F46C5.3. External left primer: GGATCATGCTCATCTCCGAT. External right primer: CGGTTTCTTGCTTCATCCTC. Internal left primer: GACGCCAACAAATTGGAACT. Internal right primer: ATTTGAAACAAAGAAGGCGG. Internal WT amplicon: 1158 bp. Deletion size: 651 bp. Deletion left flank: AAGTGTTATGCATTATTCAGCTGATTCGTA. Deletion right flank: CTCCATTAAATCTAACAACTACTGTTAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07G5.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3542 homozygotes (sterile, lays some eggs but none hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTGCCTTTTGTAGATGTGATAGGA. External right primer: TAATCCGAAAGTCACAAAATCTGA. Internal left primer: GTCCCCACAGATGACGTTCT. Internal right primer: CCTTGCATCAGCTTTTCACA. Internal WT amplicon: 1884 bp. Deletion size: approximately 1125 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59A2.4. Deletion balanced by glp-1 and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok3753 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAACACCAATGGATTTGGC. External right primer: CCAGGCTTGCAAATAAGCTC. Internal left primer: AAAGTCAATTTCGGCCCATT. Internal right primer: TTGAGGACAAAACCTACCCG. Internal WT amplicon: 1279 bp. Deletion size: 698 bp. Deletion left flank: CCGAGAGCGCATACGTTGCCGAGAGCACTC. Deletion right flank: AAATCTATCTCTCTACGAAGCATTGTTCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22A3.8. Homozygous lethal deletion balanced with bli-4-marked balancer. Heterozygotes are WT and segregate WT, Bli-4 hT2 homozygotes, hT2 aneuploids (arrested embryos), and ok2030 homozygotes (arrest stage/phenotype undetermined). hT2 homozygotes do not blister until the adult, and may be very difficult to tell from WT. Pick WT and check for correct segregation of progeny to maintain. External left primer: GGAGGTCGTAGATGCGAGAG. External right primer: TTCTCAACTCCGATCGCTTT. Internal left primer: TATCGGCTTCCAATCCTTTG. Internal right primer: GCTTTCGGGTAAGTGTGAGC. Internal WT amplicon: 3097 bp. Deletion size: 1499 bp. Deletion left flank: GTAAACCAGGACACGTCGGAAATCCATCTC. Deletion right flank: TGGTTCCAATATGAACCGAAAAATTTACTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK370.2. Apparent homozygous lethal deletion chromosome balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok3109 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTCGCTGATTCCAGTCGTTT. External right primer: AGCTAAATCCGCACACGAAC. Internal left primer: TAAACAGCATGCGGTGGAAT. Internal right primer: TGAAAAATTTGGCTCCGAGT. Internal WT amplicon: 1222 bp. Deletion size: 707 bp. Deletion left flank: AATAACTTTGAGAGGGAAAAGGTTACGAAA. Deletion right flank: TCACTGAAGATTTTCGATATGGAGATTTTT. Insertion sequence: TCACTGAAGATTTTCGATATGTATTTGAGAGGGAAAAGGTTACGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Splicing defect and nonsense allele identified by amplicon sequencing.

Homozygous viable. Splicing defect identified by amplicon sequencing.

Homozygous viable. Nonsense alleles identified by amplicon sequencing.

Homozygous viable. Nonsense alleles identified by amplicon sequencing.

Homozygous viable. Nonsense alleles and splicing defect allele identified by amplicon sequencing.

Homozygous viable. Nonsense allele identified by amplicon sequencing.

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Recessive lethal. Nonsense allele identified by amplicon sequencing, balanced by inversion marked with dpy-10 and myo-2 GFP. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, non-GFP gk3816 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain.

Homozygous viable. Nonsense allele identified by amplicon sequencing.

Homozygous viable. Nonsense alleles identified by amplicon sequencing.

Homozygous viable. Nonsense alleles and splicing defect identified by amplicon sequencing.

Homozygous viable. Nonsense allele identified by amplicon sequencing.

Homozygous viable. Splicing defects identified by amplicon sequencing.

Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.

Homozygous viable. Splicing defect identified by amplicon sequencing.

C54D2.5. Mildly Unc, slow-moving. External left primer: TCGGAGATGGTGATTCTTCC. External right primer: TGATGGAGTCCGGATAAAGC. Internal left primer: TTGCTTTCTCGCATCCTCTT. Internal right primer: TTCCAAGCTCTGGTGGTTTC. Internal WT amplicon: 1379 bp. Deletion size: 267 bp. Deletion left flank: GCGCCACAAAGTAAAGAGCTGCCCATGGGT. Deletion right flank: CTCGAGATAACTTGAGCGCTGGTACACTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Splicing defect identified by amplicon sequencing.

Homozygous viable. Nonsense allele identified by amplicon sequencing.

Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.

Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.

Homozygous viable. Nonsense allele identified by amplicon sequencing.

Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 5156 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAAAAGTCTGATGAAGATTCTGAGCCACCA. Right flanking sequence: TACCAATGTTCCAGATATTCGTGTCAGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5170 mutation is G->A, flanking sequences TCATTCCACTTCCAGATTTGGATAACGAAG and TAAGTGTTCTGAAGATGAAAACAACTATTT.

Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5171 mutation is G->A, flanking sequences CTCTGATAATAAAACATTTGTAAAGTGTTC and AATGATATTTTTCGTTGCAGATTGTTTTTT. The gk5172 mutation is T->C, flanking sequences GACGCTTTCCACCACTCCTTCCAAAATTGC and GAAAATTTGAAAACATTTGGATTTTCTATT.

Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5173 mutation is G->A, flanking sequences ATATGTAAAAACTCACCTCTTGGAAGTACT and ATCGTTTCCATTGATATGATCCATCCAGAC.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5174 mutation is G->A, flanking sequences AAATCCCTAGAAAAAAATCGATTTTTTTCA and CTTCCACCGAAAATTCAACGTGTAGAATCC.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5175 mutation is C->T, flanking sequences TCAATCCGCAAAAAGATGCAGAGAAGGTAA and TGAAAAATTGTGTAGGTAAGAAAAAAAAAA.

Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5176 mutation is T->A, flanking sequences ACCTCTGGATCCAATTGAACATATTACATA and GAAATTGATGAAATCTATGCTCCAATGTCT.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5177 mutation is C->T, flanking sequences TGTTATACAATTAAATTTAAAAAATCCTTA and CGAGACATCCACAAAGAGTGTAAACGATTA.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5178 mutation is G->A, flanking sequences GCAGAAACATAGAAACTTTGAAATTTTTCA and ATACCTCATGTAGTCGAATGCCTGCACATA.

Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5179 mutation is C->T, flanking sequences GGTGAAGCTGAGGCATTACGCGCTTCTCGT and TGAAAAATTTTAATGGATTTTTTGATTCTT. The gk5180 mutation is G->A, flanking sequences AAACTGAAAAGAAGACGTTTCCAATGCTTT and GGATTCTCAACTTATGAATAATCCGATATT. The gk5181 mutation is T->A, flanking sequences AGCATTTGCAGACGGAGATTTTACAACTTG and GAAGAAAATTTTAAAAGACGAGTTGAATCC.

Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5182 mutation is C->T, flanking sequences TCGTTCTTTCAGGAGACTATCAAAATGGCT and AGCTACTTGTCAATTTCTATGAAACGAATA.

Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5184 mutation is G->A, flanking sequences CCGACTTGCTGACTGCATTCGGAAGACTAT and GAATAGTGGCCTCGGCGCTTATATGAAACA.

Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5185 mutation is T->G, flanking sequences GATGATCTTCAACGACATCAACTCATTCTA and GATGAAAAGATTGAGGAGCTCAATGAGTTC.

Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5186 mutation is C->T, flanking sequences TCCGAGATATAGCAGAATTATGATCCAGGA and CAATTTTTTTGATTTAAAATCCATTTTTTG. The gk5187 mutation is G->A, flanking sequences AGATATGAGCGAAGATAAAGTTCTTATTAG and TAAGTAGCTTATTTTTTTAGAAAAAAACAT. The gk5188 mutation is C->T, flanking sequences GAAATCGCCAACATCAACCATTCAGTTAAA and AGCTTCTAACTGATATGGATACGGTGAAAG.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5189 mutation is C->T, flanking sequences AATGAGAGCAATGAGAAGAAGCATAAAAAT and TGGAAATATAGAAATATACTTACTTTTAAG.

Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5190 mutation is G->A, flanking sequences CAAAAATCGAGATGAGTTAGTAAGCCGGAG and TGAGTTAATCATACAAAATCAAAAAAAAAA. The gk5191 mutation is A->C, flanking sequences CCAATCTATAGCATAGTATAAAAATATTTC and TATTCTTGAAAGAAGTTATAATATTGCAGA.

Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5192 mutation is G->A, flanking sequences TCCAAGCAAGGCACAAATTCTTGAAGCTTG and GAAAATGGAGCCGAACCTTGGCAATCTACC. The gk5193 mutation is C->T, flanking sequences AGACGATTCGAAAGTCGACAATCAATCTTA and AATTGCGAAGTAAGTGAAAGTGAGAACTTT.

Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5190 mutation is G->A, flanking sequences CAAAAATCGAGATGAGTTAGTAAGCCGGAG and TGAGTTAATCATACAAAATCAAAAAAAAAA. The gk5192 mutation is G->A, flanking sequences TCCAAGCAAGGCACAAATTCTTGAAGCTTG and GAAAATGGAGCCGAACCTTGGCAATCTACC. The gk5193 mutation is C->T, flanking sequences AGACGATTCGAAAGTCGACAATCAATCTTA and AATTGCGAAGTAAGTGAAAGTGAGAACTTT. The gk5194 mutation is G->A, flanking sequences TACCTGGGCTCTTTGGAACAAAAGAAAACT and GATCCAAGTCGGCAAAGATCTCAGTCAACG.

Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5194 mutation is G->A, flanking sequences TACCTGGGCTCTTTGGAACAAAAGAAAACT and GATCCAAGTCGGCAAAGATCTCAGTCAACG.

Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5194 mutation is A->T, flanking sequences CTCTTTGCGTGGTCTCTGACGCTCGGTTGG and TAATCGATGATCACCTGGCGTGTGAAAGGC.

Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5197 mutation is G->A, flanking sequences AAATTGGATCCTTTCTACTATGTTGAACTT and CATCACTTCCATTTCATTTTCATCGTTTTT.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5198 mutation is G->A, flanking sequences AATTAAAAAATGTTTAATACCACCTATTCA and ACAGCAAAAACTACAAAGTCCACGACAACC.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5199 mutation is C->T, flanking sequences AGCGACCGGCACACTTGAAGAGAGCAGAAA and TGAAATAAAAAATTAGATTTTATCATGTTA.

Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5200 mutation is C->T, flanking sequences GAGAAACAAATATGCATTGAGTCACCGATT and AGAAGCGGCATCCAAGATCTTTTCATGATA. The gk5201 mutation is G->A, flanking sequences TCTTTTTTTCAACTAATCTACATACTTCCA and GGCTCACTGGATTTTTCACTCTTACCATCA.