More Fields
Strain Species Genotype
PS7203 C. elegans syIs423 V. Show Description
syIs423 [15xUAS::?pes-10::GCaMP6s::SL2::mKate2::let-858 3'UTR + myo-2p::NLS::mCherry + 1kb DNA ladder(NEB)].  GCaMP6s cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
QP1208 C. elegans sws-1(ea12) V. Show Description
Increased lethality and male frequency. Synthetic lethal with helq-1(tm2134). Sensitive to camptothecin. Interacts with rip-1 and rfs-1. Reference: McClendon TB, et al. Genetics. 2016 May;203(1):133-45.
QW625 C. elegans zfIs42. Show Description
zfIs42 [rig-3p::GCaMP3::SL2::mCherry + lin-15(+)]. Reference: Shipley FB, et al. Front Neural Circuits. 2014 Mar 24;8:28.
RB1753 C. elegans fbxb-56(ok2243) I. Show Description
YY63D3A.10. Homozygous. Outer Left Sequence: AGGTGGAAGGGATGGCTATT. Outer Right Sequence: GCTTCCTTGACTCTCCGTTG. Inner Left Sequence: GAAATTTGCACTCCAGGGAA. Inner Right Sequence: TAGTCTGGAAGGAGCGCTGT. Inner Primer PCR Length: 3267 bp. NOTE: External left primer occurs twice in Y63D3A, once at coordinate 1234 and once at coordinate 3721, giving external WT products of 3493 and 1006 bp respectively. Shorter product is apparently preferred in PCR. Reactions on mutant template using ok2243_external primers thus primarily gives a product from EL(3721) and ER. Nested amplification on this product using ok2243_internal primers appears to give a product from EL(3721) (remaining primer from the external round passed to internal round by product transfer) and IR. Deletion Size: 219 bp. Deletion left flank: CCACTTCAGTCTTGATGCTGCGCTCGTGCC. Deletion right flank: TGTCACTAGCTCTATATTCAAGTCTCCTCG. Insertion Sequence: TTTTGTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1783 C. elegans C16C8.21(ok2301) II. Show Description
C16C8.16. Homozygous. Outer Left Sequence: AAGACGACCACACTCTCGCT. Outer Right Sequence: ACACTGGGAAAAATGTTCGG. Inner Left Sequence: TGCCGATACTAAAGTTCCCG. Inner Right Sequence: GGACTACGGTAGGTGGCAGA. Inner Primer PCR Length: 3110 bp. Deletion Size: 1331 bp. Deletion left flank: ATTGTTCGAAAATTTGATGTCGGAATTGAA. Deletion right flank: GACTGTCAAAGCCGAGCTGAATGTGACGAA. Interpretation of sequence data is very speculative, and should be confirmed independently. Predominant band in PCR of mutants, about 600 bp, is probably not the full-length mutant product. Full-length mutant product is more likely a fainter band of about 1770 bp, which correlates well with deduced breakpoints and relative sizes of various bands produced by single-round amplification with external and internal primer pairs. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
SLE1 Escherichia coli E. coli [argA, lysA, mcrA, mcrB, IN(rrnD-rrnE)1, lambda-, rcn14::Tn10(DE3 lysogen::lavUV5 promoter -T7 polymerase]. Show Description
Bacteria. E. coli carrying pAG607 (orn-1 RNAi feeding vector) for SILAC. Arg-, Lys-, AmpR, TetR. argA, lysA, mcrA, mcrB, IN(rrnD-rrnE)1, lambda-, rnc14::Tn10(DE3 lysogen::lavUV5 promoter -T7 polymerase). Resistant to ampicillin and tetracycline. Reference: Larance M, et al. Nat Methods. 2011 Aug 28;8(10):849-51. Biosafety Level: BSL-1.
SP1196 C. elegans dyf-7(m539) X. Show Description
Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective. Animals slightly short.
SP1205 C. elegans dyf-1(mn335) I. Show Description
Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective.
SP1234 C. elegans dyf-2(m160) III. Show Description
Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective.
SP1237 C. elegans dyf-4(m158) V. Show Description
Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective.
SP1603 C. elegans dyf-3(m185) IV. Show Description
Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective.
SP1709 C. elegans dyf-10(e1383) I. Show Description
Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective.
SP1712 C. elegans dyf-6(m175) X. Show Description
Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective.
SP1713 C. elegans dyf-11(mn392) X. Show Description
Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective. Animals slightly short.
SP1735 C. elegans dyf-7(m537) X. Show Description
Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective.
SP1742 C. elegans tbb-4(sa127) X. Show Description
Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective.
SP1745 C. elegans dyf-5(mn400) I. Show Description
Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective. Animals slightly short.
TG3796 C. elegans bub-3(gt2000) II. Show Description
Y54G9A.6. Nonsense C to T transition. IR sensitive. To genotype: WT left mismatch primer: GAAACAGGCAACGGAACAC; mutant left mismatch primer: GAAACAGGCAACGGAAACT; right mismatch primer: CTCTTCATCATCTCCTCTCC. WT and mutant amplicon: 407 bp. Reference: Bertolini S, et al. G3 (Bethesda). 2017 Dec 4;7(12):3875-3885.
TG3967 C. elegans bub-3(ok3437) II Show Description
Y54G9A.6. IR sensitive. To genotype: External left primer: GTCCCGTTTCCCCCATTTG. External right primer: CTCTTCATCATCTCCTCTCC. Internal right primer: CTCCTCCGAACGCTACTT. External WT amplicon: 1970 bp. External mutant amplicon: 1635 bp. Internal WT amplicon: 1534 bp. Reference: Bertolini S, et al. G3 (Bethesda). 2017 Dec 4;7(12):3875-3885. Kim T, et al. J Cell Biol. 2015 May 25;209(4):507-17.
TG3969 C. elegans san-1(ok1580) I. Show Description
ZC328.4. IR sensitive. External left primer: AACAAGAAGGGGAAGAAAGA. External right primer: TGTCTCATCGAAATCCAACT. Internal Left Sequence: AGGAAGAAACGAGAAAAGCA. External WT amplicon: 1420 bp. External mutant amplicon: 428 bp. Internal WT amplicon: 720 bp. Reference: Bertolini S, et al. G3 (Bethesda). 2017 Dec 4;7(12):3875-3885.
TQ2183 C. elegans lite-1(xu7) X; xuEx705. Show Description
xuEx705 [npr-9p::GCaMP3.0 + npr-9::DsRed2B]. Superficially wild-type. Maintain by picking red fluorescent animals; DsRed might not be visible at lower magnifications. Reference: Piggott BJ, et al. Cell. 2011 Nov 11;147(4):922-33.
TQ3032 C. elegans lite-1(xu7) X; xuEx1040. Show Description
xuEx1040 [nmr-1p::G-CaMP3.0 + nmr-1p::DsRed]. Pick fluorescent animals to maintain. Reference: Piggott BJ, et al. Cell. 2011 Nov 11;147(4):922-33.
TY3579 C. elegans sea-1(y356) II. Show Description
Wild type phenotype. In order to identify the correct genotype, JRP93 catttgtctagaactgtcattctgtc; and JRP106 gatctccatttgccggcaaattctcc primers are used to produce a 486 bp amplicon that can be sequenced with either primer for confirmation of the sea-1(y356) lesion (C to T at +97). The sea-1(y356) mutation is covered by the balancer mIn1[dpy-10(e128) mIs14], which is often used in construction of sea-1(y356) containing strains.
UL2992 C. elegans leEx2992. Show Description
leEx2992 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL2994 C. elegans leEx2994. Show Description
leEx2994 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL2996 C. elegans leEx2996. Show Description
leEx2996 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL3294 C. elegans leEx3294. Show Description
leEx3294 [sir-2.1::mCherry + R11A8.5::GFP + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon and R11A8.5 with GFP inserted just before the STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL3295 C. elegans leEx3295. Show Description
leEx3295 [sir-2.1::mCherry + R11A8.5::GFP + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon and R11A8.5 with GFP inserted just before the STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL3351 C. elegans leEx3351. Show Description
leEx3351 [sir-2.1::mCherry + R11A8.5::GFP + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon and R11A8.5 with GFP inserted just before the STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
VC1003 C. elegans vha-3(ok1501) IV. Show Description
Y38F2AL.4. Superficially wild type. External left primer: GGTGAAAAATCGGGGAAAAT. External right primer: GCGATGACAACTATTGGGCT. Internal left primer: TTTAGCTCAAAATTTGCCCG. Internal right primer: ATGTGCTGCGACTTCCTTCT. Internal WT amplicon: 2580 bp. Deletion size: 710 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10067 C. elegans F31D5.1(gk770) gkDf13 unc-4(e120) II. Show Description
This strain is homozygous for two deletions plus unc-4(e120). The deletions were identified by comparative genome hybridization (CGH) of a mutangenized unc-4 line against N2. The deletion gk770 was confirmed by PCR and sequencing of the amplification product, and is detectable using the following primers. Left primer: GCGCATTTGCAACATCTCTA. Right primer: AACCTCAACGGAAACACTGG. WT amplicon: 1087 bp. Deletion size: 142 bp. Deletion left flank: CAGGTGAGCTTAAGCAGATTTTTTTTTGAA. Deletion right flank: GTGAGCCAAGTTAAACATTTGAAAATAATT. Insertion Sequence: GTGAGCCAAGTTGAACATTTGAAAATAAT. The deletion gkDf13 was not confirmed by PCR. CGH data indicates a maximum size of 7801 bp and a minimum size of 1357 bp. Left flanking probe: GTTTTATCTTTCGGCTTATTCAGAATAAATTATTGGTTCAGTTGTTTCAG. Left deleted probe: AGGAGAAGGAGATAAATGGTCTTGTAGACTGCGCAGCTAGGGAGAGAGAA. Right deleted probe: GAAGTTCTGAAGATTCAATTTTCAGTCTTACAATATTCAGTTCTCGTGTA. Right flanking probe: GTTGAATTTATTCGAATTTTGCAATTTCAGCAAAACACCTTTATCTTGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10068 C. elegans unc-4(e120) sre-29(gk771) II. Show Description
F57G9.4. Unc. External left primer: GACCTGAAATTGCTGGGAAA. External right primer: GGAAACTCACAAATTGCCGT. External WT amplicon: 1532 bp. Deletion size: 161 bp. Deletion left flank: CCCTCTCCACCGCAATTGCAAGAACTCCAA. Deletion right flank: GCTATAGTAATCAATTTTCCAATTATAAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1007 C. elegans C10H11.8(ok1413)/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
C10H11.8. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1413 homozygotes (arrest stage/phenotype undetermined). Homozygous ok1413 males are segregated, but homozygous ok1413 hermaphrodites have not been isolated. Pick WT and check for correct segregation of progeny to maintain. External left primer: GGCAGCTGGGATTTATTCAG. External right primer: GCGTGGAGAAACAAAATGGT. Internal left primer: GAATCAGTCGTGGGCATTTT. Internal right primer: ATTCGCGTTTTGCTTGAAAT. Internal WT amplicon: 2524 bp. Deletion size: 770 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10070 C. elegans K05F1(gk773) unc-4(e120) II. Show Description
K05F1. Unc. External left primer: GTATGGTCCGTCGCAAGAAT. External right primer: CTGATGACGGTTTTCCTGGT. External WT amplicon: 1653 bp. Deletion size: 490 bp. Deletion left flank: CCGCCAAATTTGGCGGTTTCTGAGACCTTG. Deletion right flank: CTCGCATACGCTTGAAACTTACAGCGTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10071 C. elegans srb-16(gk774) unc-4(e120) II. Show Description
F58A6.6. Unc. External left primer: AAGTGGTTTTGGGTCTGACG. External right primer: GTACCGCCGCAAGAATGTAT. Internal left primer: GCCGCCACGAGTTAATAGAA. Internal right primer: TGTTGGCCCTGATTTCTTTC. Internal WT amplicon: 4857 bp. Deletion size: 3522 bp. Deletion left flank: ACGATTTTTGCACAAAAAACCCCTCCAAAC. Deletion right flank: GTCGTTTGCTTGTTTCATCTTCATCATTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10072 C. elegans cpna-2(gk775) unc-4(e120) II. Show Description
B0228.4. Unc. External left primer: GCTCAAAGCTCCGAAACAAC. External right primer: CCCACAAGATTGGTAAGCGT. External WT amplicon: 876 bp. Deletion size: 153 bp. Deletion left flank: AGTTAGACACACTGAAAATGCTGGAAAGGT. Deletion right flank: CAGAAGCCTTGCTCCGTCGGCATCTGAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10073 C. elegans T28D9(gk776) unc-4(e120) II. Show Description
T28D9. Unc. External left primer: CATTTCGGAACGTTTCCATC. External right primer: TCTGCTTCGTACTTTGCTGC. External WT amplicon: 1121 bp. Deletion size: 436 bp. Deletion left flank: TTTTTTACGTGAATCTTTTTTTTTTCAGAA. Deletion right flank: CAAGTTGTGAATTTTCGAACATCCGTCGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10075 C. elegans T05A6.4(gk777) unc-4(e120) II. Show Description
T05A6.4. Unc. External left primer: GCAATCCTTCAAGTTCCCAA. External right primer: ACGACTTGCAGATGGTTGTG. External WT amplicon: 902 bp. Deletion size: 140 bp. Deletion left flank: GGGCATGTAAAAGTGTGCTTGTCTTTCATA. Deletion right flank: TACCACCATTTTTTTTTCATTTTTGGATGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10077 C. elegans unc-4(e120) Y46E12BL.2(gk801gk909) II. Show Description
Y46E12BL.2. Unc. External left primer: ATCCACAATGCTCCGATCTC. External right primer: TCTGGCTTGCTTTTGTGATG. External WT amplicon: 540 bp. This strain contains two point mutations in Y46E12BL.2. The first is gk801, which is a G->A mutation at Y46E12BL coordinate 21938 (flanking sequences GTTCTTGAAGCTATACGGCTTTACACAGAA and TTACTCCAGCCGATCTGGTCACCCGTTATG). The second is gk909, which is an A->G mutation at Y46E12BL coordinate 21966 (flanking sequences AAGTTACTCCAGCCGATCTGGTCACCCGTT and TGTCGATAGTGCGATCGCCAAGTCCAAGGA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10078 C. elegans syd-1(gk802) unc-4(e120) II. Show Description
F35D2.5. Unc. External left primer: TCAACGTTGTCGCTGATCTC. External right primer: CCTCAAATTCACGGAATGCT. External WT amplicon: 543 bp. This strain carries a point mutation in F35D2.5. The mutation is gk802, which is an A->T mutation at F35D2 coordinate 23221 (flanking sequences TCGACCAACTCACTAACTCTTGAGGGCCAT and TCGACAAAATCATTTGGAGACTTGAAGATG). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10079 C. elegans unc-4(e120) mix-1(gk803) II. Show Description
M106.1. Unc. External left primer: GTTGAGGAAGCAGCTGGAAC. External right primer: TTCTTCGCAGCAGTAATCCC. External WT amplicon: 815 bp. This strain carries a point mutation in M106.1. The mutation is gk803, which is an A->G mutation at R06F6 coordinate 40587 (flanking sequences CACAAAATACCGTAATGACCTCGAATCCCT and ACGAGAGGAACAATTGCTAATGACAAAGGA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10080 C. elegans C06B8.3(gk783) V. Show Description
C06B8.3. Superficially wild type. External left primer: GACATGGTTCTATCCGCCAG. External right primer: GCAGAAGGCAAAAGAGCATC. External WT amplicon: 452 bp. Deletion size: 81 bp. Deletion left flank: CTGTCAATGTGAACCCTGGACTGACGGAGT. Deletion right flank: AGGTCATTTGGGAGTCCTACAAACTTCTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10109 C. elegans K05F6(gk907) unc-4(e120) II. Show Description
K05F6.2. Unc. External left primer: ACAAATTCCCTTTGTCGTCG. External right primer: TGGATGAGCAGCTGGTAAGA. External WT amplicon: 200 bp. This strain carries a point mutation in K05F6.2. The mutation is gk907, which is a T->A mutation at K05F6 coordinate 21364 (flanking sequences AAATCAAAAACTCTGTTTGATGGATATCTA and ATGCCTTTAAATGATCTACTTCTTACCAGC). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10110 C. elegans let-19(gk908) unc-4(e120) II. Show Description
K08F8.6. Unc. External left primer: TCAATGCCTGGAGATGATGA. External right primer: CCCGCCTTCTTTATCTGTTG. External WT amplicon: 434 bp. This strain carries a point mutation in K08F8.6. The mutation is gk908, which is a G->A mutation at K08F8 coordinate 36647 (flanking sequences AATGGTTGAAGAAAGCAAGAAGGAAAGTTA and CAAACAACAGATAAAGAAGGCGGGGCAGTA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10123 C. elegans R11G1.6(gk1190) X. Show Description
R11G1.6. External left primer: GAGACGTTGAAGTACGCGCT. External right primer: CCGAAAATTCGAAAGCGTAA. Internal left primer: TTACCCAGAGACCGAACTGC. Internal right primer: CTTCATCGCCCTCTTTCCTT. Internal WT amplicon: 838 bp. Deletion size: approximately 200 bp. This deletion was identified by comparative genome hybridization (CGH) and confirmed by PCR, but was not sequenced. Left flanking probe: AAAGGATCACCCACAGCATCTCTCCAAACAGCCAACCCAAAACTAAAATT. Left deleted probe: AAAACAATGAGTACGGATTCAAAAATAAAACCTTGTAGGAAACTTGTGTA. Right deleted probe: GGATTCGATGGCATCTGTATAGAGTTGAATGGCATAATTATAGGCATTTA. Right flanking probe: GAAGCGATTCGAATCGTTCTCCCGACAACATCTTAGGAACAACGGCCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10124 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in B0310.1 (gk1191), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: GAATCCGAGAAAAGCGTCTG. External right primer: GATCTTTTGGCCTTTTGCTG. Internal left primer: TCATCCACGTAGACTTGCCA. Internal right primer: TTGCAATCCTGAAGCAAATG. Internal WT amplicon: 2706 bp. Maximum deletion size: 1911 bp. Minimum deletion size: 881 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking CGH probe: CAAAACGCGTGTTAACCCTGTGCCATCTGTCTGATCCGACTCAGAAAACA. Left deleted CGH probe: TTTCTGAATACAAGAGAAGAGCATAATGGGCGCTGATCTTCCACCGAAAT. Right deleted CGH probe: AATACATTTAAGCTACACACCTACTTGCCTGCTCTCAGTGTGACCGAAAA. Right flanking CGH probe: AAGTTTATGGGCCTGAAACAATTGTATTTTCGTATCTTGACATTGATAAA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10127 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in F19C6.1 (gk1192), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: CGAACTCGCCGTTCTACTTC. External right primer: GTTTTAGCGGCTTCAACTGC. Internal left primer: CGTCCCTTGATTGGTTCATT. Internal right primer: GATTCTCATTGGCAGACGGT. Internal WT amplicon: 3924 bp. Approximate deletion size: 2575 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking CGH probe: TTCGTTCAAGCTTAATGTTTCAGCATGCCTCTTCTTGACTCGCTTCTTTT. Left deleted CGH probe: TCCGGTACCAATTGTCGACTTGCTACCATTTTACGACCGCACAACTAAAA. Right deleted CGH probe: TAGTGAGGGAACTGTAGATAATTCTTCCACTTTTTGCTTTTTCCTTTCTT. Right flanking CGH probe: TACCGTATTGGCAACGATATTTTCAATCTCCATGGTCCTATCGTGGCTGA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10131 C. elegans fbxc-44(gk1193) II. Show Description
C16A11.6. External left primer: TCCACGGGAATTTCTACTGC. External right primer: CGCAAATTTTTCCGTGTTTT. Internal left primer: CTCCTTCAATCCAGCTTTCG. Internal right primer: AGACAATTCCGCCAACAATC. Internal WT amplicon: 3801 bp. Approximate deletion size: 1600 bp. This deletion was identified by comparative genome hybridization (CGH) and confirmed by PCR, but was not sequenced. Left flanking probe: CGATAAATCGTTCGATTAGGGGGTTATCCGATGACCGAGTCATGAAATGT. Left deleted probe: CATAAACCGCCAAGGTTCGTGAATCCTGTGCGACGCCAACTTAAATTAGT. Right deleted probe: TGAAATTTCGAACCTTGAACTTCTTAAATGACTGGGGCAGCTCAAGAATA. Right flanking probe: AAAATGCGTGCGGCGCGTTGCAACTTAGCTCCGCCCACCCTTTGAGGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10165 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in F42A10.1 (gk1194), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: TGGCTTTGCAATCTGTTGAG. External right primer: ATGCTTGCTCGTTGTCTGTG. Internal left primer: ACTTGATTCTTGACGAGCCT. Internal right primer: CAACTGATAAGAGTGGTTCGCA. Internal WT amplicon: 906 bp. Maximum deletion size: 137 bp. Minimum deletion size: 101 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking probe: TTTTGTTTCGCATTCGGTTGTTTCCCATATTTCACCCAGTTTCCACGTTT. Left deleted probe: TATTAAATTGTTCACTTCAAAATTTAAGTATGAGTGAGAGCTCTAGCCTG. Right deleted probe: AAATAATGCAAAGGTCTTCCTTGCTCGGGTCATCATGAAGAAGATACTCG. Right flanking probe: GGGTCATCATGAAGAAGATACTCGAGTTGGTAAGGCTTATCGTTCTGAAA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10166 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries homozygous deletions in C26C6.1 (gk1195) and F14D12.6 (gk1196), identified by CGH (Comparative Genome Hybridization), and confirmed by PCR but not sequenced. The deletions can be detected by the following primers. gk1195: External left primer: ACGGAAGTTCTCAAAGCGAA. External right primer: TCGTCTTCAGCAGTGAATGG. Internal left primer: GCAGGCTCTTCAATGTACGA. Internal right primer: TCTCGGAAAGGCGTAAGAAA. Internal WT amplicon: 506 bp. Approximate deletion size: 100 bp. gk1196: External left primer: CCGGGAAATCACAGCACTAT. External right primer: TACGAATGCAGCGACAGAAC. Internal left primer: AGGATTCACGACGAATGTCC. Internal right primer: CTTCTCGGTAACTTCGCCAC. Internal WT amplicon: 1785 bp. Approximate deletion size: 900 bp. gk1195 left flanking probe: GATGAGGAGGGAGGAAACAAACCGGCGATGGTGAAAAGACATGTAGGATA. gk1195 left deleted probe: TTTCTGCATGTTATTAATTAAATTCTTTTCAGGAAAGCGAAGTCGAAATG. gk1195 right deleted probe: ATATGTGGCACCATGTTACGCATACGTTTCCCGATCTGACGAGAAGAAAA. gk1195 right flanking probe: ACGCATACGTTTCCCGATCTGACGAGAAGAAAACTCCTCTTCACATTTTC. gk1196 left flanking probe: AGCAACCGACATCTGGACGACACGTCGCCGTAGCTCCTTTTGAGTGACGT. gk1196 left deleted probe: GCTCAAATTGCAAACTAGTTTTCATTTGTAGAACTCCATGAGTGGATGAA. gk1196 right deleted probe: TCTCTGTTTCCTTCAGTCGCTGCCTACTATGACGGATGGTTATACTGTAG. gk1196 right flanking probe: CTATGACGGATGGTTATACTGTAGATTTTGGCATAAACGATGATGAGAAT. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537