This strain is homozygous for a deletion (gk3187) in T05H4.13, detectable by PCR using the following primers. External left primer: AAGGACCTTCGAAACATAAGGAG. External right primer: ATCTCCACCCTCCCAATTAAATA. Internal left primer: AAGCAGGTGCTGACTGTGTG. Internal right primer: CATTCCAAATTTCGGCAGTT. Internal WT amplicon: 2323 bp. Deletion size: 512 bp. Deletion left flank: ACCACTGCTAGTCTCATTCAAAAGGCGTTT. Deletion right flank: GATCAAAAATGGAGGAAAAATCAACAAAAA. Validation: gk3187 passed by CGH. Other deletions (gk3201, gk3202, gk3203) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48G10A.4. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and gk3088 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTAATTGTTCGGCGAATTTT. External right primer: AAACATTTTCAACCCTGCAAGT. Internal left primer: ATACGTCACCCGAGCAATTC. Internal right primer: CAACCAGAATGCAGAGCAAA. Internal WT amplicon: 1226 bp. Deletion size: 763 bp. Deletion left flank: CCAGTATAGATTGAATAACTTTAAAAATTT. Deletion right flank: AAAATGCTCCACGTACGCATTCTCATGATT. Insertion Sequence: AACTATAGTTATTTAAATTCTTACTGTAGTTTTCGCTAAGTGATATCGCGCGTCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R11A8.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3090 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCGTATTATGGCAGCTCAC. External right primer: CGTTCGAGCCCACATTTTAT. Internal left primer: CGATTTTGATTTTTACAATTGCTG. Internal right primer: ATCATTTTGAAAGGGAGACTCAAC. Internal WT amplicon: 1355 bp. Deletion size: 373 bp. Deletion left flank: AGTTTCGATTAAATTTTTTTAAATTTAAAT. Deletion right flank: CTTCCGAATCGACGACCGCCTGGACTCGGA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3102) in F45H7.6, detectable by PCR using the following primers. External left primer: CCCATTAACAATTGCCTGCT. External right primer: TCTGTGTGCAGTTTGGAAGC. Internal left primer: AAGGAACTGATGAACTGCCG. Internal right primer: AAAGCTAGCGGGAGAAGGAG. Internal WT amplicon: 2299 bp. Deletion size: 900 bp. Deletion left flank: GAAGTGATAGCAGCCGACACTTTACGGGCC. Deletion right flank: CAAAACAAACCTCTTCTGCAAGGACTTGTA. Insertion Sequence: AAAC. Validation: gk3102 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK270.1. Dpy or Dpyish. External left primer: CAACCAGATGACGCAGCTAA. External right primer: TGATTCCATTTCACGGACAA. Internal left primer: CCGGTCTCCAGGATAACAAA. Internal right primer: GTAGCCATGGAATACACGGG. Internal WT amplicon: 1140 bp. Deletion size: 899 bp. Deletion left flank: GGATAACAAATGTAAAGTCAGTCAAAATGA. Deletion right flank: ATATACACATTTGATGACGACACCGCTGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R06A4.9. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3744 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTTGTGTCTGGTGGTGGA. External right primer: GATGATTGTTGTTGTTGCGG. Internal left primer: TGGTTCAATAGTCTACTGGATGGT. Internal right primer: AACGAAAAACCAACCCTTCC. Internal WT amplicon: 1161 bp. Deletion size: 688 bp. Deletion left flank: GGCGACACTGTTGAAGACATTTTTGGATTG. Deletion right flank: CATCTCAGCAAGGACCTCCTCCACGACAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01A2.5. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and gk3070 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TAAATATAATACCGTGCGTGCG. External right primer: TCAAAGTCATGTTTCCGTATCG. Internal left primer: GGCTCAGGGTAAATAGACATGG. Internal right primer: TTTAAATGGGTTTGAATCTGGG. Internal WT amplicon: 1458 bp. Deletion size: 510 bp. Deletion left flank: ATTGCAAAAGTGGGCGGGGCGTCGTTTCGT. Deletion right flank: ATCAACTCGATTTTGAGCAAAACTATCTCG. Insertion Sequence: TAGTTATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C30B5.4. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3082 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACGTGGTGTGTGCATAAGGA. External right primer: TTGATTGAATTGGCGATGAA. Internal left primer: GAGAGCTTCGGAAGACATGG. Internal right primer: TCCAGGTTCCCTGAAACAAG. Internal WT amplicon: 1567 bp. Deletion size: 390 bp. Deletion left flank: AAAATTTGAAAAAGGCTTTATATTAATGTT. Deletion right flank: TCGGATTCATGTTTTACTGCAAAATGTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C07G2.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk3083 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCCATTCGTGTTTCGATGA. External right primer: AGTTATCCCCACCGCTTTTT. Internal left primer: AACCGGAAAAATTCCAAACC. Internal right primer: CTTCTTCGCCGTTTCACTTC. Internal WT amplicon: 2013 bp. Deletion size: 836 bp. Deletion left flank: CCGTTTTGTGGACGTCCAACTGGATTTCCA. Deletion right flank: TTGGCTTCCAAAGCTTCAAGAGATTGATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T12D8.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3661 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAACAGTTCCGTAACGCTCA. External right primer: TTCTGATGGGGCTATTGGAG. Internal left primer: GACGAGATCACGGATCCAAT. Internal right primer: GTTTTTGCACTGGCTGGAAT. Internal WT amplicon: 1224 bp. Deletion size: 706 bp. Deletion left flank: GCTTCCACAGGTCGACGTCGATCCGCCGAA. Deletion right flank: AAAGATGAGGTCGCCTGGAGTATGGAGGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Apparent homozygous lethal deletion chromosome (gk3069 in F56C11.1) balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and gk3069 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGTGCAAATGAAGGAGCATC. External right primer: CTTCACACCGTTGGACATTG. Internal left primer: TCCACAACTGAACACTCCGA. Internal right primer: TTCAGGAAGCATTCTTTGGG. Internal WT amplicon: 1399 bp. Deletion size: 443 bp. Deletion left flank: CTGAACACTCCGATTTTGGATTGCTGCAAA. Deletion right flank: AGGAAATATACTTTACGGCAACGAACTCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R53.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3079 homozygotes (sterile, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GGTCCGTGAACGTTCTTGTT. External right primer: CAAAGAAAGCCAAGGTCGAG. Internal left primer: AAAATGTGTGCAGTTTTCAACG. Internal right primer: AACAACGACATCGTGTTCACTC. Internal WT amplicon: 1340 bp. Deletion size: 565 bp. Deletion left flank: TTATATCCTATTTTCTGCTTTAAATTTGAG. Deletion right flank: AATTTGAAACGTCAGATGGAACTCAAGTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3104) in R173.4, detectable by PCR using the following primers. External left primer: AAAAGGATCCGAAAGGAGGA. External right primer: GCGTGTTACTGTACGCGAAA. Internal left primer: TTGCTCCTCCTTCCACACTT. Internal right primer: GGAAAGGGGGAAGTTGACTC. Internal WT amplicon: 1628 bp. Deletion size: 177 bp. Deletion left flank: CAGTTAATAGCAATCTCACTGGTATTAGTT. Deletion right flank: TTTCTCTATGAAAGTATGAAGACAAAAGAG. Insertion Sequence: TT. Validation: No CGH probes for gk3104. Other deletions (gkDf31, gkDf32) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39E4B.12. External left primer: GAAAAGGCAAAATACGACAAGG. External right primer: AATCGCGAAAAATTTCCAGTAA. Internal left primer: CAAAAATGTTGTCGATTTACGAAG. Internal right primer: CTTTTCTTACCAAGCATCGAATTT. Internal WT amplicon: 1049 bp. Deletion size: 233 bp. Deletion left flank: AGCGTGAGGGATTGATTCGAGCAAGACTTC. Deletion right flank: AATTTTGTGTCAAAAAATGGAAGGTAAAAA. Validation: gk3119 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y60A3A.12. Strongly Him, sickly, slow-growing. External left primer: GAGTTTTAGCGATTGCTCGG. External right primer: CGCGATTTTCGTATTTTCGT. Internal left primer: AAATTTCAAGGTTTTCGGCA. Internal right primer: GCGCAATTTTCTTCGTTTTT. Internal WT amplicon: 1171 bp. Deletion size: 390 bp. Deletion left flank: CGCCCGTACCACTGATCGATCGGATTTCTT. Deletion right flank: CAGTAGAAAACTACTCTATCAATGGAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3163) in Y67H2A.10, detectable by PCR using the following primers. External left primer: TTGAACATCGGAAACTGCAA. External right primer: GATTCTAGGCCACCGTTCAA. Internal left primer: ACCAGGGCACACGAAATAGA. Internal right primer: GCACCAATGAATCTACCGCT. Internal WT amplicon: 2510 bp. Deletion size: 1275 bp. Deletion left flank: ATTTAACCCCTTTTCATCAAAATTTTGAAT. Deletion right flank: ACATTTTTTAAATATTTATTGTATGAAGAA. Validation: gk3163 passed by CGH. Other deletions (gk3206, gk3207, gk3209) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3188) in Y38H6C.3, detectable by PCR using the following primers. External left primer: ACGAAGACCGTTTTTGCAGT. External right primer: CCATCAAGATTACCCTCCGA. Internal left primer: TGTCGGCCGATGTAGATAAA. Internal right primer: CTCCGAGTGTCGAGGAGAAG. Internal WT amplicon: 978 bp. Deletion size: 286 bp. Deletion left flank: ACATAGCGCTTGGGCCAAGAAGTACTAGGA. Deletion right flank: AAATTATATGTTTCTCAAAAAAAAACTCAC. Insertion Sequence: G. Validation: gk3188 validated by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3189) in F23H12.6, detectable by PCR using the following primers. External left primer: CATCCTTTCCTGCACCTCAT. External right primer: CGCCGTACAATTGTGTTGAC. Internal left primer: CTTACCCAGACCTGCCAGAA. Internal right primer: TTGAAGGAATGTCGGGAGTT. Internal WT amplicon: 1579 bp. Deletion size: 530 bp. Deletion left flank: TATTTTAACTTGCCATCTGTCATTTATATA. Deletion right flank: CGACCTTTTATTATTGATTGAAGCATTCCA. Validation: gk3189 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3116) in Y41D4B.21, detectable by PCR using the following primers. External left primer: GAAACGTTGGAAAAACGGAA. External right primer: CTTTGTTCGCTGCGTAATGA. Internal left primer: CAATTTCCATACCCTCGCTC. Internal right primer: CGCACACAAGCCTTAACTCA. Internal WT amplicon: 1594 bp. Deletion size: 444 bp. Deletion left flank: ACCTCATTAGTGACAGCTCTTCGAAAGAAT. Deletion right flank: CAATTTTTTCAGACATTTTTCTGATCTCGT. Insertion Sequence: AAA. Validation: No CGH probes for gk3116. Other deletions (gkDf36, gkDf37) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3190) in C01G12.1, detectable by PCR using the following primers. External left primer: TTTTCCAATTTTCCTGCACC. External right primer: ACCTGTTGAGCCTGCTGAGT. Internal left primer: AAAACAATTCGGCATTCGAC. Internal right primer: TTCATCTGCTGCTTGACCAC. Internal WT amplicon: 1381 bp. Deletion size: 421 bp. Deletion left flank: AAAAATAATTCAACATTTGAAACAAAAAAC. Deletion right flank: TATCGTGGTTGGACCCGTTTTTGAAGGATA. Insertion Sequence: GGATATATGTATATATATATAT. Validation: gk3190 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3191) in C08G9.2, detectable by PCR using the following primers. External left primer: TCACAAGTTGGTACTGGGAGG. External right primer: CCATGCGAATTTTTGAACTGT. Internal left primer: ACAAGACCGTATGGGCAAAG. Internal right primer: ACCAATTTCATCTTGCCCTG. Internal WT amplicon: 1980 bp. Deletion size: 465 bp. Deletion left flank: CATTTCAAAAATCCATGGCAATCCGAATCT. Deletion right flank: ATCACCGTATCCACTGTTTTTGCAATGGTA. Validation: gk3191 passed by CGH. Other deletions (gk3253, gk3254, gk3255) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3166) in R06F6.6, detectable by PCR using the following primers. External left primer: CGGGGAAATTATGAAAGCATTA. External right primer: TGCCAGCATAAAATTCAAAATG. Internal left primer: CGATGAAAATGTTCGGGATTAT. Internal right primer: AGCACAGAACAGGGACAAAAAT. Internal WT amplicon: 1384 bp. Deletion size: 892 bp. Deletion left flank: TCTTCCAGCAATGACTCCAACGCCGATTAT. Deletion right flank: TTTGGAATTTTTTTTGTCTGCTGACAAAAT. Insertion Sequence: T. Validation: gk3166 passed by CGH. Other deletions (gk3256, gk3257) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3297) in K09C6.7, detectable by PCR using the following primers. External left primer: GGCGGTGGTCCAGTAAACTA. External right primer: GCTCGGTTTTACGGAATTGA. Internal left primer: GTTGACGCCTCGACATGTAA. Internal right primer: CAGGAACGTTGCCAGGTAAT. Internal WT amplicon: 2481 bp. Deletion size: 2123 bp. Deletion left flank: GAAATGTTGACGCCTCGACATGTAAGTGTT. Deletion right flank: TTTTCAAAATTTCTACATTTCTGTACTAAT. Insertion Sequence: T. Validation: gk3297 passed by CGH. Other deletion (gk3510) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01D4.6. External left primer: CGCGTTGAAGTCAGTTGTGT. External right primer: GACTCCTGTTGGATTGGCAT. Internal left primer: CTGCCACATCAGTGTTGCTT. Internal right primer: CAAAGCCTCTCAGTGCGATT. Internal WT amplicon: 2450 bp. Deletion size: 1104 bp. Deletion left flank: TCCATAAGCGTCAACCTCCTAAAAATTAAA. Deletion right flank: ATAAAATGAGATTGGAAAATAGAATGAATA. Insertion Sequence: AAAATAAAAA. Validation: gk3299 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain in homozygous for a deletion (gk3165) in W05H7.4, detectable by PCR using the following primers. External left primer: TCATTGTACGCTGGCTTCTG. External right primer: CCGCACTGAAATTGGTAGGT. Internal left primer: GATTGAGTCCATCCTTCCGA. Internal right primer: GAGAAATCGTTCAACGGGAA. Internal WT amplicon: 1623 bp. Deletion size: 781 bp. Deletion left flank: ACGTGGCGGACGGCCCGGAAGTGGCAAATC. Deletion right flank: CCGCCTCATTGAAGCAAATGCGCTCTACCG. Validation: gk3165 passed by CGH. Other deletions (gk3513, gk3514) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3192) in E03H4.6, detectable by PCR using the following primers. External left primer: ACAGGGCGATTGACGATAAC. External right primer: CAGATAACCATGTCCCCCAC. Internal left primer: CCTCCAAACAATCCTCAAACA. Internal right primer: CTACGGAATGAATTGGCTTCA. Internal WT amplicon: 1592 bp. Deletion size: 392 bp. Deletion left flank: AGAGGTATGTTAAAACGTATGTATGTATGT. Deletion right flank: TTGGATTGAATCTGCATGGAATTATTTGAT. Validation: gk3192 passed by CGH with slightly low log2 scores. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W03D8.6, C11E4.3, F13D12.4, W03D8.5, F48E2.4, F49E2.7, F48E2.9, C11E4.1, C11E4.2, C11E4.17, C11E4.15, C11E4.14, C11E4.10, C11E4.9, C38C5.2. The gk3108 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: CATTTGGCTGGGTCAACTTT. External right primer: TATTGTAAGGATCTGCCCCG. Internal left primer: TTGCACCAAAATGATGGAAA. Internal right primer: CTCAGACAACAAGATCCGCA. Internal WT amplicon: 2496 bp. Deletion size: 1960 bp. Deletion left flank: GTAGGAGTTGTTGCGTGGAAGGTCACACGC. Deletion right flank: AAATTGCGAACACAATTTTGAAATTCAAAA. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y38F1A.1. External left primer: GCACCCCATTGTTGAACTTT. External right primer: ATGCCACGTAGCAAAAATCC. Internal left primer: TTCCCAAACACAAGAATCCC. Internal right primer: GCTAAGAGATATCGCGCGTC. Internal WT amplicon: 1616 bp. Deletion size: 493 bp. Deletion left flank: CTTCCCGGTGATTGTAAGGTCTTTAGACAT. Deletion right flank: TGTTTTTTATGTTGTTGTTTTTAAAATTGT. Validation: gk3300 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3265) in F40H3.2, detectable by PCR using the following primers. External left primer: TTCCATTCGTGTTTCGATGA. External right primer: AGTTATCCCCACCGCTTTTT. Internal left primer: AACCGGAAAAATTCCAAACC. Internal right primer: CTTCTTCGCCGTTTCACTTC. Internal WT amplicon: 2013 bp. Deletion size: 819 bp. Deletion left flank: GAGCCGAGAAGTCACCGGCCTGAAAACGTT. Deletion right flank: GCTAGAGGAGCAGCAGCAATACAGCTCATC. Validation: gk3265 passed by CGH. Other deletions (gkDf40, gk3266) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3200) in F38B7.1, detectable by PCR using the following primers. External left primer: TTTATCAGGCAATCCCAACC. External right primer: CGTATGCCCTCATGTTTGTG. Internal left primer: AGTTCGAACAGCTGCCAAAT. Internal right primer: GCGACAAAGCCAATTAGTCC. Internal WT amplicon: 1490 bp. Deletion size: 540 bp. Deletion left flank: TCCAAGAATTTCAATGTATACTTCTCACAT. Deletion right flank: CCACTTTCAACCGTCGAAACAAAGGGATTC. Validation: No CGH probes for gk3200. Other deletions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3164) in W07G1.3, detectable by PCR using the following primers. External left primer: CAGGCTGATCCATTACGGTT. External right primer: TTCCCTGTCTCCAAAAATGC. Internal left primer: CGTATCAACTGGAATCGGGT. Internal right primer: GCTCCGAGCTCTCCCTATTT. Internal WT amplicon: 2525 bp. Deletion size: 1275 bp. Deletion left flank: AGTGTTTCAATTCGGCTTGATCTACGTAGA. Deletion right flank: ATGAATAGACCACGACCATTTTCTGGGCGG. Validation: gk3164 passed by CGH. Other deletions (gk3267, gkDf41) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3168) in Y41D4B.8, detectable by PCR using the following primers. External left primer: CTTTTTCAGGCCAATTCCAA. External right primer: TCGTTGCACCTCTGATTACG. Internal left primer: CGGAGTCGTTTGCAGGTATT. Internal right primer: TGGAAGCTTCTACCTCGGAA. Internal WT amplicon: 1944 bp. Deletion size: 626 bp. Deletion left flank: AAAGTTCTTCTCAAAGAGTTTAAGCTTGTT. Deletion right flank: CAGACATTACCTACCTACCATCTGGTGATT. Insertion Sequence: GT. Validation: gk3168 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3194) in B0207.7, detectable by PCR using the following primers. External left primer: AGCATTAAAATCAGGGCACG. External right primer: GGTACACCCAGCTTCGACAT. Internal left primer: ACGGGCCTTTCATAACTTCC. Internal right primer: GGTGCAACCCAAAGGTTCTA. Internal WT amplicon: 2021 bp. Deletion size: 771 bp. Deletion left flank: AAAAAACTATGAATTCAATATTCCCGAGTA. Deletion right flank: CGTGCTACAGTAATTGCTGGTGCCCATGAA. Validation: gk3194 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous sterile deletion chromosome (gk3086 in F45H11.2) balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3086 homozygotes (late larval arrest or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGCGATGAGACCCATCTATT. External right primer: CGACAATGTGGTCGTTTTTG. Internal left primer: CTTGTGTCGATTTACGGGCT. Internal right primer: ATGGAAGAGTGCAAGTTCGG. Internal WT amplicon: 1685 bp. Deletion size: 1145 bp. Deletion left flank: ATTCTCAGGATTTTTTGTTACCATAGTGTT. Deletion right flank: TCTTACAAATACTGCGCGTTCTGATCTCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23H12.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3118 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CATCCTTTCCTGCACCTCAT. External right primer: CGCCGTACAATTGTGTTGAC. Internal left primer: CTTACCCAGACCTGCCAGAA. Internal right primer: TTGAAGGAATGTCGGGAGTT. Internal WT amplicon: 1579 bp. Deletion size: 310 bp. Deletion left flank: GATACTTCCACGACTACAATATCTCCAAAA. Deletion right flank: ACAATCCATTGATCATCTAATCTTAACTCT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C35C5.6. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1279 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTCCGATGAGCACGTTAGG. External right primer: GCGAGAAGAGCATTTTGACC. Internal left primer: CCGTCAATCAGAGAAGAGCC. Internal right primer: CCTTCGACAATAAAGGCCAA. Internal WT amplicon: 3388 bp. Deletion size: 1808 bp. Deletion left flank: CTTGCAATATATTTGGGCTACACAATGAGT. Deletion right flank: CTTCATTCCAACCGGAACAATTCATATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC376.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2803 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATAAGGCCCGAATAGCTTGG. External right primer: AGACCAAAACGGCAATTCAT. Internal left primer: TTTTTCATTAGAACACAAACAACAC. Internal right primer: CGAGATTGACAACAAGTGTGC. Internal WT amplicon: 3073 bp. Deletion size: 1600 bp. Deletion left flank: AAAAAATCCGTTACATTCACGAAAATTGAA. Deletion right flank: TTTGCATACAAACAATCTTCAGAAATCGGT. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3195) in T10D4.6, detectable by PCR using the following primers. External left primer: AGTCGGAGGATCTACGGAAAA. External right primer: CGCATAAGCAAATGAGAAAGC. Internal left primer: AGCCGTATCGCAGATCTTGT. Internal right primer: TCTGTCTCCAATTCGAACCC. Internal WT amplicon: 1669 bp. Deletion size: 962 bp. Deletion left flank: AGATCTGAGAACTTACCTTCAACATCTGCT. Deletion right flank: GTCGAGCTTCATGCTGTGATGAATGTTTTC. Insertion Sequence: T. Validation: gk3195 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3170) in F39B2.1 and F39B2.12, detectable by PCR using the following primers. External left primer: CCGGTAGTAGCTTTCCCCTC. External right primer: AAGTCGCATAAGTCCATCGG. Internal left primer: ATATCAACCATCCAGCCAGC. Internal right primer: CGTCAGAATGGTACACAGCG. Internal WT amplicon: 2358 bp. Deletion size: 1150 bp. Deletion left flank: GCGGTGCTTCGAATTTATTTATAACATTCA. Deletion right flank: CGCTCGTCACCACAGCGGTGAGAAGGTGCT. Validation: gk3170 passed by CGH. Other deletion (gkDf39) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3196) in F53C11.3, detectable by PCR using the following primers. External left primer: CATTTTGTCGACATTGCCAC. External right primer: TGCTCTCATTATTGCCCTCC. Internal left primer: ACCACCACTTCTGCGTCTCT. Internal right primer: TTTCCTCCCATTTCTCGTTG. Internal WT amplicon: 1586 bp. Deletion size: 858 bp. Deletion left flank: CTTGGAGCAAGTGTGGCCATTGCTGCAAGA. Deletion right flank: CGTTTTTTAACTTTTGATTATTTTACTGCA. Validation: gk3196 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3197) in C15H11.4, detectable by PCR using the following primers. External left primer: AATGTCCTCATTCAGACGGC. External right primer: TTGACCCCGCTGGATACTAC. Internal left primer: CCGAGAAGGAGAAACTGACG. Internal right primer: GCCATTGAGGCTCTTCAGAC. Internal WT amplicon: 1991 bp. Deletion size: 1301 bp. Deletion left flank: AATAGAGAAATTATTGTAGCTGCGCTGGCA. Deletion right flank: ACTAAAAAATAAATAACAGGGATTGCGAAA. Validation: gk3197 passed by CGH. Other deletion (gkDf30) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3198) in C01B12.2, detectable by PCR using the following primers. External left primer: TCAAAAATTTGCGAAACGTG. External right primer: AGGGAGTGAGCGAGAAACAA. Internal left primer: CTACATTGGTCCGACCCCTA. Internal right primer: ATGAGCTTTGCCCTGAAAGA. Internal WT amplicon: 1379 bp. Deletion size: 941 bp. Deletion left flank: AAGTTAAGCAATTTACTCAAATTATTTCAG. Deletion right flank: TGAATTTCGCAATAAAACTTTTTGGAAATT. Insertion Sequence: ATTTTT. Validation: gk3198 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3123) in C03G5.7, detectable by PCR using the following primers. External left primer: CCTTCTATTCCCCCAGAGGCTTAC. External right primer: CGTTTGTCACCACTTCCCTATCC. Internal left primer: GGGTCGTGTGACGAATTGCGC. Internal right primer: AACCGTAATAGAAGACAGGGAGGTG. Internal WT amplicon: 3658 bp. Deletion size: 1513 bp. Deletion left flank: ACAGAAAAAAAAACACAAAAAACCAAAACT. Deletion right flank: TGGGTTAGTATTTCAAGAAAATAATTTTTT. Validation: gk3123 passed by CGH. Other deletion (gk3259) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3122) in C44B7.9, detectable by PCR using the following primers. External left primer: CCAGTTAGGTGTTCGCATGTT. External right primer: ACTGGTTTCAGTGGGAACCTT. Internal left primer: TTGTGGTAAAACAATCGAGCC. Internal right primer: ACTTGGTTGCAAAAACGAAGA. Internal WT amplicon: 2135 bp. Deletion size: 439 bp. Deletion left flank: TCATGTATGGCCTCTGTGGTACGTAGAATA. Deletion right flank: GTATTCTTGCATTAACTGGTTACGTGACAT. Validation: gk3122 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3199) in Y59A8B.13, detectable by PCR using the following primers. External left primer: ATTCGCTGGAAACTTGGAAAT. External right primer: AAATGGCTGAAAAGCCAAAAT. Internal left primer: ACCTCTGAAATCCACCGAAAT. Internal right primer: GAAAACGCTGAAAATGTTGGA. Internal WT amplicon: 1267 bp. Deletion size: 193 bp. Deletion left flank: TTTTTTTTCTATTTTTGGCGGGAAACTGAA. Deletion right flank: TATGAAAATTGTCGAAAAATTTCCACATTT. Validation: No CGH probes for gk3199. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T28F12.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3507 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGAAGCCAACACAAGAATCA. External right primer: TCGGTGTGCAAATCCAATTA. Internal left primer: ATCATCTTGCCGAAATCTGG. Internal right primer: TTTGACGTTCAGTTTGCTGG. Internal WT amplicon: 2229 bp. Deletion size: 628 bp. Deletion left flank: AGGCTTCCAATTTATTTTTTACACGCTTTT. Deletion right flank: GCGATAAATTTATCTGCAGGTCCTTTGAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08G9.2. Apparent homozygous lethal deletion chromosome balanced by translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, vulvaless nT1 homozygotes, and gk3384 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCACAAGTTGGTACTGGGAGG. External right primer: CCATGCGAATTTTTGAACTGT. Internal left primer: ACAAGACCGTATGGGCAAAG. Internal right primer: ACCAATTTCATCTTGCCCTG. Internal WT amplicon: 1980 bp. Deletion size: 466 bp. Deletion left flank: GTCTGATCGTAGTTTCCATTTCTACTGCAT. Deletion right flank: GGTTTGATGTACATTCTACACGTCGAAGTG. Insertion Sequence: TTCTACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59B10.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3366 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATCCATTTGAATCCTCGCTG. External right primer: AGCTTCCGATACAATGCCAC. Internal left primer: GTACCGGTGATTCGCTTTGT. Internal right primer: GAGCCGATCGTAAACCACAT. Internal WT amplicon: 1767 bp. Deletion size: 761 bp. Deletion left flank: TTACAAGATGGATTGAAGCATTTTTCAAGT. Deletion right flank: CGAATATCGGATGGATTGATTATTCGGCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3281) in C14C10.4, detectable by PCR using the following primers. External left primer: TAACTCATTAACGTCGGTGGC. External right primer: TGTGTAATTACCGTACCCGGA. Internal left primer: CATCAGATCAAGGGCTGGTAA. Internal right primer: GGGTTAAGTAGAAACGGCCTG. Internal WT amplicon: 1785 bp. Deletion size: 540 bp. Deletion left flank: GCGTTTCTCTTGTTGATGGAGCAAACATAA. Deletion right flank: AGATTAAAAGCATCAAATTGTCCATTTTCA. Insertion Sequence: ATTTTGCAAAC. Validation: gk3281 passed by CGH. Other deletions (gkDf44, gk3282) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F12F6.5. Apparent homozygous lethal deletion chromosome balanced by translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, vulvaless nT1 homozygotes, and gk3385 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAGTCACTTGAAGCATCAGAAAA. External right primer: TCAGAATCAAGCTTCTTTGTTGAG. Internal left primer: TCAAAAACCAATTTCGTTAGAGC. Internal right primer: TGATTTTTATTGCCTTTTTCCAA. Internal WT amplicon: 2179 bp. Deletion size: 980 bp. Deletion left flank: TATGTAGAAGCAACTGGAGAAGAAATTCCA. Deletion right flank: TTCAAAAATAGTTCATTATCATCCGAAGGA. Insertion Sequence: TAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807