More Fields
Strain Species Genotype
VC1508 C. elegans +/szT1 [lon-2(e678)] I; sulp-3(ok1953)/szT1 X. Show Description
F41D9.5. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1953 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTCGTAAGGGTAATTGGCA. External right primer: TCCAAGAAGGAGTGGTCCAG. Internal left primer: TTCATCAACAGCAGTTTGGC. Internal right primer: CAACGTGCATATCCCAACAG. Internal WT amplicon: 3086 bp. Deletion size: 2464 bp. Deletion left flank: GTTTCTGACATGACCTCTTCAGAATTTTCA. Deletion right flank: GAGGAAATCTGTTGATTAAATAATGAGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1509 C. elegans nhr-220(gk690) V. Show Description
T19H12.8. External left primer: CCTGGATTCGATTTTCGGTA. External right primer: GGCATCAGAAATGCTCCAAT. Internal left primer: AATAATGGCATCGGTTCTGG. Internal right primer: TCCAACCAAATGAGAGTCCC. Internal WT amplicon: 2272 bp. Deletion size: 672 bp. Deletion left flank: CCATTGGGGAAATTGCTTCAAACCCCGCAT. Deletion right flank: TTGTATTTTTTTCTCAAAGGTCTATAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1511 C. elegans F32H5.1(ok2017) V/nT1 [qIs51] (IV;V). Show Description
F32H5.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2017 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTTGACAGAGACTTCGG. External right primer: GAGTTCGCGGAAATTTATGG. Internal left primer: CTAGACGGCGATACCTGGAA. Internal right primer: TTTCCAACATCCCTGGAGAG. Internal WT amplicon: 2266 bp. Deletion size: 1489 bp. Deletion left flank: ATCGTAAGAAATCATACCATTCTCTCCAAA. Deletion right flank: GTTTCCGCTTTCCATAGTTTCTGTTTTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1512 C. elegans H01G02.2(gk687) IV/nT1 [qIs51] (IV;V). Show Description
H01G02.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk687 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTGCATGGAAAGGCAAAAAT. External right primer: TCGCTACAGGGGAGAAAAGA. Internal left primer: GTTCGGTCTTTGGTCGTGTT. Internal right primer: CGGAAACCATTTGAGGCTAC. Internal WT amplicon: 1834 bp. Deletion size: 449 bp. Deletion left flank: TGAAGCTATTCAGAACAATTCAATTTTTAT. Deletion right flank: GAAGAAGATTAAAGTGTGAATGTGTACATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1513 C. elegans +/szT1 [lon-2(e678)] I; adt-1(ok1965)/szT1 X. Show Description
C02B4.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1965 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATACGACGACCTCAGTTGCC. External right primer: GCACAACTTTTGTCGGGTTT. Internal left primer: GTGTGACCCGTTATTCGCTT. Internal right primer: GCTCAGGACAACTTGCTTCC. Internal WT amplicon: 3370 bp. Deletion size: 1659 bp. Deletion left flank: TGATGCTTCCCCAGGCCTTATATCTACAAA. Deletion right flank: ATGGGGCGATTGGCTGCCGTGCTCTGTATC. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1514 C. elegans T23G5.3(ok2019) III. Show Description
T23G5.3. Superficially wild type. External left primer: TCTTGTGCAAGTTCGAAACG. External right primer: AATTGAAAAGGGTGTGCGTC. Internal left primer: GTACATCTTCCTTTCGCCCA. Internal right primer: TAACCTTCCCCAAGATTCCC. Internal WT amplicon: 2170 bp. Deletion size: 683 bp. Deletion left flank: TTAATTTTATAATTCTATAGATATTCTACT. Deletion right flank: TCAAATTTTCCCAATCTACCGTAACCCCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1516 C. elegans Y58G8A(gk1021) V. Show Description
Y58G8A. External left primer: GGGCCAGTTGGTCAGAGATA. External right primer: GGGAAGTGATTCGTTCTCCA. Internal left primer: TGCACTCAAGATCAAACGGA. Internal right primer: CTAGACTGGGCGGCATTTAG. Internal WT amplicon: 2306 bp. Deletion size: 125 bp. Deletion left flank: ATTCAACAAGGGAAATGGGGGCTGGGTAAA. Deletion right flank: CTTTGAAGAGACACAGGTGTGAGTTTGCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1517 C. elegans nhr-215(gk711) X. Show Description
T07C5.4. External left primer: TTGCTCAAAAGAAGCGGAAT. External right primer: TGGTTATGCGTCCAGTGAGA. Internal left primer: ACAAGCCTAATCTGCATGGG. Internal right primer: TGTGACGTCTGCAACAATCC. Internal WT amplicon: 2331 bp. Deletion size: 1279 bp. Deletion left flank: GATAAAATCATACTAAGCTGTCTGAAGACA. Deletion right flank: AAACAATCAACGAAAAATTAGAGTTCGATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1518 C. elegans atf-7(gk715) III. Show Description
C07G2.2. External left primer: CAAGAAGGGACGGAAATTCA. External right primer: AATATTTGCAGGTGGTTCGC. Internal left primer: GCTGTGGAGCTCGAAGAGTT. Internal right primer: CCACTGTTTCTCCACCCATT. Internal WT amplicon: 1805 bp. Deletion size: 1197 bp. Deletion left flank: ATTCCTCTAGTATTCCATAAATCTTGACAT. Deletion right flank: AGAAAAACAAACAAAAAGCTTACCTCTGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1519 C. elegans gei-8(gk693) III. Show Description
C14B9.6. External left primer: CCCTCTCATTGTTCGTTCGT. External right primer: TTTTCGGGCAACAACTTTTC. Internal left primer: ATTTCATTGCGTGCATGTGT. Internal right primer: TAACTGTCAGCGTCTCGTCG. Internal WT amplicon: 1595 bp. Deletion size: 1018 bp. Deletion left flank: CGCCAATGACAACGAAGAAAATAAACTGAA. Deletion right flank: ATGAAAATCAAGGAGACGTCAGAGCAGACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1520 C. elegans nhr-130(gk710) V. Show Description
T01G6.8. External left primer: TTCGGATACTTTTCGGTTGC. External right primer: TTCCATTTTTACGGTCCTCG. Internal left primer: GATATGAGGTCCCGATCGAA. Internal right primer: TGAGGCAGATTGGTGTTCTG. Internal WT amplicon: 2444 bp. Deletion size: 1218 bp. Deletion left flank: TTTGAAGCTTCCGCAAAAATTTACATTCCC. Deletion right flank: AAAAAAAATACCGGAAAATAGGCTCCGCCC. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1521 C. elegans dyf-2(gk678) III. Show Description
ZK520.3. External left primer: GAGGTCGCTCCACTCTCAAC. External right primer: CAGCAGACGCACTCACATTT. Internal left primer: CGGCAATCGCTAGTACATCA. Internal right primer: TCGATGTCGGCTGTGTATTC. Internal WT amplicon: 1671 bp. Deletion size: 202 bp. Deletion left flank: TGCCCATTTGGTCTCCATCGATGAATAATC. Deletion right flank: AAAAAATGAAGTACAAATCATTGAGCTACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1523 C. elegans dpl-1(gk685)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T23G7.1. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk685 homozygotes (sterile, with few eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGATTTCCATCAGCAGTGAA. External right primer: ATACCGGCAGCAGCTAGAAA. Internal left primer: TTTGACAACAATCCAATCGC. Internal right primer: AGCTTGTCGGCTCAACGTAT. Internal WT amplicon: 2352 bp. Deletion size: 871 bp. Deletion left flank: ACAAACCAACCGGACTCAGACATTTTTCCA. Deletion right flank: TGGAAACCACAATTTTCAGACCGTAAAAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1524 C. elegans nhr-117(gk691) V. Show Description
F16B4.12. Superficially wild type. External left primer: CATACGGCAAGTTCAGCAAA. External right primer: CTACCAACCTGGTCATGGCT. Internal left primer: TCGGGATTTGACAAGTTCGT. Internal right primer: GCCGACTGTTGTCAGGATCT. Internal WT amplicon: 1781 bp. Deletion size: 1010 bp. Deletion left flank: TCACAAATCACCTCATCGTAAAACATTTCA. Deletion right flank: CGAGTGCTAAAAGCGGGCTCCGCGCAGACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1525 C. elegans C34B4(gk702) V. Show Description
C34B4.2. External left primer: TAGGGCGACAGGTTCAAAAC. External right primer: AACTGATGGACCAGGCAGAC. Internal left primer: TGTGAAGTGATGCGGTGTTT. Internal right primer: GTATGGAACGGCATGGAACT. Internal WT amplicon: 2195 bp. Deletion size: 1165 bp. Deletion left flank: TCAACTGATAAGGACACTGTCCTCCGTATT. Deletion right flank: TGATCTTTTCACTCTTTCCCTCTCCACCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1527 C. elegans nhr-68(gk708) V. Show Description
H12C20.3. External left primer: CGGTTCTAATCCTCCGTCAA. External right primer: AGCGCACCTGTAAATTGCTT. Internal left primer: TGCCTTGTTTGCCAAGATTT. Internal right primer: CTCCAACCCGTCCTTCTGTA. Internal WT amplicon: 1761 bp. Deletion size: 1301 bp. Deletion left flank: TTATATCATGTTTAGCCCACAAATATTCTA. Deletion right flank: TTTCCGGATGGAACATATTATGATAGAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1528 C. elegans unc-4(gk705) II. Show Description
F26C11.2. Unc. External left primer: TTCATGGTGAGAACGAGCAG. External right primer: GGCATATGTACGAGGCAGGT. Internal left primer: CGCAAGGTGAAATGAGTGAA. Internal right primer: GCCGACACGCCTACTTTCTA. Internal WT amplicon: 2274 bp. Deletion size: 307 bp. Deletion left flank: TGCAAAGTATTTCACTACAGTTTTACTGTA. Deletion right flank: GCTTAATCCTGCTAGACTTCTACCACAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1530 C. elegans mei-1(ok2000) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T01G9.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2000 homozygotes (sterile, lays eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAATTGTTTGTCGCGGATGA. External right primer: GATGAAGGTGGCCTTGAAAA. Internal left primer: TGTTTCCAACAAGTGAGCCA. Internal right primer: CAAAAACCAAAGCTAGGCCA. Internal WT amplicon: 2180 bp. Deletion size: 1378 bp. Deletion left flank: ACAAAGAAAGGAGTTGGAGCAGCAGGTCCA. Deletion right flank: CAAAGAATGGTGTGACTCTTTTGGTGCCAT. Insertion Sequence: TGTAAATCAACTATTTATTGTGATCTCCTTTTAGTTTAAAATATTGTGGCCTAGCTTTG GGTTTTTGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1531 C. elegans Y37D8A.2(gk704) III. Show Description
Y37D8A.2. External left primer: TATTGGCCTTGAGAACACCC. External right primer: CTCTTCGTCAGTTTTTCGGC. Internal left primer: TTGAAAGCGCGAAACAATTT. Internal right primer: CTTCAGGCTTCTGGCAAACT. Internal WT amplicon: 1789 bp. Deletion size: 306 bp. Deletion left flank: ATGATTTTTTGAAAATTAAAAAAAAACCAG. Deletion right flank: TTTTGCCTTTTTCTTCAAAATCCAAGCAAA. Insertion Sequence: CC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1532 C. elegans Y58G8A(gk1022) V. Show Description
Y58G8A. External left primer: GGGCCAGTTGGTCAGAGATA. External right primer: GGGAAGTGATTCGTTCTCCA. Internal left primer: TGCACTCAAGATCAAACGGA. Internal right primer: CTAGACTGGGCGGCATTTAG. Internal WT amplicon: 2306 bp. Deletion size: 210 bp. Deletion left flank: TACATTCAACAAGGGAAATGGGGGCTGGGT. Deletion right flank: TGGGCGACAAACTATTTTTTTCCGGCAACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1533 C. elegans T23D8.3(ok2016) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T23D8.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2016 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGAAGAGCAAGAAGGCGA. External right primer: GGCGCCAATACTTGTTGAAT. Internal left primer: ACACAATTGAGTCGAAGGGG. Internal right primer: CCGGTTCTGTCCAATCAGTT. Internal WT amplicon: 3212 bp. Deletion size: 1434 bp. Deletion left flank: AGGGAATATAAGGAATATTTTGAGACGGGT. Deletion right flank: ATAATTTTCTTGAAGTTTATTTTTCATAAA. Insertion Sequence: ATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1534 C. elegans elt-6(gk723) IV. Show Description
F52C12.5. External left primer: ACCTCCTCCTCCGACAACTT. External right primer: GGTTCCTGCTGCTTTGACTC. Internal left primer: CCTCCCACCACTTTGTCATT. Internal right primer: GTAGGCATGGCAGCTCTTTC. Internal WT amplicon: 1787 bp. Deletion size: 457 bp. Deletion left flank: ACTTCTACCCAAGTATAACTAAAAAAAAGA. Deletion right flank: TTTCGCAGCATTTTCCCGCCGCCTGACAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1535 C. elegans vha-7(ok2015) IV/nT1 [qIs51] (IV;V). Show Description
C26H9A.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2015 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAACGCCTACAGTGCTCAAA. External right primer: TGAGCAGCATCACCAAACAT. Internal left primer: TGACGACGGTTTCCACAATA. Internal right primer: TCTCCAAAATGCCTACCTGG. Internal WT amplicon: 2817 bp. Deletion size: 1865 bp. Deletion left flank: AATTTCTCGATTTGAACAACAATGATTATG. Deletion right flank: AAGTTCGAATTTTTAGTCAGAATTTGGCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1536 C. elegans spp-10&hlh-12(ok1923) IV/nT1 [qIs51] (IV;V). Show Description
C28C12.7, C28C12.8. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1923 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCCTTCCATAAATCGCTTG. External right primer: CGGTGTCGAATGAAGGTTTT. Internal left primer: GAGCCGCAATGAAAAACAAC. Internal right primer: GACTGCGGTCAAACTGACAA. Internal WT amplicon: 2109 bp. Deletion size: 939 bp. Deletion left flank: ACTAAAAAAATTCAAGAAAATGTTAATTTT. Deletion right flank: AGTGCCATGGAGAAATTCTTCGAAAACTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1537 C. elegans isw-1(ok1951) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F37A4.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1951 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTGCTCGATCACGTCAAAC. External right primer: AGAAATCCGGCAAGCATCTA. Internal left primer: TACAGCTTGCCGGAAAAATC. Internal right primer: TAAACGCCCGAGGTAATTTG. Internal WT amplicon: 2817 bp. Deletion size: 1866 bp. Deletion left flank: TTTCTGGGCTTCCGACATACGACCTTGTTG. Deletion right flank: GCGGCGTCGGACGATTCCGGTTCATCGTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1538 C. elegans vha-7(ok1952) IV. Show Description
C26H9A.1. Viable, fertile, slow-growing, sometimes sterile. External left primer: CAACGCCTACAGTGCTCAAA. External right primer: TGAGCAGCATCACCAAACAT. Internal left primer: TGACGACGGTTTCCACAATA. Internal right primer: TCTCCAAAATGCCTACCTGG. Internal WT amplicon: 2817 bp. Deletion size: 1749 bp. Deletion left flank: ATTTGAAAACTTTTCTGAAAGTCTCACAAT. Deletion right flank: GTATTTCAAAGTATTGTTGATTCATATGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1539 C. elegans hpd-1(ok1955) III. Show Description
T21C12.2. Superficially wild type. External left primer: TTGTGGCTGTGCACATTTTT. External right primer: AACATCCCCGTAGCCATTCT. Internal left primer: CGGCAATTTGTCAAAAATCA. Internal right primer: AAAACAGGAAACCGTTGTGG. Internal WT amplicon: 2256 bp. Deletion size: 1363 bp. Deletion left flank: TAATTCAGAACTCGGAAATCACCTTGTTCA. Deletion right flank: GCCCGTGGCTGTGAATTCCTTTCCATTCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1542 C. elegans F58B3.7(ok2027) IV. Show Description
F58B3.7. Superficially wild type. External left primer: TCACTTTCGCTAGCATCCCT. External right primer: GGATCATCATTCGGACAAGG. Internal left primer: TCAATTCACTGTCCGCATGT. Internal right primer: GGAGGACGTTCTGACTTTGG. Internal WT amplicon: 2208 bp. Deletion size: 1136 bp. Deletion left flank: CCGTATTTTTGGGTCTGGGTAACAAAGTCT. Deletion right flank: TTAATTATCAACTTTGTTTAACAGTTTATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1543 C. elegans sea-1(gk1023) II. Show Description
F19B10.9. External left primer: ACCGTCACGAATGAGGTTTC. External right primer: CTCTTGCCGACTTCGTTTTC. Internal left primer: TGCCTGAGCAATTTCCTTCT. Internal right primer: TTATATTTGCGGTGCTGTGC. Internal WT amplicon: 2319 bp. Deletion size: 2143 bp. Deletion left flank: GGAATGTTGCCTGAGCAATTTCCTTCTTTT. Deletion right flank: GCTAGAATTGTAGGCAATTGTCGATTTCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1544 C. elegans C12D12.5(gk700) X. Show Description
C12D12.5. External left primer: GCACTGTTGCTGTCCACACT. External right primer: CAGGATTGCAAGTTACGGGT. Internal left primer: AACTTTCTCGTGCTCCTCCA. Internal right primer: AAATGCGCTTTACCACCAAC. Internal WT amplicon: 2128 bp. Deletion size: 1031 bp. Deletion left flank: ATCTGAATCGTTGACTTGCTCAAACGATTT. Deletion right flank: GAATAAAGGTATAATGTGTAAATGAAGCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1545 C. elegans nhr-142(gk826) V. Show Description
F44E7.8. External left primer: CAACGTCAGTTGCATCGTCT. External right primer: CACCTCTTGTCGTTTCCCAT. Internal left primer: TCGTGAATTCAGGGAGAACA. Internal right primer: TCACTCCAACTCGCACAGAC. Internal WT amplicon: 2183 bp. Deletion size: 1107 bp. Deletion left flank: GAAACATAGTTTTTGTGACTCATAAGACGC. Deletion right flank: AGATTGTGTCTGTGCGAGTTGGAGTGAGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1546 C. elegans nhr-134(gk722) V. Show Description
F44C8.2. External left primer: AAATGCCGAATTACTCGTCG. External right primer: TCAAAAACGCAGCAGACATC. Internal left primer: GCAGATTTGAGATTGCGGAT. Internal right primer: CAGAAGCGATTCTTCTTGCC. Internal WT amplicon: 1783 bp. Deletion size: 915 bp. Deletion left flank: CCAAAAAACTTCGGGACGCCATTTTGGAGT. Deletion right flank: AAAAGAGTTAGTCAAATTTCTTGAAGCTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1547 C. elegans nhr-285(gk698) V. Show Description
T26E4.16. External left primer: AGAAGCCGACCACAAAACAG. External right primer: ATTTACGCGCATATTTTGGC. Internal left primer: ATATATGACGGCAGCCCAAA. Internal right primer: AGGAGCTCCAACGTGCTCTA. Internal WT amplicon: 2370 bp. Deletion size: 886 bp. Deletion left flank: AAACATGAGCTTTCAAATGAAACATGTTTC. Deletion right flank: TTCTGGATTGCCACCATCATCTATTTTGAT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1548 C. elegans fbxb-1(ok2052) V. Show Description
T26H2.1. Superficially wild type. External left primer: AACCGGAAGGTTCTCCAAGT. External right primer: TGTACAAGAAGACGACCCCC. Internal left primer: TCTTCCCGATTGATGACTCC. Internal right primer: AAACTTCCGGCAAATTGATG. Internal WT amplicon: 2121 bp. Deletion size: 1037 bp. Deletion left flank: TTTAAACGTTTTTTTTTAACTTCTCTCTTT. Deletion right flank: GGAATGAGGTGGATTTTGAGAACAATCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1549 C. elegans pfd-5(gk706) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R151.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk706 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGGAACTGGTGCTTTTTCG. External right primer: ACATTGCAGGGAAACAAAGG. Internal left primer: ATAGCAGCGAGACAAGCACA. Internal right primer: TTGAATTACCGCCAACAGTG. Internal WT amplicon: 1648 bp. Deletion size: 587 bp. Deletion left flank: TCGCAGTTTGTCACCGGTTGAACTCTCATT. Deletion right flank: CCTGCAGTTGCAATTTTCACATCGTCCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1550 C. elegans nhr-166(gk688) II. Show Description
C49D10.2. External left primer: CACCATACCGATTTTCGCTT. External right primer: GTGATTATCGCTTTTCCCGA. Internal left primer: TGAAACCAATTGTACCAGCG. Internal right primer: CAGATCACAATGATGCCCAG. Internal WT amplicon: 2288 bp. Deletion size: 762 bp. Deletion left flank: GCAGGTAGATAGGTAGGCAAGTAGGTAGAA. Deletion right flank: CAACTAATCACTCAAGACCATCGAAATGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1551 C. elegans nhr-117(gk729) V. Show Description
F16B4.12. External left primer: CATACGGCAAGTTCAGCAAA. External right primer: CTACCAACCTGGTCATGGCT. Internal left primer: TCGGGATTTGACAAGTTCGT. Internal right primer: GCCGACTGTTGTCAGGATCT. Internal WT amplicon: 1781 bp. Deletion size: 1203 bp. Deletion left flank: AAATATTCCTGCAATCTTATATTTTTCACA. Deletion right flank: GCGTTTTGAATAGACGTTAGACAGCGTGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1552 C. elegans nhr-283(gk724) V. Show Description
F57A10.6. External left primer: TGCACTAAAAGGCTGCAATG. External right primer: TTCGATTTTTATTTTGCGCC. Internal left primer: GTCGTGGCTCAATGAGGTTT. Internal right primer: CTCAAGTTAATCCCAGGCCA. Internal WT amplicon: 2348 bp. Deletion size: 1027 bp. Deletion left flank: GCCTACCTGCCTACGATGCTCCCACCTACT. Deletion right flank: CATTCAAGAAAAATTTAGGTGCTTAAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1553 C. elegans dnj-19(gk650) V. Show Description
T05C3.5. External left primer: TTTGGCATTCCTTTTCCAAG. External right primer: CGGCCAAACATTTTTGAAGT. Internal left primer: TCCTCTGATGACTCCTGGCT. Internal right primer: CTTGACACACGAATTCTCGG. Internal WT amplicon: 2058 bp. Deletion size: 336 bp. Deletion left flank: TGATGTTTTTCCGACGTAAAGCTCTTCGAG. Deletion right flank: AGCAAGTTTGAAGTAAGATTTCTTAATGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1554 C. elegans nhr-155(ok2026) V. Show Description
C14C6.4. Superficially wild type. External left primer: GGTTCGGTGCAAGGAAATTA. External right primer: TGCGAATTTTGGTGTTTTGA. Internal left primer: AGTACAACGGAGGTGAACGG. Internal right primer: TTTCGAGCACGATTTCACAA. Internal WT amplicon: 2276 bp. Deletion size: 1738 bp. Deletion left flank: AGAAATTAGTCTTGTTTGAATTTTCATATT. Deletion right flank: AATCAGCTCCGCGCTCAGAAAATATTACAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1555 C. elegans F13C5.2(gk716) X. Show Description
F13C5.2. External left primer: GCAAAATCTTTGTTGGGGAA. External right primer: TCGCCGATCAACTTCTTTCT. Internal left primer: CATTCTGCCATTTCCTTCGT. Internal right primer: CGTCAACTGGCTTACGGAAT. Internal WT amplicon: 1651 bp. Deletion size: 385 bp. Deletion left flank: CTCTGTTCTCTCAGCGGTGGCCAGTGTGTA. Deletion right flank: ATTACTCAGAACTATAAAAACAACATTACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1557 C. elegans nhr-86(gk717) V. Show Description
Y40B10A.8. External left primer: AACCCAAAAGTTGCATGAGG. External right primer: AAAATTGGCCAGAAATGACG. Internal left primer: TCTGGCTTGATTTCTCGCTT. Internal right primer: CGCATGAGAACTGCAAGAAG. Internal WT amplicon: 1750 bp. Deletion size: 445 bp. Deletion left flank: AAAATTCAAAAAATTTTCTAAGTTTTATAT. Deletion right flank: AATAATTATTTTAACTCACTCGCAGTAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1558 C. elegans cyp-13B2(gk726) X. Show Description
K06G5.2. External left primer: TCACCCACGGACATGTAAGA. External right primer: TTTGGGCAGGTACAAACACA. Internal left primer: CTGATTGCGAGGAACAACAA. Internal right primer: GTGAACAGCGGTCTCACAAA. Internal WT amplicon: 1832 bp. Deletion size: 1291 bp. Deletion left flank: TTTGATGCCCTTTCAATGAGAAAACACCTT. Deletion right flank: AGTACAAGTAATTTCAGGTACTATCAGGAA. Insertion Sequence: AGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1560 C. elegans cnd-1(gk718) III. Show Description
C34E10.7. Unc, sometimes with rounded nose. External left primer: GTTGCGGACAACACACATTC. External right primer: CATGTTAATCGGTGACACGC. Internal left primer: ACGTACTCGATATCTCGCCG. Internal right primer: GTGGAACACCATTCCACACA. Internal WT amplicon: 2138 bp. Deletion size: 1438 bp. Deletion left flank: TACTCGATATCTCGCCGCGATCGTACCGTA. Deletion right flank: TACTCTCTGAGCATATCCAATGCATTATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1561 C. elegans nhr-175(gk720) V. Show Description
F09F3.10. External left primer: CCCGACTCACGGTAGAACAT. External right primer: AACGACCAAAAATGCGAAAC. Internal left primer: ATATTTGTCGCAGCGCTCTT. Internal right primer: AATTGGAATGGGCTGAACTG. Internal WT amplicon: 2080 bp. Deletion size: 778 bp. Deletion left flank: ATGGAGATTGTTTGATCAATTACGGTAAGT. Deletion right flank: ATCTGATGTGAACAAAGTGTTAAAATGGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1562 C. elegans nhr-109(gk712) II. Show Description
T12C9.5. External left primer: TCGAGGCACAATGTCAAAAG. External right primer: AACTGATGGCTCTGCGACTT. Internal left primer: AGAGACATTCTGGAGTGGCG. Internal right primer: ACAAGGCCAGTATCCCAGTG. Internal WT amplicon: 2434 bp. Deletion size: 1587 bp. Deletion left flank: CTGTTTTGGTTTTTAAAATTTTTTTAAATT. Deletion right flank: GGTGTCCTCTTGTTTTGATGAGTTTCGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1563 C. elegans nhr-229(gk713) IV. Show Description
Y116A8C.18. External left primer: CAAAAATGTTTTGTGCGTGG. External right primer: TCAAATCTGCGTGCTCATTC. Internal left primer: AATTACCCGCATGTTTGAGC. Internal right primer: CCGCTCAGAAATCATTCGTT. Internal WT amplicon: 1761 bp. Deletion size: 593 bp. Deletion left flank: GGCCACTTCCGATTTTAACAATCTTTCTGA. Deletion right flank: GAAACAGTTTTTTAACCAACCTTGTCTTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1564 C. elegans cyl-1(ok1943) V. Show Description
C52E4.6. Superficially wild type. External left primer: GAAGAGGATGGGGAGAGGTC. External right primer: GCAATTTTCGCCTGTCAAAT. Internal left primer: CCCCAAAATGACACAAATCC. Internal right primer: GAAGCGCCTCTTCTGAATTG. Internal WT amplicon: 3228 bp. Deletion size: 1511 bp. Deletion left flank: TTCTTCTTTCGGAGTTGATCATCTGAAAAT. Deletion right flank: ATTTTGTTCTTTTGGCTAAAAATACATAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1565 C. elegans nhr-116(gk728) V. Show Description
F09C6.9. External left primer: ATTCCTCCTACTCCCTCCGA. External right primer: TAGGGCATTCTTTCATTGGC. Internal left primer: ATCTGTGTCTCTTCGCCCAT. Internal right primer: TCGATCAGCAAACCCTATCC. Internal WT amplicon: 2056 bp. Deletion size: 923 bp. Deletion left flank: TCAGATTTGTTCAATTGTTCTTCTCTCTTA. Deletion right flank: ACGGGTGCAAAACATTTTTCCGGAGGATGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1566 C. elegans F31B9.2(ok2066) X. Show Description
F31B9.2. Superficially wild type. External left primer: CGACAACTCAACCATCGAAC. External right primer: CGAACGGAGCTAGGAACAAG. Internal left primer: CTGCTGATCCAGTCCAACAA. Internal right primer: AACCGATGGGAAATTCACTG. Internal WT amplicon: 2279 bp. Deletion size: 850 bp. Deletion left flank: CAAATAGCATCCCATTTGAACTGTTCTCGC. Deletion right flank: GATGGAAAAAGAAAACGAAATGCTCAGCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807