More Fields
Strain Species Genotype
VC4112 C. elegans T03F6.10(gk5189) III. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5189 mutation is C->T, flanking sequences AATGAGAGCAATGAGAAGAAGCATAAAAAT and TGGAAATATAGAAATATACTTACTTTTAAG.
VC4113 C. elegans K12C11.6(gk5190) I; sre-40(gk5191) II. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5190 mutation is G->A, flanking sequences CAAAAATCGAGATGAGTTAGTAAGCCGGAG and TGAGTTAATCATACAAAATCAAAAAAAAAA. The gk5191 mutation is A->C, flanking sequences CCAATCTATAGCATAGTATAAAAATATTTC and TATTCTTGAAAGAAGTTATAATATTGCAGA.
VC4114 C. elegans C01A2.6(gk5192) I; F25B5.3(gk5193) III. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5192 mutation is G->A, flanking sequences TCCAAGCAAGGCACAAATTCTTGAAGCTTG and GAAAATGGAGCCGAACCTTGGCAATCTACC. The gk5193 mutation is C->T, flanking sequences AGACGATTCGAAAGTCGACAATCAATCTTA and AATTGCGAAGTAAGTGAAAGTGAGAACTTT.
VC4115 C. elegans K12C11.6(gk5190) abhd-11.1(gk5194) C01A2.6(gk5192) I; F25B5.3(gk5193) III. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5190 mutation is G->A, flanking sequences CAAAAATCGAGATGAGTTAGTAAGCCGGAG and TGAGTTAATCATACAAAATCAAAAAAAAAA. The gk5192 mutation is G->A, flanking sequences TCCAAGCAAGGCACAAATTCTTGAAGCTTG and GAAAATGGAGCCGAACCTTGGCAATCTACC. The gk5193 mutation is C->T, flanking sequences AGACGATTCGAAAGTCGACAATCAATCTTA and AATTGCGAAGTAAGTGAAAGTGAGAACTTT. The gk5194 mutation is G->A, flanking sequences TACCTGGGCTCTTTGGAACAAAAGAAAACT and GATCCAAGTCGGCAAAGATCTCAGTCAACG.
VC4116 C. elegans abhd-11.1(gk5194) I. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5194 mutation is G->A, flanking sequences TACCTGGGCTCTTTGGAACAAAAGAAAACT and GATCCAAGTCGGCAAAGATCTCAGTCAACG.
VC4117 C. elegans F57G12.1(gk5196) X. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5194 mutation is A->T, flanking sequences CTCTTTGCGTGGTCTCTGACGCTCGGTTGG and TAATCGATGATCACCTGGCGTGTGAAAGGC.
VC4118 C. elegans ZK1248.11(gk5197) II. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5197 mutation is G->A, flanking sequences AAATTGGATCCTTTCTACTATGTTGAACTT and CATCACTTCCATTTCATTTTCATCGTTTTT.
VC4119 C. elegans clec-199(gk5198) IV. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5198 mutation is G->A, flanking sequences AATTAAAAAATGTTTAATACCACCTATTCA and ACAGCAAAAACTACAAAGTCCACGACAACC.
VC4120 C. elegans dhs-29(gk5199) X. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5199 mutation is C->T, flanking sequences AGCGACCGGCACACTTGAAGAGAGCAGAAA and TGAAATAAAAAATTAGATTTTATCATGTTA.
VC4121 C. elegans C36B7.3(gk5200) ent-2(gk5201) X. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5200 mutation is C->T, flanking sequences GAGAAACAAATATGCATTGAGTCACCGATT and AGAAGCGGCATCCAAGATCTTTTCATGATA. The gk5201 mutation is G->A, flanking sequences TCTTTTTTTCAACTAATCTACATACTTCCA and GGCTCACTGGATTTTTCACTCTTACCATCA.
VC4122 C. elegans F53G12.9(gk5202) I. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5202 mutation is G->A, flanking sequences TTTCTTCGGAGCAAGCTAATTCCCTATGAA and TGAGAGCATTTAGGTTAATAAACATAGTCC.
VC4123 C. elegans srw-68(gk5203) V. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5203 mutation is C->T, flanking sequences TGATGAAATTTTTATGCTAGAATTTTCGAA and CTATTTTCCGATCCATTTCGTTGTGATATC.
VC4124 C. elegans R07E3.7(gk5204) X. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing.The gk5204 mutation is A->T, flanking sequences TGGAGGTTGCTTTTTGTCTTTTGATCGTAT and CAGAAAAATAGGATGAGAATCAACAGAACG.
VC4125 C. elegans ptr-13(gk5205) II. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5205 mutation is C->T, flanking sequences CAGAGGATACGATAGATTGACCCCAGGCAT and CATTCGATTGCAAGTAGTTTCTAAACCAGT.
VC4126 C. elegans Y39G10AR.15(gk5206) ZC334.7(gk5207) I; cnnm-5(gk5208) III. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5206 mutation is T->A, flanking sequences GGCCTTTCCAACTTAGAATTTTGGTCGTCC and GAAAAATAACGAAGTTATGGTGAACTCCCT. The gk5207 mutation is C->T, flanking sequences CCTGAGATCAAATGTACAAATTTTCAGGCC and GACGCTACCCGGTAATGATGTACACCCTGA. The gk5208 mutation is T->A, flanking sequences CAATCGTGATGATTCCGACTACTTTCGAGC and GAAATTTGGTGAAACTTTAGGGCTACAATG.
VC4127 C. elegans ZC334.7(gk5207) I; cnnm-5(gk5208) III; K08H2.10(gk5209) X. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5207 mutation is C->T, flanking sequences CCTGAGATCAAATGTACAAATTTTCAGGCC and GACGCTACCCGGTAATGATGTACACCCTGA. The gk5208 mutation is T->A, flanking sequences CAATCGTGATGATTCCGACTACTTTCGAGC and GAAATTTGGTGAAACTTTAGGGCTACAATG. The gk5209 mutation is G->T, flanking sequences AAAAAGGAAGACATTGAGTTTGAGGATACA and AACGTCGAATTCATTCTCGAAGTGTTCGAA.
VC4132 C. elegans srz-38(gk5214) IV. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5214 mutation is C->T, flanking sequences TTACTGTTTCCAGCAGTCAATCATTTCTAT and AAATGACAAGAAACGTTTTTTTCCTCTGCA.
VC4133 C. elegans hot-6(gk5215) V. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5215 mutation is G->A, flanking sequences CACCAATTGGATAAAAGAAAATATCAGTTT and AGTTGCAAGTTGTCGACGAACTGTTGCATT.
VC4134 C. elegans ZK1225.1(gk5216) I. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5216 mutation is C->T, flanking sequences AAATACACTCTGGAATCATACGCATCAATT and GAAGATATTATCCTACCAACAAGTTTATTA.
VC4135 C. elegans fbxa-182(gk5217) II; srbc-70(gk5218) IV. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5217 mutation is C->T, flanking sequences GCTGATGCGGACATCCAACTTAGTTAAAAT and CATTCATTTGTGGCTTGACATAAATTATAT. The gk5218 mutation is C->T, flanking sequences GTGATCAGTTCTATTTTTGGTGCAGAACTT and CAGACGAAAAGTCGAATGGCAAGAACTGCT.
VC4156 C. elegans R12C12.6(gk5239) II; clec-56(gk5240) V. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5239 mutation is A->T, flanking sequences AAATTTTAAAAGACTCGGACAAATGCATCG and CATCGTGTATCTTCGAAGTTAGCCTGAAAA. The gk5240 mutation is G->A, flanking sequences ATGCTGACACCAATCACTGCCCTCTTGGAT and GACCTTCTCCACCAATACTTCTTACTGTTA.
VC4157 C. elegans glct-4(gk5241) I; C05D2.8(gk5242) III. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5241 mutation is C->T, flanking sequences GAGCTTCCACAACGACTCCTCCGACTAGGC and TGAAATTTTAGGGGGTTCTGGGATTGAGGT. The gk5242 mutation is C->T, flanking sequences ACAATATCCCTCTCTCCTCCATCACCACCC and ACTGAGAATTCATCAAATTTTCTTTATTGT.
VC4158 C. elegans AH9.1(gk5243) K09C4.10(gk5244) X. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5243 mutation is C->T, flanking sequences TTCAGTCCGACTGTTTTGTGATGGCTGTCT and CAGAACCAATTACGTTTGTCAATTTTCCGC. The gk5244 mutation is C->A, flanking sequences TGTCTGATCCTTTCTCAATAGTTCCATCCT and GCGCTTTTCAGCAATATGATTTTCAGATCC.
VC4177 C. elegans fipr-3(gk5263) K09E3.5(gk5264) X. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5263 mutation is G->A, flanking sequences TTTTTCGTATTTTCAATTTCCAATGTTTCA and CCTTCTTTGTGTCCTTGCCTTGGTCATGTG. The gk5264 mutation is G->A, flanking sequences ATCTTCTTACCTTTGCTCCTTTCGGAGCTT and ATCTTCCCAGCTGATTTCCCTGGCCATAGA.
VC4178 C. elegans W03G9.2(gk5265) I; C34F11.1(gk5266) II. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5265 mutation is G->A, flanking sequences GAAATGACCGCCGAACTGAAGAAGTTAAAG and TGATATATACAACAATGAACAATCACTAAT. The gk5266 mutation is C->T, flanking sequences TCAGGCTCATGGCGAGCTCTTCCAGTGGCA and AAGGCGGTTCCTCACATATTCGTATCTGGC.
VC4181 C. elegans clec-91(gk5267) I. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5267 mutation is C->T, flanking sequences AATGCGCTGGTGCCAAGATCCTTGTGGTCC and AGTTGTAGTATGTCACTGTAAGATTGATTA.
VC4182 C. elegans nol-16(gk5268) I. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5268 mutation is G->A, flanking sequences TGCTCATTGATTCATAATTTTGAATTTTCA and AAAGAGATCATCGACGCGGAGCCAATTGAC.
VC4209 C. elegans C29F9.8(gk5294) III; fbxa-139(gk5295) V. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5294 mutation is C->T, flanking sequences CAGAAAAGTACAAATTTGCCTGGATTTTGC and TGAAAATTTTTATCAAAAAACCGGCAAATT. The gk5295 mutation is G->A, flanking sequences GATTAAATCTGATTAGATGAAGCTCAAATC and ATCGAAGTTGTAGAGATACTCCATTGGCAT.
VC4210 C. elegans frpr-2(gk5296) X. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5296 mutation is G->A, flanking sequences ATAGAGGGGTACGCGGGAGTTGCCAATCTG and TAAGTATACTGAAAACCCTAGTTTTCGAGG.
VC4211 C. elegans C03B1.1(gk5297) X. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5297 mutation is C->T, flanking sequences TTGTACGACGAGTCATGCTGTGTTGGAGCC and GAGGTCGTGATGTCTATCTAAATTTCGGTC.
VC4212 C. elegans C56A3.8(gk5298) V. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5298 mutation is G->A, flanking sequences ATAATTTTAAGGAAAAAATTAAATTTTTCA and AAACTTTTCCGTCACGGAATCGCTAGCTCC.
VC4213 C. elegans tsp-19(gk5299) I. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5299 mutation is G->A, flanking sequences AAAAGTCATATAATGACATATGTAAACCCG and TGAGTGACGGATTGAATGAAGTCCATTATC.
VC4214 C. elegans D2005.4(gk5300) I. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5300 mutation is G->A, flanking sequences AATCTTGATTTTAAATGCGAACGATTTTCA and GGCGAAGACTACAATGTGCAGCAGGCAAAA.
VC54 C. elegans unc-112(r367) V; dim-1(gk54) X. Show Description
C18A11.7. Suppressed Unc. Left primer: TCCACCAACAAGCTTTTGCC. Right primer: CTCAGTCGATCACAATACAG. WT amplicon: 1031 bp. Deletion size: 133 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC593 C. elegans Y48A6B.5(ok807) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y48A6B.5. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok807 homozygotes (often sickly, slow-growing, or sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTCAGGTAAACCCAATCGC. External right primer: GCGAGACCGGTAAATTCTCA. Internal left primer: CAAGTTGGCCAAGAAGGTGT. Internal right primer: TTTTTCCTCGAAACAATGGC. Internal WT amplicon: 2103 bp. Deletion size: 1269 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC664 C. elegans ras-1(ok977) II. Show Description
C44C11.1. Superficially wild type. External left primer: GTCCAAGTCGTCAAGGCAAT. External right primer: GCAGGAAGATCGGTAAGCAC. Internal left primer: CCAAAGAAATCCCGTTTTGA. Internal right primer: ACGCTATAGCCTTCCCCAAT. Internal WT amplicon: 3114 bp. Deletion size: 1173 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC728 C. elegans atl-1(ok1063) V. Show Description
T06E4.3. Superficially wild type. External left primer: TGAAGCTGGTCCTCTGTCTG. External right primer: AAGAAATGAGTGCCGCAAGT. Internal left primer: TATATCACGGTCTCCTCGGG. Internal right primer: TCTTCAATCTCGCCAAATCC. Internal WT amplicon: 3344 bp. Estimated deletion size: 1400 bp. Breakpoints only narrowed due to extremely poor sequence quality. Deletion of approximately 1400 bp lies between chromosome V coordinates 9640245 and 9642180. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC740 C. elegans F20D1(gk323) X. Show Description
F20D1. Superficially wild type; affects pseudogene. External left primer: GGTATGACCAGCAAGACCGT. External right primer: CGTACATTGATGCTCGGTTG. Internal left primer: TGGGACAAAGACCATTCACA. Internal right primer: TTGTTTGGGATGTTGGAGGT. Internal WT amplicon: 1634 bp. Deletion size: 806 bp. Deletion left flank: CTTTACAGTGAATTATATTGCTCATGAAAC. Deletion right flank: CTCTCTATTCTTGAGTGAACCCAAATCAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC856 C. elegans eif-3.H(ok1353)/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
C41D11.2. Homozygous sterile deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, arrested szT1 aneuploids, Lon-2 males, and ok1353 homozygotes (sterile adult). Pick WT and check for correct segregation of progeny to maintain. Gravid WT progeny that do not segregate Lon-2 males are rare recombinants. External left primer: ATGATGGTGGTGGGATTGTT. External right primer: GGGGAAGGTGGAAAAGGATA. Internal left primer: TGGAACCAATGGTGTCTGAA. Internal right primer: GGGAGGAAACAAAAACACGA. Internal WT amplicon: 2150 bp. Deletion size: 1337 bp. Deletion left flank: GTGAACTTCATGCAGGAATTAGTGAGGTAT. Deletion right flank: GCTGTTGCTGAGGAGAAAGTCGCCGGAACA. Insertion Sequence: GT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC915 C. elegans taf-4(ok1399) I. Show Description
R119.6. Superficially wild type. External left primer: AGGCTCAACCGCATCTTTTA. External right primer: CATCGATTTTGCAGCATTGT. Internal left primer: GGAATGCTGTTCGAAATGGT. Internal right primer: CGAAAAATGACACCCTTGGT. Internal WT amplicon: 2880 bp. Deletion size: 869 bp. Deletion left flank: CAGCAGCCACCACTAGAAATGCGTCAAATT. Deletion right flank: ACTTGCTTCGTGTCGATTTACGGGAGCTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC979 C. elegans F18A12(gk911) II. Show Description
F18A12. External left primer: TAGTCGGCGCTTCAGGTACT. External right primer: CTGGGCTCTTTACTTCCGTG. Internal left primer: TTTCATGGCTTCTATCCGCT. Internal right primer: TTATCTGGAATCGGCTTTGG. Internal WT amplicon: 1859 bp. Deletion size: 721 bp. Deletion left flank: AATAAGGAAACATACCCGAAAAACTCGAGG. Deletion right flank: AAAAAATGGGGTTTTAATATTGTTTTTATA. Insertion Sequence: AAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC988 C. elegans ceh-60(ok1485) X. Show Description
F22A3.5. Superficially wild type. External left primer: TATGGCGGTTCAAAATGTCA. External right primer: AAAGGTGAAGGTCACATCCG. Internal left primer: TCGAATTTTGCCCAGTTTTC. Internal right primer: TTCAGGCTCTCGGATGAACT. Internal WT amplicon: 2621 bp. Deletion size: 612 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC996 C. elegans pas-5(ok1808) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F25H2.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1808 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGAGTGTTCACAAACCCAA. External right primer: TGGATTCTTTCCGAGGTGTC. Internal left primer: GCTCTGTCACCTCGAAGACC. Internal right primer: GCGGACGTATTGAATGTGTG. Internal WT amplicon: 2116 bp. Deletion size: 880 bp. Deletion left flank: GAGTACGATCGTGGAGTCAACACTTTTTCT. Deletion right flank: TTATTTGTCGTTCTTTTATACATTTTTGAA. Insertion Sequence: AAAAAATAGAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VH742 C. elegans tsn-1(hd42) II. Show Description
F10G7.2. External left primer: AGAACTTTGTCGGATCGATTGT. External right primer: TCTCCGTACTCCCAAATGTTCT. Internal left primer: AAAGAGACTTCGCTTGTGGAAG. Internal right primer: ACCTTCTTGTTTCCACTGTCGT. Internal WT amplicon: 1729 bp. Deletion size: 878 bp. Deletion left flank: AACAACTTTATAAAATTGTATTTTTTTTTT. Deletion right flank: ACGTCCAACTCACTTCTGATGCTTTCGCCC. This strain was provided by the Hutter Lab at Simon Fraser University (Burnaby, BC), which should be acknowledged in any publications resulting from its use.
VPR108 C. elegans vprIs108. Show Description
vprIs108 [hlh-17p::GCaMP2.0 + hlh-17p::mCherry]. Variably penetrant backward ventral coiler. GCaMP2.0 green fluorescence is normally very low. Reference: Stout RF, Parpura V., Cell Calcium. 2011 Jul;50(1):98-108.
XA8400 C. elegans qaIs8400. Show Description
qaIs8400 [let-858p::Ov-GST-3 + rol-6(su1006)]. Called AK1 in the reference article. The Ov-GST-3 gene was amplified from genomic DNA of O. volvulus with 1µM of the sequence specific primer 5'Klon and 3'Klon (5'Klon: 5'-GGCGTACGATGTCAAGATTTCCTCAACAAG-3'; 3'Klon: 5'-GGTCTAGATTTATTTAGGAATGATTGAATCGGTCG-3'; representing bases 4 - 25 and the complementary sequence of bases 821 - 841 of the published Ov-GST-3 cDNA (AF203814); bold underlines indicate restriction sites for Pfl23II (SplI) and XbaI, respectively; dotted underline indicates the start codon for translation; italics indicates the conserved sequence for the polyadenylation signal for transgenic transcript processing; the 8 5'-nucleotides of primer 3'Klon and the fourteen 5'-nucleotides of primer 5'Klon do not correspond to the template and introduce the sequences to the amplicon), 200 µM of each deoxynucleotide (Gibco BRL) and 2.5 units of Taq polymerase (Gibco BRL). After an initial denaturation of 3 minutes at 93°C, 35 cycles of annealing at 55°C for 1 minute, synthesis at 72°C for 2 minutes and a 1 minute denaturation at 93°C were performed, followed by a final extension at 72°C for 5 minutes. The genomic Ov-GST-3 fragment obtained by PCR (see above) was ligated into the pGEM-T Easy vector (Promega) by TA-cloning, cleaved with the restriction enzymes Pfl23II (SplI) and XbaI (restriction sites introduced by the primer) and inserted between the unique Pfl23II (SplI) and XbaI sites of the vector pPD103.05 (kindly provided by A. Fire). The sequence of the genomic Ov-GST-3 fragment in the resulting plasmid pAK1 was confirmed by automated dye terminator, dideoxy sequencing (ABI Prism 377TM Sequencer, PE Applied Biosystems) using the PCR primers (see above). The pAK1 DNA was injected in combination with the marker plasmid pRF4 [rol-6(su1006)] into the gonads of N2 C. elegans at a concentration of approximately 100 ng/µl for each plasmid. Transgenic worms were identified by the selectable Roller marker phenotype and the stable transmitting line AK1ex (AK1 extrachromosomal) was established. Integration of the extrachromosomal arrays was achieved by irradiation of AK1ex worms with 3600 rad (1 rad = 0.01 Gy) of x-rays (x-ray chamber: RUM 9421-070-77002, Philips, Netherlands; dosimeter: PTW-SN4, PTW, Germany). The progeny of these worms was then screened for 100% transmittance of the Roller phenotype to obtain the C. elegans line AK1int (AK1 integrated) with the chromosomally integrated transgenes.
XE1995 C. elegans wpIs98 I; ric-7(n2657) V; wpIs103. Show Description
wpIs98 [itr-1pB::Chrimson::SL2::mCherry + odr-1p::RFP] I. wpIs103 [myo-3p::GCaMP6 + myo-2p::mCherry].  ric-7 causes defective expulsion during defecation and slightly slow growth. Chrimson is expressed in DA9. GCaMP6 expressed in body wall muscles. Use 100 uM ATR in OP50 for optogenetic experiments. Reference: Ding C & Hammarlund M. Elife. 2018 Oct 29;7. pii: e38829. doi: 10.7554/eLife.38829.
ZM8428 C. elegans hpIs459. Show Description
hpIs459 [unc-4p::GCaMP3::wCherry + lin-15(+)]. Strong GCaMP3 and wCherry expression in A-class motor neurons, as well as some head and tail neurons. It is recommended to use L4 stage animals when using this strain for calcium imaging and recording. Transgene expression becomes dimmer in many A-class neurons (except DA9), and is expression in VC neurons of adults. Reference: Gao S, et al. eLife, 7, e29915. https://doi.org/10.7554/eLife.29915 PMID: 29360035
ZM9078 C. elegans hpIs587. Show Description
hpIs587 [flp-14p::GCaMP6::wCherry + lin-15(+)]. CGaMP6 and wCherry expressed in RID, ALA, some head neurons, a mid-body neuron and a tail neuron. Reference: Lim et al., 2016. Elife 5. pii: e19887. doi: 10.7554/eLife.19887.
ZW495 C. elegans zwIs132. Show Description
zwIs132 [myo-3p::GCamp2 + lin-15(+)]. Transgenic animals are GFP+ in body wall muscle. Maintain under normal conditions. Reference: Liu P, et al. J Physiol. 2011 Jan 1;589(Pt 1):101-17.