(sy241)] I. Show Description
Y63D3A.5. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2290 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGCTCCGGATAAACTTGGGT. External right primer: TATTCCCTTCCCACCAATCA. Internal left primer: TTCCAGATGGTGCATTCAAA. Internal right primer: AGACAGGAGCCCGAGATTTT. Internal WT amplicon: 2440 bp. Deletion size: 1264 bp. Deletion left flank: AGCAGATTAAGGTAAGGAGGATTTTGAGCG. Deletion right flank: CCACCACCGCAGGGAGCTCCCCAGCAAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2127 C. elegans mog-4(ok2708)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
C04H5.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2708 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATCTTCGCCTGCAAATCAC. External right primer: TTCATGCCGTACCTGTTCAA. Internal left primer: TCTTCGATCCCAGTGCTTTC. Internal right primer: AAGGAGCAAAACTTCGATGG. Internal WT amplicon: 3202 bp. Deletion size: 2453 bp. Deletion left flank: ATACCAAAATATCGCCGGGAAGTGGCTGGG. Deletion right flank: GCGAATAAAAGTCGAAAAAAAAATGTTTTG. Insertion Sequence: ATTTTTTTTCGTTTTTTTTTGGGTTTATTCGAAGTATTGATTAAAATTTAAGAGCGATC GATTTTTTTCTTAATTAAAAACAAAAATCCTGAATGTTTGGTTTTTTTGCTGTTTTTGT AAATGTTCTAAAAATTACCTATAACTAGCCAAATCGGGTTCGTTGAGAAACTCTCTGAG CAGCATTCCGTCTGTCATGTATTTGAGGACAGTCTTCTCCGATGTGCAATCCTCGAAAC GAATACTGTAGCCGACCTGGAAAATGGAAGCGTTTCGAAAGAAAAATCGGAATCTGTTT TCCTCGTTTTTTTACAAGTTTAAAAATTTTTAGAAGCGGCAAAGAATTGCCCAAATTTT TTTAACTTCCAGTTTTTTTTTCTAAATTTTGGAATTTTCCGACTAGAATGAAACTTAGT TTATTTTCGCCAATTTCCAAAAACCACCCAACCTGAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2128 C. elegans Y38H8A.4(ok2793) IV. Show Description
Y38H8A.4. External left primer: CACTTCCCCCAGTTTTTGAA. External right primer: GATCAACATCACTCCGACCC. Internal left primer: CCACCTTTAAAATTGGGCAG. Internal right primer: GTGAAAAAGATGACTACATCAAGAA. Internal WT amplicon: 1314 bp. Deletion size: 551 bp. Deletion left flank: CCCCTTCTTATCCATGATGTCTCTTGCTAT. Deletion right flank: GCACAATGTTATATGATTGGAGATGCTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2129 C. elegans T19B4.1(ok2681) I. Show Description
T19B4.1. External left primer: GGCATGTAGGCAGACAGTCA. External right primer: CAAACCTTGCATCCCAAACT. Internal left primer: CAGTTGCATTTGAACCGATG. Internal right primer: TTCCAGCTCTTTGGAAAACG. Internal WT amplicon: 1163 bp. Deletion size: 519 bp. Deletion left flank: CAAGATGGAATAAAATATTTTGTGCTCCAA. Deletion right flank: AAATCTAAAATAGTCAATTTTAAGAAAAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2130 C. elegans Y65B4BR.8(ok2828) I. Show Description
Y65B4BR.8. External left primer: TAAAGGCGCACACATTTTCA. External right primer: GTTTTTGCAGCAGCCTTTTC. Internal left primer: AAAATTTGTCGTGCCGAGAT. Internal right primer: TTACAGAATGGTGGGTTTGAA. Internal WT amplicon: 1278 bp. Deletion size: 465 bp. Deletion left flank: AATCGTTCCAATTGTTTCCAGGTAATGGCT. Deletion right flank: TCGCACGATGCCTTGTCTCCACACTTACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2131 C. elegans Y54G2A.20(gk962) IV. Show Description
Y54G2A.20. External left primer: TCGCAATGAGTGTTCTCCTG. External right primer: CTCATTCCCTGAACTCTCGC. Internal left primer: GGACAGGCCGCATACATATT. Internal right primer: ATCTCAAGAACGTTCACCGC. Internal WT amplicon: 2280 bp. Deletion size: 855 bp. Deletion left flank: TAATCTGATACGATTCTACCTGATATCTTG. Deletion right flank: AATGGTTGAGAACTGACGCTTTGGATGAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2132 C. elegans C35D6(gk980) IV. Show Description
C35D6. External left primer: GCCCAGGATGACAGTTGTTT. External right primer: GACCTGTGGATCCTCCTTCA. Internal left primer: TCATCATGAGTGGTCGTTCC. Internal right primer: TTGAAGTGAGACGGTCCTCC. Internal WT amplicon: 1678 bp. Deletion size: 204 bp. Deletion left flank: TTACTATTACTTTTCGATCCCGCCACTTTT. Deletion right flank: ATATGTTACTGTTTTCTATTTTGTTTTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2133 C. elegans C11E4.7(gk3221) dhhc-1(gk1067) X. Show Description
This strain is homozygous for a deletion (gk1067) in F09B12.2, detectable by PCR using the following primers. External left primer: TGGTGGAGGTTTTCAAGGAG. External right primer: GCGTCATGGTGGGTAAAATC. Internal left primer: AAAGTGAACAGCGAAACGGT. Internal right primer: TAACTGGCAGCAGTGGTGAG. Internal WT amplicon: 1907 bp. Deletion size: 502 bp. Deletion left flank: TATAAGCCTGGCTGAAAGTTACGAATTTGG. Deletion right flank: AAAATTTGAATGAAATGTAAAGTTGAAGTA. Validation: gk1067 passed by diagnostic PCR, CGH. Other deletion (gk3221) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807