More Fields
Strain Species Genotype
VC39 C. elegans cca-1(gk30) X. Show Description
C54D2.5. Mildly Unc, slow-moving. External left primer: TCGGAGATGGTGATTCTTCC. External right primer: TGATGGAGTCCGGATAAAGC. Internal left primer: TTGCTTTCTCGCATCCTCTT. Internal right primer: TTCCAAGCTCTGGTGGTTTC. Internal WT amplicon: 1379 bp. Deletion size: 267 bp. Deletion left flank: GCGCCACAAAGTAAAGAGCTGCCCATGGGT. Deletion right flank: CTCGAGATAACTTGAGCGCTGGTACACTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3942 C. elegans col-128(gk5030) IV. Show Description
Homozygous viable. Splicing defect identified by amplicon sequencing.
VC3945 C. elegans F12A10.8(gk5033) II. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing.
VC3964 C. elegans aps-3(gk5047) I; C17C3.3(gk5048) II. Show Description
Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.
VC3965 C. elegans clec-118(gk5049) C17C3.3(gk5048) II. Show Description
Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.
VC4001 C. elegans Y55F3AM.11(gk5073) IV. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing.
VC4002 C. elegans C06E2.9(gk5074) C05G5.3(gk5075) X. Show Description
Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.
VC4065 C. elegans ampd-1(gk5139[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 5156 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAAAAGTCTGATGAAGATTCTGAGCCACCA. Right flanking sequence: TACCAATGTTCCAGATATTCGTGTCAGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4083 C. elegans tni-4(gk5170) IV. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5170 mutation is G->A, flanking sequences TCATTCCACTTCCAGATTTGGATAACGAAG and TAAGTGTTCTGAAGATGAAAACAACTATTT.
VC4084 C. elegans T27E7.4(gk5171) IV; irk-2(gk5172) X. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5171 mutation is G->A, flanking sequences CTCTGATAATAAAACATTTGTAAAGTGTTC and AATGATATTTTTCGTTGCAGATTGTTTTTT. The gk5172 mutation is T->C, flanking sequences GACGCTTTCCACCACTCCTTCCAAAATTGC and GAAAATTTGAAAACATTTGGATTTTCTATT.
VC4085 C. elegans glb-31(gk5173) II. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5173 mutation is G->A, flanking sequences ATATGTAAAAACTCACCTCTTGGAAGTACT and ATCGTTTCCATTGATATGATCCATCCAGAC.
VC4086 C. elegans Y37H9A.1(gk5174) .I Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5174 mutation is G->A, flanking sequences AAATCCCTAGAAAAAAATCGATTTTTTTCA and CTTCCACCGAAAATTCAACGTGTAGAATCC.
VC4087 C. elegans Y45F10D.15(gk5175) IV. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5175 mutation is C->T, flanking sequences TCAATCCGCAAAAAGATGCAGAGAAGGTAA and TGAAAAATTGTGTAGGTAAGAAAAAAAAAA.
VC4088 C. elegans gpa-14(gk5176) I. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5176 mutation is T->A, flanking sequences ACCTCTGGATCCAATTGAACATATTACATA and GAAATTGATGAAATCTATGCTCCAATGTCT.
VC4089 C. elegans C27A7.6(gk5177) V. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5177 mutation is C->T, flanking sequences TGTTATACAATTAAATTTAAAAAATCCTTA and CGAGACATCCACAAAGAGTGTAAACGATTA.
VC4090 C. elegans hot-8(gk5178) X. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5178 mutation is G->A, flanking sequences GCAGAAACATAGAAACTTTGAAATTTTTCA and ATACCTCATGTAGTCGAATGCCTGCACATA.
VC4091 C. elegans F16A11.1(gk5179) I; H23N18.4(gk5180) K11G9.2(gk5181) V. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5179 mutation is C->T, flanking sequences GGTGAAGCTGAGGCATTACGCGCTTCTCGT and TGAAAAATTTTAATGGATTTTTTGATTCTT. The gk5180 mutation is G->A, flanking sequences AAACTGAAAAGAAGACGTTTCCAATGCTTT and GGATTCTCAACTTATGAATAATCCGATATT. The gk5181 mutation is T->A, flanking sequences AGCATTTGCAGACGGAGATTTTACAACTTG and GAAGAAAATTTTAAAAGACGAGTTGAATCC.
VC4092 C. elegans etc-1(gk5182) II. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5182 mutation is C->T, flanking sequences TCGTTCTTTCAGGAGACTATCAAAATGGCT and AGCTACTTGTCAATTTCTATGAAACGAATA.
VC4093 C. elegans K11E4.1(gk5184) X. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5184 mutation is G->A, flanking sequences CCGACTTGCTGACTGCATTCGGAAGACTAT and GAATAGTGGCCTCGGCGCTTATATGAAACA.
VC4094 C. elegans col-141(gk5185) V. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5185 mutation is T->G, flanking sequences GATGATCTTCAACGACATCAACTCATTCTA and GATGAAAAGATTGAGGAGCTCAATGAGTTC.
VC4095 C. elegans srz-5(gk5186) II; R09H10.7(gk5187) IV; F54B11.7(gk5188) X. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5186 mutation is C->T, flanking sequences TCCGAGATATAGCAGAATTATGATCCAGGA and CAATTTTTTTGATTTAAAATCCATTTTTTG. The gk5187 mutation is G->A, flanking sequences AGATATGAGCGAAGATAAAGTTCTTATTAG and TAAGTAGCTTATTTTTTTAGAAAAAAACAT. The gk5188 mutation is C->T, flanking sequences GAAATCGCCAACATCAACCATTCAGTTAAA and AGCTTCTAACTGATATGGATACGGTGAAAG.
VC4112 C. elegans T03F6.10(gk5189) III. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5189 mutation is C->T, flanking sequences AATGAGAGCAATGAGAAGAAGCATAAAAAT and TGGAAATATAGAAATATACTTACTTTTAAG.
VC4113 C. elegans K12C11.6(gk5190) I; sre-40(gk5191) II. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5190 mutation is G->A, flanking sequences CAAAAATCGAGATGAGTTAGTAAGCCGGAG and TGAGTTAATCATACAAAATCAAAAAAAAAA. The gk5191 mutation is A->C, flanking sequences CCAATCTATAGCATAGTATAAAAATATTTC and TATTCTTGAAAGAAGTTATAATATTGCAGA.
VC4114 C. elegans C01A2.6(gk5192) I; F25B5.3(gk5193) III. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5192 mutation is G->A, flanking sequences TCCAAGCAAGGCACAAATTCTTGAAGCTTG and GAAAATGGAGCCGAACCTTGGCAATCTACC. The gk5193 mutation is C->T, flanking sequences AGACGATTCGAAAGTCGACAATCAATCTTA and AATTGCGAAGTAAGTGAAAGTGAGAACTTT.
VC4115 C. elegans K12C11.6(gk5190) abhd-11.1(gk5194) C01A2.6(gk5192) I; F25B5.3(gk5193) III. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5190 mutation is G->A, flanking sequences CAAAAATCGAGATGAGTTAGTAAGCCGGAG and TGAGTTAATCATACAAAATCAAAAAAAAAA. The gk5192 mutation is G->A, flanking sequences TCCAAGCAAGGCACAAATTCTTGAAGCTTG and GAAAATGGAGCCGAACCTTGGCAATCTACC. The gk5193 mutation is C->T, flanking sequences AGACGATTCGAAAGTCGACAATCAATCTTA and AATTGCGAAGTAAGTGAAAGTGAGAACTTT. The gk5194 mutation is G->A, flanking sequences TACCTGGGCTCTTTGGAACAAAAGAAAACT and GATCCAAGTCGGCAAAGATCTCAGTCAACG.
VC4116 C. elegans abhd-11.1(gk5194) I. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5194 mutation is G->A, flanking sequences TACCTGGGCTCTTTGGAACAAAAGAAAACT and GATCCAAGTCGGCAAAGATCTCAGTCAACG.
VC4117 C. elegans F57G12.1(gk5196) X. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5194 mutation is A->T, flanking sequences CTCTTTGCGTGGTCTCTGACGCTCGGTTGG and TAATCGATGATCACCTGGCGTGTGAAAGGC.
VC4118 C. elegans ZK1248.11(gk5197) II. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5197 mutation is G->A, flanking sequences AAATTGGATCCTTTCTACTATGTTGAACTT and CATCACTTCCATTTCATTTTCATCGTTTTT.
VC4119 C. elegans clec-199(gk5198) IV. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5198 mutation is G->A, flanking sequences AATTAAAAAATGTTTAATACCACCTATTCA and ACAGCAAAAACTACAAAGTCCACGACAACC.
VC4120 C. elegans dhs-29(gk5199) X. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5199 mutation is C->T, flanking sequences AGCGACCGGCACACTTGAAGAGAGCAGAAA and TGAAATAAAAAATTAGATTTTATCATGTTA.
VC4121 C. elegans C36B7.3(gk5200) ent-2(gk5201) X. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5200 mutation is C->T, flanking sequences GAGAAACAAATATGCATTGAGTCACCGATT and AGAAGCGGCATCCAAGATCTTTTCATGATA. The gk5201 mutation is G->A, flanking sequences TCTTTTTTTCAACTAATCTACATACTTCCA and GGCTCACTGGATTTTTCACTCTTACCATCA.
VC4122 C. elegans F53G12.9(gk5202) I. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5202 mutation is G->A, flanking sequences TTTCTTCGGAGCAAGCTAATTCCCTATGAA and TGAGAGCATTTAGGTTAATAAACATAGTCC.
VC4123 C. elegans srw-68(gk5203) V. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5203 mutation is C->T, flanking sequences TGATGAAATTTTTATGCTAGAATTTTCGAA and CTATTTTCCGATCCATTTCGTTGTGATATC.
VC4124 C. elegans R07E3.7(gk5204) X. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing.The gk5204 mutation is A->T, flanking sequences TGGAGGTTGCTTTTTGTCTTTTGATCGTAT and CAGAAAAATAGGATGAGAATCAACAGAACG.
VC4125 C. elegans ptr-13(gk5205) II. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5205 mutation is C->T, flanking sequences CAGAGGATACGATAGATTGACCCCAGGCAT and CATTCGATTGCAAGTAGTTTCTAAACCAGT.
VC4126 C. elegans Y39G10AR.15(gk5206) ZC334.7(gk5207) I; cnnm-5(gk5208) III. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5206 mutation is T->A, flanking sequences GGCCTTTCCAACTTAGAATTTTGGTCGTCC and GAAAAATAACGAAGTTATGGTGAACTCCCT. The gk5207 mutation is C->T, flanking sequences CCTGAGATCAAATGTACAAATTTTCAGGCC and GACGCTACCCGGTAATGATGTACACCCTGA. The gk5208 mutation is T->A, flanking sequences CAATCGTGATGATTCCGACTACTTTCGAGC and GAAATTTGGTGAAACTTTAGGGCTACAATG.
VC4127 C. elegans ZC334.7(gk5207) I; cnnm-5(gk5208) III; K08H2.10(gk5209) X. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5207 mutation is C->T, flanking sequences CCTGAGATCAAATGTACAAATTTTCAGGCC and GACGCTACCCGGTAATGATGTACACCCTGA. The gk5208 mutation is T->A, flanking sequences CAATCGTGATGATTCCGACTACTTTCGAGC and GAAATTTGGTGAAACTTTAGGGCTACAATG. The gk5209 mutation is G->T, flanking sequences AAAAAGGAAGACATTGAGTTTGAGGATACA and AACGTCGAATTCATTCTCGAAGTGTTCGAA.
VC4132 C. elegans srz-38(gk5214) IV. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5214 mutation is C->T, flanking sequences TTACTGTTTCCAGCAGTCAATCATTTCTAT and AAATGACAAGAAACGTTTTTTTCCTCTGCA.
VC4133 C. elegans hot-6(gk5215) V. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5215 mutation is G->A, flanking sequences CACCAATTGGATAAAAGAAAATATCAGTTT and AGTTGCAAGTTGTCGACGAACTGTTGCATT.
VC4134 C. elegans ZK1225.1(gk5216) I. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5216 mutation is C->T, flanking sequences AAATACACTCTGGAATCATACGCATCAATT and GAAGATATTATCCTACCAACAAGTTTATTA.
VC4135 C. elegans fbxa-182(gk5217) II; srbc-70(gk5218) IV. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5217 mutation is C->T, flanking sequences GCTGATGCGGACATCCAACTTAGTTAAAAT and CATTCATTTGTGGCTTGACATAAATTATAT. The gk5218 mutation is C->T, flanking sequences GTGATCAGTTCTATTTTTGGTGCAGAACTT and CAGACGAAAAGTCGAATGGCAAGAACTGCT.
VC4156 C. elegans R12C12.6(gk5239) II; clec-56(gk5240) V. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5239 mutation is A->T, flanking sequences AAATTTTAAAAGACTCGGACAAATGCATCG and CATCGTGTATCTTCGAAGTTAGCCTGAAAA. The gk5240 mutation is G->A, flanking sequences ATGCTGACACCAATCACTGCCCTCTTGGAT and GACCTTCTCCACCAATACTTCTTACTGTTA.
VC4157 C. elegans glct-4(gk5241) I; C05D2.8(gk5242) III. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5241 mutation is C->T, flanking sequences GAGCTTCCACAACGACTCCTCCGACTAGGC and TGAAATTTTAGGGGGTTCTGGGATTGAGGT. The gk5242 mutation is C->T, flanking sequences ACAATATCCCTCTCTCCTCCATCACCACCC and ACTGAGAATTCATCAAATTTTCTTTATTGT.
VC4158 C. elegans AH9.1(gk5243) K09C4.10(gk5244) X. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5243 mutation is C->T, flanking sequences TTCAGTCCGACTGTTTTGTGATGGCTGTCT and CAGAACCAATTACGTTTGTCAATTTTCCGC. The gk5244 mutation is C->A, flanking sequences TGTCTGATCCTTTCTCAATAGTTCCATCCT and GCGCTTTTCAGCAATATGATTTTCAGATCC.
VC4177 C. elegans fipr-3(gk5263) K09E3.5(gk5264) X. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5263 mutation is G->A, flanking sequences TTTTTCGTATTTTCAATTTCCAATGTTTCA and CCTTCTTTGTGTCCTTGCCTTGGTCATGTG. The gk5264 mutation is G->A, flanking sequences ATCTTCTTACCTTTGCTCCTTTCGGAGCTT and ATCTTCCCAGCTGATTTCCCTGGCCATAGA.
VC4178 C. elegans W03G9.2(gk5265) I; C34F11.1(gk5266) II. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5265 mutation is G->A, flanking sequences GAAATGACCGCCGAACTGAAGAAGTTAAAG and TGATATATACAACAATGAACAATCACTAAT. The gk5266 mutation is C->T, flanking sequences TCAGGCTCATGGCGAGCTCTTCCAGTGGCA and AAGGCGGTTCCTCACATATTCGTATCTGGC.
VC4181 C. elegans clec-91(gk5267) I. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5267 mutation is C->T, flanking sequences AATGCGCTGGTGCCAAGATCCTTGTGGTCC and AGTTGTAGTATGTCACTGTAAGATTGATTA.
VC4182 C. elegans nol-16(gk5268) I. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5268 mutation is G->A, flanking sequences TGCTCATTGATTCATAATTTTGAATTTTCA and AAAGAGATCATCGACGCGGAGCCAATTGAC.
VC4209 C. elegans C29F9.8(gk5294) III; fbxa-139(gk5295) V. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5294 mutation is C->T, flanking sequences CAGAAAAGTACAAATTTGCCTGGATTTTGC and TGAAAATTTTTATCAAAAAACCGGCAAATT. The gk5295 mutation is G->A, flanking sequences GATTAAATCTGATTAGATGAAGCTCAAATC and ATCGAAGTTGTAGAGATACTCCATTGGCAT.
VC4210 C. elegans frpr-2(gk5296) X. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5296 mutation is G->A, flanking sequences ATAGAGGGGTACGCGGGAGTTGCCAATCTG and TAAGTATACTGAAAACCCTAGTTTTCGAGG.