More Fields
Strain Species Genotype
VC1848 C. elegans mom-5(gk812) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T23D8.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk812 homozygotes (sterile, eggs don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGTGTGTGCTCCGTTCTCTC. External right primer: AATCGGTCGAACTGGATACG. Internal left primer: GCACTTGGAACCAATGTCAA. Internal right primer: AATGAACATTCAGGAAGGCG. Internal WT amplicon: 1742 bp. Deletion size: 567 bp. Deletion left flank: TTTTAGCTATTTACTTAAGTTCGGTTTTTT. Deletion right flank: AAAAGTTTGGATTTCAATGGCCAGATCAAT. Insertion Sequence: GAAAAAGTTTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1853 C. elegans dre-1(gk857) V/nT1 [qIs51] (IV;V). Show Description
K04A8.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk857 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCATTTGTTGAGCCTGCTG. External right primer: ACGCTGAGAGTAAGTGCGGT. Internal left primer: TCAGTGAATGTCAATGCGGT. Internal right primer: CCCGATCATTCTCAACCATT. Internal WT amplicon: 2234 bp. Deletion size: 1021 bp. Deletion left flank: TGAAAACACTTTGAGAAGAAGTTCTTCGGG. Deletion right flank: TAGATGGTGGCAGATTCCGAATAGCTGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1855 C. elegans mbtr-1(ok2465) I. Show Description
Y48G1A.6. External left primer: GCCGACAGGATGCATAAAAT. External right primer: CCCTGCTGGTTTCATATGCT. Internal left primer: GGATTCATCGTCCGATTCTG. Internal right primer: GCCAACAGAGGAGATTCTGG. Internal WT amplicon: 1178 bp. Deletion size: 722 bp. Deletion left flank: AATCCATTAATCATTGCAAATCCGACTGGA. Deletion right flank: TTTTTTCACATTCTCCACCAGAAAAAACAT. Insertion Sequence: TTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1856 C. elegans pde-1(gk891) I. Show Description
T04D3.3. External left primer: GAATGATGTGGCGCTAGGAT. External right primer: AAATATCCCCCAAAGGCAAC. Internal left primer: TCTGCGTCTCTCTCCCTCTC. Internal right primer: GATACATGGGCCAAGACACC. Internal WT amplicon: 1592 bp. Deletion size: 778 bp. Deletion left flank: CACAAGTTGAGAAGCATCTCTGATTGACTT. Deletion right flank: CGGAAATAAAGTTTTAGATAATTTGAGATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1857 C. elegans ces-2(gk892) I. Show Description
ZK909.4. External left primer: GCTCTGCGTCTCGTTCTCTT. External right primer: TCTACGGGGGTATAGTTGCG. Internal left primer: CACTGTTGCACCCTCTGATG. Internal right primer: TGGGTGGTGCTAAACAATGA. Internal WT amplicon: 1932 bp. Deletion size: 651 bp. Deletion left flank: TCGGAAGTTTAAACTGAAAATCAAACATTT. Deletion right flank: GATGGTTTATGGGTGTCAGAATTTTTGATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1858 C. elegans lin-39(gk893) III. Show Description
C07H6.7. External left primer: GGACCCGAAATGTTTCAAGA. External right primer: CCGTTATTCTGCCGATCATT. Internal left primer: TCAGCGCTTTGCAGAAACTA. Internal right primer: CGAAATTGCTGAGTTCGTCA. Internal WT amplicon: 1900 bp. Deletion size: 1206 bp. Deletion left flank: GGAGCTTCCTAACTATAACGCTCCAACTCT. Deletion right flank: GCATTCATCAAAAGGAATTAGATCAACCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1859 C. elegans Y67D8B.2(gk894) IV. Show Description
Y67D8B.2. External left primer: GGAAAAGCAGACAACCTTGC. External right primer: AAGCCTGCCTAACGACTTGA. Internal left primer: GAGATTCCAGCAAGCCACTC. Internal right primer: GGGTGCCACTAATCGCTAAA. Internal WT amplicon: 1761 bp. Deletion size: 485 bp. Deletion left flank: CATTTGGGTCGAGGCTACTGGATTCATCTG. Deletion right flank: CCTATATGCCTACGTGTTAGGTCGGATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1860 C. elegans nhr-262(gk897) V. Show Description
F09C6.8. External left primer: ATTTGCCGCGATTAACGTAG. External right primer: GATTTGCCCATTCTGTTGCT. Internal left primer: GACAAGCATTCTCTGCGTGA. Internal right primer: TTTCAGGCAAAGTTTGAGCA. Internal WT amplicon: 2373 bp. Deletion size: 2158 bp. Deletion left flank: TCTGCGTGATCTTTCGTGTGCAAACTGTGA. Deletion right flank: AACATATAAATTTTCCGCCAAAAATTTTCT. Insertion Sequence: ATTTTCCGCCAAAAAACTGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1862 C. elegans F17C11.9(ok2464) V/nT1 [qIs51] (IV;V). Show Description
F17C11.9. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2464 homozygotes (sterile Dpy). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCTCGCCAACAAGACTGT. External right primer: TCCGAAAAGAATCATGGAGG. Internal left primer: ATTTCAGACCCCAGCATTTG. Internal right primer: TACAGCTCATGAAGGCGAGA. Internal WT amplicon: 1152 bp. Deletion size: 357 bp. Deletion left flank: AACGTTTTTCATGGGACTGAGAGTTGGAAA. Deletion right flank: ACCAAGGCTATCCCACACTTCTGGGAGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1863 C. elegans ZK418.9(ok2248) III. Show Description
ZK418.9. External left primer: AATACTTCGTCGCAGTGCCT. External right primer: ACTGCCAATTTTTCGAATGG. Internal left primer: AAACGAGATCGGCACAATTC. Internal right primer: TGGTGGCATTGGAACACTAA. Internal WT amplicon: 2302 bp. Deletion size: 966 bp. Deletion left flank: ACACTGGCTTGTGGTTGTTGCATAGGATTC. Deletion right flank: GAAGTGGCTTCGGCTGGCCAGTTGCAGTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1864 C. elegans Y49E10(ok2316) III. Show Description
Y49E10. External left primer: ACCGCACCACATATGATTGA. External right primer: GTCGTCGTCGGAACACATAA. Internal left primer: AATGCGCGCGCTTAGTAG. Internal right primer: TCACCTGTTTTAGGCATTTTCA. Internal WT amplicon: 3186 bp. Deletion size: 1053 bp. Deletion left flank: TCGAGAGTACAAAATAAGCCTGTGGAAAAA. Deletion right flank: TCCAGATCTAAATAAAGGTTTATAACAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1865 C. elegans ZK265(gk3042) I. Show Description
This strain is homozygous for a deletion (gk3042) in ZK265, detectable by PCR using the following primers. External left primer: ATTTTGGCGCATATCTCACC. External right primer: AGGGTGCGATTAACGTTTTG. Internal left primer: GCGTTGGTAGGTTGTGTTGA. Internal right primer: GCACTCTGCGGGATTTCTAC. Internal WT amplicon: 2020 bp. Deletion size: 1123 bp. Deletion left flank: AAGAAGAACTGTGTGATGGGAAGCAGCAAA. Deletion right flank: AGACACTTGTGGATTCCTCGAGAAAAAGTG. Validation: No CGH probes for gk3042. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1867 C. elegans T24A6(gk1030) V. Show Description
T24A6. External left primer: AGGAGGAACTCCTCATCGGT. External right primer: CTGTCCTCGCACAAAATCAA. Internal left primer: GGAGTGGTCAAACGGTCATT. Internal right primer: TTCCAGGCTACCCAAATAGC. Internal WT amplicon: 2157 bp. Deletion size: 185 bp. Deletion left flank: ATAAAACTAAACTTTTGTGTAAATAATACA. Deletion right flank: AATTGGGATATGTTAATGGTGGCGCTACAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1868 C. elegans F39H11.1(ok2247) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F39H11.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2247 homozygotes (mid- to late-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GACTTCGTCGTGAGCATTCA. External right primer: ATTCTTAACCGTGCGACACC. Internal left primer: CATCATAAAGCATGTGCGCT. Internal right primer: TGTCGCTGCTCAGAAGAAGA. Internal WT amplicon: 2222 bp. Deletion size: approximately 400 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1872 C. elegans W07G4.4(ok1223) V. Show Description
W07G4.4. External left primer: TAGCCTGCCATCTCTTTTGC. External right primer: GGGGCGAATGATAAGAAACA. Internal left primer: CTTTTGATGCTGTCGTGCTC. Internal right primer: AAACGTGAGGAAGCACAAGG. Internal WT amplicon: 2105 bp. Deletion size: 1522 bp. Deletion left flank: AAACGTGCGGAGGAAAGCATAGATCAGCAT. Deletion right flank: CCATCAGTTAGCTTCCCTAATCCACTTGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1873 C. elegans rad-51(ok2218) IV/nT1 [qIs51] (IV;V). Show Description
Y43C5A.6. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2218 homozygotes (sterile, lays eggs that don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTTACCTCATTCTTGGCCG. External right primer: GTTCCTATCGGTGCCTTTCA. Internal left primer: TGAATCCGTGAAAGTGTGGA. Internal right primer: AGGACTTGGCACGTGTCTCT. Internal WT amplicon: 2435 bp. Deletion size: 1634 bp. Deletion left flank: AACGAACGGCTAGTCCTCGCGTGCGTCCTC. Deletion right flank: TGATACTTTCAATTCAATTAATTGGATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1874 C. elegans mes-4(ok2326) V/nT1 [qIs51] (IV;V). Show Description
Y2H9A.1. Homozygous maternal effect sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2326 homozygotes (maternal effect sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGTTCTTGCGGTTTTTCGTG. External right primer: TTCCAGCTACCTTCACCCAC. Internal left primer: GGTGTCGGCTACAGGTTGAT. Internal right primer: GCCACGAAAGTTTCTGAGTG. Internal WT amplicon: 3258 bp. Deletion size: 1596 bp. Deletion left flank: TCTGAAAATGACAATTGGCAAAATATAAAA. Deletion right flank: AAATTATCATTTCGAACTTCTCCACTTTCC. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1875 C. elegans dnc-2(ok2249) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C28H8.12. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2249 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACCACTGACCCGATTTCTTG. External right primer: AACAATCGAACGTTTTTGCC. Internal left primer: AAATGTGATAGTCCACCGGC. Internal right primer: CCGGTAGAGCGCAGTAACTC. Internal WT amplicon: 1224 bp. Deletion size: 707 bp. Deletion left flank: TCAAGTTTGGTAAGCATCATATTCAAACGT. Deletion right flank: TTTTCAGGTTCACTTTTTTGAACTTGACTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1876 C. elegans C39D10.3(ok2179) X. Show Description
C39D10.3. External left primer: ACCCAAACATGTGGGACCTA. External right primer: TTGAACATTGCGATTTCGTC. Internal left primer: TTTGTCTCGAGAGCGCATTA. Internal right primer: AAATGACAACCTGGAGTCCG. Internal WT amplicon: 2866 bp. Deletion size: 1925 bp. Deletion left flank: TTAAAATTGAAAACTTTCAGCTTTGACTTT. Deletion right flank: AATACAATTAGAATTTCAGGTTGTTTATGT. Insertion Sequence: TGTACATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1877 C. elegans clc-4(ok2507) X. Show Description
T05A10.2. External left primer: GCTTGAGGAGAAGGTGTTGC. External right primer: ATTCCAATCACCCAATCCAA. Internal left primer: CGCTCTTTCTGGTCCATCAT. Internal right primer: TAAGCAAGAAACTGTCCGCC. Internal WT amplicon: 2157 bp. Deletion size: 1046 bp. Deletion left flank: AAAACTCCAATGGCAACAGTCAGAAAAATT. Deletion right flank: TTTAACAACACTTTTTTAAAGTTTAATTTT. Insertion Sequence: ACAACACTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1878 C. elegans lpd-3(ok2138) I. Show Description
Y47G6A.23. External left primer: AAGAAGCTGCTGGCCAATAA. External right primer: TGGAACTCTTCCAATTTCCG. Internal left primer: TGTTTCGGTCTAAACGAGGC. Internal right primer: TCAGTGAAGTGGCGATTGAG. Internal WT amplicon: 3251 bp. Deletion size: 1913 bp. Deletion left flank: GACTGTTGGGTTACTGTAGTGGTATTGTGG. Deletion right flank: AGTACCCTTTAAAGGTGCACGCCTTTTTTC. Insertion Sequence: GAGTAATTCTTTTTTTTTCGCGTAGCCAACAAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1880 C. elegans C06E2.1(ok2451) X. Show Description
C06E2.1. External left primer: ACATTTCCTAGCGCGTCATT. External right primer: GGTCAACTTTTCCGGTGAGA. Internal left primer: TTTAACAGCAGCAGCGGAC. Internal right primer: CTGTGACAAATGCTCACGCT. Internal WT amplicon: 3075 bp. Deletion size: 2173 bp. Deletion left flank: GCCAGTTTTCTTTCAAATGTGTATCTCTTC. Deletion right flank: CAAAAACCCTAAAACTCTAAAACGATTCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1884 C. elegans Y55F3BL.2(ok2160) IV. Show Description
Y55F3BL.2. External left primer: TTTCACCCAATTTTCAAGCC. External right primer: GCTCACGGAATCTGTGTTCA. Internal left primer: CGAAGTGAGACGTTTAGGGC. Internal right primer: ATTCAATCGAATTTCGTGCC. Internal WT amplicon: 2938 bp. Deletion size: 1401 bp. Deletion left flank: ACGGGTCATAAAGCGAAAACGCGGAGGGTT. Deletion right flank: GATACATATGATGCTTAGATGTTGAAATTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1885 C. elegans spe-11(ok2213) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F48C1.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2213 homozygotes (sterile, lays unfertilized oocytes). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTGGGTGCAAAACAGGTTC. External right primer: GGCTTACAGCTCTTGGTGGA. Internal left primer: GACCAAATTGAAGCGCATTT. Internal right primer: GAACATTTTTCCGTCAACCG. Internal WT amplicon: 2133 bp. Deletion size: 1051 bp. Deletion left flank: TGGGATGAATTTATGTGCAACATGCTCGTA. Deletion right flank: ACATTTTTATCATTATAACGAATATTCATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1886 C. elegans sbp-1(ok2363) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y47D3B.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2363 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATGCCACTTGTTCAGGGTT. External right primer: GCATGAGAGTTACACGCGAA. Internal left primer: TGGAGACATGTACCCGTTGA. Internal right primer: ATCACACGAGCCCTCAGAAC. Internal WT amplicon: 2759 bp. Deletion size: 1315 bp. Deletion left flank: TGCTTGATAAGACCCCCCTCTACTGCAACA. Deletion right flank: CAAAATCAGAACTCAAAAGCAAAGAAGGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1887 C. elegans dsh-2(ok2162)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C27A2.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2162 homozygotes (sterile, lays eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAACCAGACCCACTGCTGAG. External right primer: GAAGCTTTGCTCCGTACGAC. Internal left primer: TTCCGTGAGGAAATGGAGAC. Internal right primer: AATTGACCTGACCTTGGCTG. Internal WT amplicon: 2756 bp. Deletion size: 1104 bp. Deletion left flank: TTGTAAGCATGCGCCTTTTTAACATAAGTC. Deletion right flank: AGTCTTTCTCTGCGTCTCCTCTTCTTGTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1888 C. elegans mmaa-1(ok2514)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T02G5.13. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2514 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGATTGGTGCACTGGTCATT. External right primer: AATCACGATACCTTGGACGC. Internal left primer: TCGTTTCGAAATTCGTCCTC. Internal right primer: ATGCCTGGTGACGACTACCT. Internal WT amplicon: 2798 bp. Deletion size: 1179 bp. Deletion left flank: TTTAAGAACAAAAACGTACCAAATGTGCTA. Deletion right flank: ATAGAAATAAGAGATATCAAGTGTTGAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1889 C. elegans fars-3&F22B5.10(gk1029)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F22B5.10, F22B5.9. fars-3 is the new name for frs-2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk1029 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTGTTGTTCCACCCACAAGA. External right primer: TGCCGTTTTCTGCTCTTTTT. Internal left primer: CAGCCAGATGCACTTTCTCA. Internal right primer: CATTTGGGAGTTTGGTGGAG. Internal WT amplicon: 1427 bp. Deletion size: 823 bp. Deletion left flank: TGCAGTTCATATTGGAAATCCAAAAACTCT. Deletion right flank: TATCACATGGCTTCTTGTGTATAGATCCGA. Insertion Sequence: C. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1890 C. elegans tbx-7(gk1033) III. Show Description
ZK328.8. External left primer: GCTGCTCCACCTTTTGTTTC. External right primer: ATCACAGGGTGCATCTTTCC. Internal left primer: ACCCGAACTATCAGCTCGAA. Internal right primer: GCGTATGCACTCGAAGTGTG. Internal WT amplicon: 1994 bp. Deletion size: 488 bp. Deletion left flank: CTACTGATATCATTTCCATTATTATTGTGT. Deletion right flank: GCTCCATAAATTTCTATTTACCAGCTCAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1891 C. elegans F10A3.12(ok2192) V. Show Description
F10A3.12. External left primer: AAAAATGCTCCAAAGCATGG. External right primer: GATTTTTACGGAAAACGCCA. Internal left primer: CCCAAGCTTTTCAACTTTCG. Internal right primer: TGGGAACTTTTCCTGATTGC. Internal WT amplicon: 2833 bp. Deletion size: 1054 bp. Deletion left flank: GCATGTAAAAGCTATGGTTTGGTCCAACAG. Deletion right flank: GTTTTTCTGCTTCTACTACTTAAATGGACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1894 C. elegans +/szT1 [lon-2(e678)] I; peb-1(ok1941)/szT1 X. Show Description
T14F9.4. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1941 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GCGTGAGCAGTATGCCACTA. External right primer: GCCTGGGTTCAACATAGCAT. Internal left primer: AATTTAGGGCTTCCTTCCCA. Internal right primer: GCTGAATGGTGGCTCAACTT. Internal WT amplicon: 1610 bp. Deletion size: 779 bp. Deletion left flank: CTAGCTTTTGAGAGTGTCTAAGGGAATTGT. Deletion right flank: AAACGAATGATGAAGTTTGAAGTTGATGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1895 C. elegans +/mT1 II; cyk-1(ok2300)/mT1 [dpy-10(e128)] III. Show Description
F11H8.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2300 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCAGCATTTCCTGTAGCACG. External right primer: CAAGATAATCAGGCGAAGGG. Internal left primer: CGGCTTCCTTTCTTGTTGAG. Internal right primer: CGGAATGCAAGCAGGATATT. Internal WT amplicon: 3243 bp. Deletion size: 826 bp. Deletion left flank: TTCAAAAATGTTCGGAATCCTTCAGATGCT. Deletion right flank: GCGGGGGTCCTCCGGTGATTGGAGGAAGAC. Insertion Sequence: TCGGAATCCTTCAGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1896 C. elegans ckb-3(ok2310) III. Show Description
B0285.10. External left primer: ACTATTCGTTGGCAACTCGC. External right primer: TGAACCGAAGACGAGACTCC. Internal left primer: GGACTCCGTAGCTGTTCTACAAA. Internal right primer: GGCCCGGACTCAGTAAAGTC. Internal WT amplicon: 3214 bp. Deletion size: 2055 bp. Deletion left flank: ATTAACATTTTGAGCTATTGGCAAAATAAA. Deletion right flank: CTTCCAAACTAAATTTGTCGAAACAAAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1897 C. elegans C32F10.8(tm2997) I. Show Description
C32F10.8. External left primer: GCATTCCGCATTCTCCCATG. External right primer: GCATGCGAACCGTACAAGCA. Internal left primer: CCCATGTATCCTTTGGATAC. Internal right primer: TTCCGGACTCGTCACAAGTC. Internal WT amplicon: 1307 bp. Deletion size: 594 bp. Deletion left flank: TAACTGCTTAGGAAAAAAAGCTCACTTATT. Deletion right flank: CATGGAATTCCTCCATCACGTCTCTTAATA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1898 C. elegans Y66D12A.24&tin-10(ok2400) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y66D12A.22, Y66D12A.24. Homozygous lethal or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2400 homozygotes (late larval arrest or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGCTCACTTGACACTTTCG. External right primer: TGGGGAAAATCGAAAACTTG. Internal left primer: CTGTGCAATTTGTGATTGCC. Internal right primer: ATATGTACCGCCGAATGACC. Internal WT amplicon: 2686 bp. Deletion size: 1690 bp. Deletion left flank: TTCATTTTGGCTAATTTCTCAGTAAAAATT. Deletion right flank: TTCGATTTAAAAAAAATCGATTTTTTTCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1900 C. elegans T20H4.2(ok2547) III. Show Description
T20H4.2. External left primer: AGATGGGAGCCAAGACGTTA. External right primer: GACGTTGCCTTCGACATCTT. Internal left primer: TCATGCACATACAATGCCAA. Internal right primer: CTACCAAGTCACGCCCACTT. Internal WT amplicon: 2220 bp. Deletion size: 1394 bp. Deletion left flank: GGGGAATGATGGAAAGAACATTTACACTTT. Deletion right flank: ATGGGGTTAGTAATTCACCATTCGAATCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1902 C. elegans lgc-4(ok2567) X. Show Description
F18G5.4. External left primer: TATTCCATGATGGCGTCGTA. External right primer: CATGGTTGAGTGCAATGGTC. Internal left primer: TCAGGATCTGATGAATCCCC. Internal right primer: GCAGCGCTATCCGAGAATAC. Internal WT amplicon: 2935 bp. Deletion size: 2383 bp. Deletion left flank: ACTTGTAAAAATATGAAACGTATTTCAAAA. Deletion right flank: GCTATTTTTTAATCAGTCGCCTTCATTACA. Insertion Sequence: GGTGGTACTGACCAGAATTGCAGATCTACCAACGAGGCTATACGAATTGCAGGATTTGA TAACTTTGCTGATCAGCTCCAAGAATCCAATGGCGTTTTCGAAGCATGCCCAGAGGCCC ATTCAGAACAAGGAAATGAGAGTGAAGATTTTAAAGATTTGATCAATAGTGAAACTGAG TGCAACATTGAAGACGTTGTTCTCCCGACAGTACACGTTTCTACGGATTCTGAAGAAAT CATTTCGGGCGATGTGATTATGAATGGTTAGTAGATTGTTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1904 C. elegans hlh-34(gk1031) V. Show Description
T01D3.2. External left primer: GTGAAGCCGAAGGATCATGT. External right primer: CGTCTTTGCTTTCTTTTCCG. Internal left primer: GAAGAACTTTGCATCGAGGG. Internal right primer: TGTCCAACAATTTCCAACGA. Internal WT amplicon: 1737 bp. Deletion size: 163 bp. Deletion left flank: TAAAAAACAGAAAAAAAATTAAAAATATAT. Deletion right flank: TTAAATCAAAAACTTAAAAGTTACCGAGTT. Insertion Sequence: TATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1905 C. elegans F21G4.5(gk1035) X. Show Description
F21G4.5. External left primer: TTGATGGAACTTTCATGGCA. External right primer: ATGATCTGAGATGAACGGGG. Internal left primer: CCTCTAAATGCCGACGTTGT. Internal right primer: TCCTGATCAATTGCAGCATC. Internal WT amplicon: 1653 bp. Deletion size: 444 bp. Deletion left flank: TTGCAGGTACATTTTCCTTGGTGAACATAA. Deletion right flank: ACTTTTTTCCATGTCTCCCACAACGTAAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1906 C. elegans ceh-45(gk1015) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZK993.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1015 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAATGGAGAGACGGGTGTGT. External right primer: TTGAAAATTGTGAAGCTGCG. Internal left primer: GGCGCCAGAGTTTGATCTAC. Internal right primer: AGGTTGATGTGGACGGAGAG. Internal WT amplicon: 1907 bp. Deletion size: 1113 bp. Deletion left flank: CAAAATCTTGGTAGTCTAGAAAACCCCAAT. Deletion right flank: CATGGTGTCCTAGGAATATTTTTAAAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1907 C. elegans Y97E10AR.7&rpb-9(gk1044) V/nT1 [qIs51] (IV;V). Show Description
Y97E10AR.5, Y97E10AR.7. Homozygous semi-sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk1044 homozygotes (often sterile or nearly sterile, can be maintained). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTATGAAGCTTAGCGCGGAC. External right primer: GACCATTGACACCTCGACCT. Internal left primer: TGCCAGAAGCATTGTACGAG. Internal right primer: GGATGGGTTAACTGGGATGA. Internal WT amplicon: 1933 bp. Deletion size: 931 bp. Deletion left flank: TAGACTGATTATGAGCATGTTTTAAAAAAT. Deletion right flank: TTTTGTTCCAACATTTTTAGTTTAAAATTA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1908 C. elegans mbk-2(ok2235) IV/nT1 [qIs51] (IV;V). Show Description
F49E11.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2235 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGAGCCGCTCAACACAGTT. External right primer: CGTCGGGCAATAGTAGAGGA. Internal left primer: CGTACAAACATATTGCCCCC. Internal right primer: ACTCACACAAACTGGGGAGG. Internal WT amplicon: 3315 bp. Deletion size: 2275 bp. Deletion left flank: TAGTAATTTTTTTAAGCCAAAAGCTCCTTC. Deletion right flank: TCAAGACCGGATACAGTAATTTTGACGCAA. Insertion Sequence: AGCTCCTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1909 C. elegans flp-1(ok2505) IV/nT1 [qIs51] (IV;V). Show Description
F23B2.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2505 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGTGTCCCGTTTTGGATGT. External right primer: AGCGTCCGAATCTGAAGAAA. Internal left primer: CGGTACTTGCAAAGAAGGCT. Internal right primer: CTGCAGATCGTTTTCCGAAT. Internal WT amplicon: 1194 bp. Deletion size: 475 bp. Deletion left flank: GTATACTATTCATTTAAAAAATATTGCCTA. Deletion right flank: TTTCTGATAAAAAAGAGCACAACTTGGTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1910 C. elegans ncl-1(ok2555) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZK112.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2555 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGCCAATATGGGACTCTC. External right primer: GGATGATACGGCTTTGTGCT. Internal left primer: AGCCATTCCTGTTCCAAATG. Internal right primer: GATTGGACTTCCTCCGTGAA. Internal WT amplicon: 3295 bp. Deletion size: 1644 bp. Deletion left flank: AACAAATGCTCAAAATGGAGCAATTGATTG. Deletion right flank: TTCTCTCGTAGATTGATGTCCTTCGCGTCG. Insertion Sequence: AATTCTCAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1911 C. elegans C01B12.2(gk1032) II. Show Description
C01B12.2. External left primer: AGACGCCATGATTTTCAACC. External right primer: AACCGTAATGGGACAGCTTG. Internal left primer: GAACCTGCGGTTCAAACAAT. Internal right primer: AGGGAGTGAGCGAGAAACAA. Internal WT amplicon: 2259 bp. Deletion size: 561 bp. Deletion left flank: AAACGTGGTTTTGCCCGAGTTCTCTGAAAC. Deletion right flank: AAGCAATTTACTCAAATTATTTCAGTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1914 C. elegans C47G2.3(ok2557)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C47G2.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2557 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAATCCGTCTGACTCCTCGT. External right primer: GCTGAAAATGAGGTTTGGGA. Internal left primer: GTTGCAAACCTGGGTGGTAG. Internal right primer: GTACTCCTCCCGGACAATGA. Internal WT amplicon: 2124 bp. Deletion size: 1307 bp. Deletion left flank: TTAGGGTTAGCTGGAAAATTTTTTGATTAA. Deletion right flank: CCGTTTTTGGGATCAATTGGTCTGCTATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1915 C. elegans klp-18(ok2519) IV/nT1 [qIs51] (IV;V). Show Description
C06G3.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2519 homozygotes (sterile, lays eggs that don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTAAACTAGCGATGCCCG. External right primer: GAATTCCGTCCGAACCTTTT. Internal left primer: TCTTCAATCATTCACCGCTTT. Internal right primer: CGTCAACCTCTTGGCGTAGT. Internal WT amplicon: 1183 bp. Deletion size: 556 bp. Deletion left flank: TATGAGCTCCATCATATCTTTGATAGCTCT. Deletion right flank: GTCAAGGAAAGGTCATCTATCCTGAACCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1925 C. elegans fkh-9(ok1709) X. Show Description
K03C7.2. External left primer: CGAGCTGGGCTAGTGGATAG. External right primer: GCGTTTAACTTTGAGGCAGG. Internal left primer: GCATGTGCAAACTAGGAGCA. Internal right primer: ACGGGGTTTGAGTTGAGTTG. Internal WT amplicon: 3077 bp. Deletion size: 1054 bp. Deletion left flank: AGTTCATTTTGCTGGTTGTTTGTTGCATTG. Deletion right flank: TCATACTGTAGTTGGCAAATATTGAAAGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1927 C. elegans fib-1(ok2527) V/nT1 [qIs51] (IV;V). Show Description
T01C3.7. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2527 homozygotes (early- to mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTTCCGACGAGGAGAAGTG. External right primer: GCTTCCTCGTTATTTGCAGC. Internal left primer: AAGGTCTGAACCGATTGCAC. Internal right primer: TGCTACATATGCCGATTCCA. Internal WT amplicon: 2241 bp. Deletion size: 1271 bp. Deletion left flank: GGCAAGGTTGAGAACCAAGTAAAGATAAAA. Deletion right flank: AAAAATCCTGAAATTCAGTTTACCTCCGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1928 C. elegans Y62E10A.17(gk902) IV/nT1 [qIs51] (IV;V). Show Description
Y62E10A.17. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk902 homozygotes (mostly sterile; eggs sometimes hatch but larvae are abnormal and arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGATTCAGTTGGCGTCTCTG. External right primer: TCTCGTCGTCTCATCCCTCT. Internal left primer: AACCCGTTGAGACACGATTC. Internal right primer: CCATTCCATTACTTGGCACA. Internal WT amplicon: 2267 bp. Deletion size: 1096 bp. Deletion left flank: TGCTGACATACATTCTCTGAAATATTTGGA. Deletion right flank: TTTTTCTGTGCCGCACTTTGGTTTTTTTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807