More Fields
Strain Species Genotype
VC3095 C. elegans R04B5.5(gk3180) V. Show Description
R04B5.5. External left primer: CTGGAAAACTTGATCTATCGGG. External right primer: CCATTGACTGACTTTTTCTCCC. Internal left primer: AGAAGAGATAAGCGCACGGA. Internal right primer: CATGTTTCCTCTCGGCATTT. Internal WT amplicon: 1679 bp. Deletion size: 247 bp. Deletion left flank: ATTCCAAAGCCTGGGCCAAATCAGGTGCTT. Deletion right flank: TGTGAGCACTGCAAAACTGGAAGATACAAT. Validation: gk3180 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3103 C. elegans F38E9.5(gk3181) X. Show Description
This strain is homozygous for a deletion (gk3181) in F38E9.5, detectable by PCR using the following primers. External left primer: GAGCAGCCAAAGGCTCATAC. External right primer: GGCTAGTCTCGGACTGGTTG. Internal left primer: GTGCTTCATTCTGTTCCGGT. Internal right primer: TTCCAATGATTCGAGGGTTC. Internal WT amplicon: 1591 bp. Deletion size: approximately 500 bp. Validation: gk3181 passed by CGH. Deleted probe: GAAGAAAGCATTTAGAAGTTATAGCTTTGGACTAGCATCCGTTTTAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3106 C. elegans cpn-3(ok3766) I. Show Description
F28H1.2. External left primer: TTTTTAAGTCCGGCAAATGG. External right primer: ATGTTTTTGCTGTGAAGCCC. Internal left primer: AGGCGCACACTATTTTTCGT. Internal right primer: CCGGCGTATAGAAACCAGAG. Internal WT amplicon: 1306 bp. Deletion size: 543 bp. Deletion left flank: GATCAAGAAGCTCTCCGGTGAGAACATCTC. Deletion right flank: ACAAAGCTCGATTCTTCTCTCTTTTCTGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3108 C. elegans mel-46(ok3760) IV. Show Description
T06A10.1. External left primer: CAGCTTGTCTCCCGAATCTC. External right primer: AGGCCAACAATAGCCAAAAA. Internal left primer: CTCGTCTTTCTCGCGTTTTC. Internal right primer: TTTGAGCAATTCTGGACTAAAAA. Internal WT amplicon: 1270 bp. Deletion size: 448 bp. Deletion left flank: GACGTGAAGGCTTCACGAATGTGTTGGAGC. Deletion right flank: ACAGAAAAATGGGCGGGGCACAGTTTTGCA. Insertion Sequence: AGAAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3110 C. elegans ztf-22(gk3235) II. Show Description
Y48C3A.4. External left primer: CCATTTCTAACATAGGGGCTTTATT. External right primer: TATTTCGGCATTTTACCAAATTTTA. Internal left primer: TGTGAAAAAGAGCCAAATTGATAA. Internal right primer: GAGGTTTTTCCTGAAAATTGAAAA. Internal WT amplicon: 1190 bp. Deletion size: 369 bp. Deletion left flank: TTTGGAGCAACGTGTTTAAAGTGTTGAAGA. Deletion right flank: GGTTGGCAAGTGTTAAAATGTCCAAATATC. Validation: gk3235 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3111 C. elegans gpb-2(ok3691)/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
F52A8.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3691 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATAATCAAGCCCAAATGCG. External right primer: CCAACAACTTGGGTTATGGC. Internal left primer: TTCCATCAGGAGAAGTTCGG. Internal right primer: ATCGCTTGCGGGTAAGATTT. Internal WT amplicon: 1318 bp. Deletion size: 393 bp. Deletion left flank: TTGTCACTTCTTCTCGAGGAGTACACTAGC. Deletion right flank: ACATGTTGAATCTCCACTTCCAGTTAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3112 C. elegans C41A3.1(ok3769) X. Show Description
C41A3.1. External left primer: AAGCTTGGCGATCAGGTAGA. External right primer: CAGTTGACTCAATTTCCGCA. Internal left primer: ACGGCATAATACCGAACCAG. Internal right primer: TGCTCGTCAACAATGTTCGT. Internal WT amplicon: 1141 bp. Deletion size: 689 bp. Deletion left flank: CTCAATCCGACTCTGCGATGGAGGATATTT. Deletion right flank: GATCTGCCAGCTATTTGCTTGTGGGTTTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3113 C. elegans tax-4(ok3771) III. Show Description
ZC84.2. External left primer: GCGGTTCGGATACGAAAATA. External right primer: GTGCCTGCAAGGAGACCTAC. Internal left primer: GCAAATTATACACAGGATCCATCTAC. Internal right primer: CCTGCTCCAAAAGTAAGCCA. Internal WT amplicon: 1290 bp. Deletion size: 442 bp. Deletion left flank: ACTTGGGATGGTCGAAATATTGGCATTTTC. Deletion right flank: AGAGCTTACCCGAGTGAGTTTTTAGATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3115 C. elegans srgp-1(gk3182) IV. Show Description
F12F6.5. External left primer: GAAGTCACTTGAAGCATCAGAAAA. External right primer: TCAGAATCAAGCTTCTTTGTTGAG. Internal left primer: TCAAAAACCAATTTCGTTAGAGC. Internal right primer: TGATTTTTATTGCCTTTTTCCAA. Internal WT amplicon: 2179 bp. Deletion size: 470 bp. Deletion left flank: AATGGAAACCTCATGGAAAGACTCGAAGCA. Deletion right flank: TATTCCCAATATTCATGTTCGAACAGTTTT. Insertion Sequence: CTCGATATTCTCTTCGTAATCAGGGATTATTCCGAGTTTCTGGTTCACAATCGGAAATT AATCGATTCAGAGAAGCTTATGAAAGAGGAGAGGATCTATTCCAGTATCTGGGAGGATC TATTCCAGTATCTATTCCAG. Validation: gk3182 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3116 C. elegans fbxb-101(ok3765) I. Show Description
Y63D3A.3. External left primer: TCGCCCCAAAAATAAGTGAC. External right primer: TCCGCCTTCAACTAAACCAC. Internal left primer: CACATGGGGATTGAGGTCAT. Internal right primer: CTTTGCCGCATGCAAAAT. Internal WT amplicon: 1172 bp. Deletion size: 467 bp. Deletion left flank: TAAAATGAGAACTTTGAAGCTTAGGTACCA. Deletion right flank: AAGCTATGAACTTATATACTACATATTTTT. Insertion Sequence: CGAAAGAAAGAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3118 C. elegans M05B5.2(ok3716)/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
M05B5.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3716 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGGCAGTTTCAGGGTTCAAA. External right primer: CTAAGGCACTTGGCTTTTGC. Internal left primer: GGGAGGAAATTTCAAAAATGA. Internal right primer: AAAAATTTAACGCGTCGCTG. Internal WT amplicon: 1169 bp. Deletion size: 569 bp. Deletion left flank: GGAATGGCAAATTGACAGCATGAGGGTTTC. Deletion right flank: TTTTTGGGATGTTCAGCGACGCGTTAAATT. Insertion Sequence: TTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3119 C. elegans +/mT1 II; C07A9.4(ok3733)/mT1 [dpy-10(e128)] III. Show Description
C07A9.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3733 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTGCGATGTTTGAAAACGAA. External right primer: TTTCGGGTTGCCGAATAATA. Internal left primer: TCTTCTATTGGCAATGCAACC. Internal right primer: CTGTGAAGGTGGTGGTTACG. Internal WT amplicon: 1278 bp. Deletion size: 537 bp. Deletion left flank: CAAAATGCCAAAAATGCTAGAGCAACAAGA. Deletion right flank: ATAACACCAACATGTAGATGACCCCGGTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3121 C. elegans T07D10.1(gk3249) I; F59E12.3(gk3183) II; Y116A8C.5(gk3250) IV; unc-83(gk3251) gkDf35 V; gkDf32 X. Show Description
This strain is homozygous for a deletion (gk3183) in F59E12.3, detectable by PCR using the following primers. External left primer: GCATGCAAGAAATGCAAGAA. External right primer: TGAAGTCGCGCACAAATAAG. Internal left primer: TCACAAATGGAAACGTGTGG. Internal right primer: CAACGAGGCCAAAGTGATTT. Internal WT amplicon: 1320 bp. Deletion size: 585 bp. Deletion left flank: GAACTGACAACAAGTATCTCAACCTACACG. Deletion right flank: CCCCCGTTTATGCGCCCAGGGCATCCCACA. Validation: gk3183 passed by CGH. Other deletions (gkDf32, gkDf35, gk3249, gk3250, gk3251) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3123 C. elegans kin-21(gk3184) IV. Show Description
This strain is homozygous for a deletion (gk3184) in W08D2.8, detectable by PCR using the following primers. External left primer: TGAACCATTTCACTAGCCCC. External right primer: GCTCTATCCGTTCTTCGTGC. Internal left primer: AATGATGTTCGGAAAGGCTG. Internal right primer: CATTCGGGAGTAGATGCGAT. Internal WT amplicon: 2184 bp. Deletion size: 652 bp. Deletion left flank: ATTCTCCAAAGGATTATTCAATGAGAAAAC. Deletion right flank: CTAAGTGAACTCATGTAATCAACAAAATAG. Validation: gk3184 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3124 C. elegans Y74C9A.3(gk3247) I; C03C10.2(gk3027) III; gkDf34 V. Show Description
This strain is homozygous for a deletion (gk3027) in C03C10.2, detectable by PCR using the following primers. External left primer: ACTACCGTGCTCTTGGCACT. External right primer: TCAACCTCACCCCATTTCTC. Internal left primer: GCATGTGTCTACCATCCACG. Internal right primer: GCAGTGATTTCGGGCTGTAT. Internal WT amplicon: 2385 bp. Deletion size: 826 bp. Deletion left flank: ATGCATTGAAAGATATTCATGATATGGGAT. Deletion right flank: TCAAAACCGAATCCGGTGTATGCATTCCAT. Validation: gk3027 passed by CGH. Other deletions (gk3247, gkDf34) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3125 C. elegans ccch-1&F38B7.12(gk3237) V; gkDf32 X. Show Description
This strain is homozygous for a deletion (gk3237) in F38B7.1, detectable by PCR using the following primers. External left primer: TTTATCAGGCAATCCCAACC. External right primer: CGTATGCCCTCATGTTTGTG. Internal left primer: AGTTCGAACAGCTGCCAAAT. Internal right primer: GCGACAAAGCCAATTAGTCC. Internal WT amplicon: 1490 bp. Deletion size: 243 bp. Deletion left flank: TCCAAGAATTTCAATGTATACTTCTCACAT. Deletion right flank: GAAAAATTATATCCTTTTTACTTAAATAAC. Validation: No CGH probes for gk3237. Other deletion (gkDf32) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3126 C. elegans F42A10.3(gk3185) III. Show Description
This strain is homozygous for a deletion (gk3185) in F42A10.3, detectable by PCR using the following primers. External left primer: ATCAAATCTGGTGCCATTCAG. External right primer: AAACAAACATGTGAAAAGCGG. Internal left primer: GGGAAGTGAACACTGATTGTGA. Internal right primer: TTTCTAGAACTTTCGATCCCGA. Internal WT amplicon: 1235 bp. Deletion size: 839 bp. Deletion left flank: GGGAAGTGAACACTGATTGTGAAGAGATAT. Deletion right flank: GTCTGATGTTTATACTCTCTCCCTTGGATT. Insertion Sequence: TTGAAGA. Validation: gk3185 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3127 C. elegans Y41D4A.5(gk3186) IV. Show Description
This strain is homozygous for a deletion (gk3186) in Y41D4A.5, detectable by PCR using the following primers. External left primer: TTTTTATCAGGTGGAAAATGGG. External right primer: GTTATTCGTGTGTTGCCTTGAA. Internal left primer: CGGAGAAAAATTGTGTGGAAA. Internal right primer: TTTCTTCATTTCTCAGCCGAA. Internal WT amplicon: 784 bp. Deletion size: 232 bp. Deletion left flank: AATTCGTGTTTTTTAGCCTAAATTTTCGCT. Deletion right flank: TCAAGTTTTTCAGTGAAAAATTTGAAAAAA. Validation: gk3186 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3130 C. elegans poml-3(ok3772) I. Show Description
E01A2.10. External left primer: CAAAACCCAGTGCTCTGTCA. External right primer: AGGCAAGCATGTCCTCAAAT. Internal left primer: TGAACAAAACCCAAGTTCCC. Internal right primer: TCGGCAAATTGATAAAATGCT. Internal WT amplicon: 1304 bp. Deletion size: 528 bp. Deletion left flank: CATCTTTCTTTATCCAATGAGATATTCCAT. Deletion right flank: AACCGCCTCTCCTGGGCACGTGTTCTCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3132 C. elegans crml-1(gk3284) I; gkDf32 X. Show Description
This strain is homozygous for a deletion (gk3284) in K07G5.1, detectable by PCR using the following primers. External left primer: TTGCCTTTTGTAGATGTGATAGGA. External right primer: TAATCCGAAAGTCACAAAATCTGA. Internal left primer: GTCCCCACAGATGACGTTCT. Internal right primer: CCTTGCATCAGCTTTTCACA. Internal WT amplicon: 1884 bp. Deletion size: 608 bp. Deletion left flank: TTGAGCTCTTCGAGACACTGAAAATGAGAT. Deletion right flank: CTAGAAAAATTTAATTTTAAGTCAAGCATA. Validation: gk3284 passed by CGH. Other deletion (gkDf32) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3133 C. elegans hlh-33(gk3285) III; gkDf32 X. Show Description
This strain is homozygous for a deletion (gk3285) in Y39A3CR.6, detectable by PCR using the following primers. External left primer: TGCATTTTCCAAAAGTTTAAATCA. External right primer: ACGACATTTTGTTTACAAGGAACA. Internal left primer: TCGATCAAAAACTTGGACAGC. Internal right primer: AGTGTGCATTTGATTGTCACG. Internal WT amplicon: 1494 bp. Deletion size: 353 bp. Deletion left flank: AACCACCGCTGCTCTCCGACCCGCTCGTCC. Deletion right flank: TTAGAAAAAATGGGAAAAAAAATTCTCAAA. Validation: gk3285 passed by CGH. Other deletion (gkDf32) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3134 C. elegans Y53F4B.3(gk3286) II; gkDf49 Y51A2B.6(gk3540) V. Show Description
This strain is homozygous for a deletion (gk3286) in Y53F4B.3, detectable by PCR using the following primers. External left primer: GAAACCGGTCTCAACACGAT. External right primer: TTGGTGTCATCGGTCAAAAA. Internal left primer: TCGGCAAATTTATCTCTCGC. Internal right primer: GCACTTTCTCGTCTGCCTTT. Internal WT amplicon: 807 bp. Deletion size: 509 bp. Deletion left flank: CGATTTCGAGAACGGTCTCCGGAAGCTCTT. Deletion right flank: TCCTCCTCGCTCATTTGCGCGATCGGAGCG. Insertion Sequence: TCATCT. Validation: gk3286 passed by CGH. Other deletion (gk3540) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3135 C. elegans F11E6.1(gk3287) IV. Show Description
F11E6.1. External left primer: AAAAACGTTCTAAGGCTAAATTGCT. External right primer: AAATTCAGCACAATAGAGAATCCTG. Internal left primer: CGGTTTTAATGGCTCCAAAA. Internal right primer: CTTGAGCAGTTCGGTTGACA. Internal WT amplicon: 2099 bp. Deletion size: 464 bp. Deletion left flank: TTTTAAAAGATTTTTCGAAGCCTATTCATC. Deletion right flank: ATTCATCATGGCCCATTAATGGGTGACTGG. Validation: gk3287 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3138 C. elegans ric-8(ok98) IV/nT1 [qIs51] (IV;V). Show Description
Y69A2AR.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok98 homozygotes (paralyzed, sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTGTCTTTACATCCGTCATTTCTG. External right primer: CATGATCAATAGCCTTCACATCTC. Internal left primer: AAGCGTCCAAGGCACATATCG. Internal right primer: CGTCTTCAACGCCTCGGTAG. Internal WT amplicon: 3370 bp. Deletion size: approximately 1480 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3139 C. elegans Y53C12B.1(ok1245)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Y53C12B.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1245 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AGCTGCTAGTGGCCATGTTT. External right primer: GAAATGGGTGGGCACTTAAA. Internal left primer: GCTAACATCTTGCTTTGCCC. Internal right primer: CGCGTAGAATTAAACGGGAA. Internal WT amplicon: 3125 bp. Deletion size: 1458 bp. Deletion left flank: CAGTATGCGCATCAATGGAACATTCACAAT. Deletion right flank: TTTCTTGAGTTTCTGTTTCATGAATACTCA. Insertion Sequence: TTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3146 C. elegans fln-1(gk3291) IV; cdf-1(gk3543) X. Show Description
This strain is homozygous for a deletion (gk2191) in Y66H1B.2, detectable by PCR using the following primers. External left primer: AGCGAGTCCAGTGTCGATTT. External right primer: ACGTGAAGCTGGAGAGCATT. Internal left primer: GACATCCTTAATCCGGACCC. Internal right primer: AGAACCAGGAGTCTACGCGA. Internal WT amplicon: 1864 bp. Deletion size: 1225 bp. Deletion left flank: ATGGATTAGATACTTCTCTTCTAACTTTAT. Deletion right flank: CATTTTTATTTCCTAGTGAATATTACCTTA. Insertion Sequence: TTTTCCCATATTTCAGATATTACTACAATACGCTCGGTA. Validation: gk3291 passed by CGH. Other deletion (gk3543) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3149 C. elegans crh-2(gk3293) II. Show Description
C27D6.4. External left primer: ATGTGATGGAGTGGGTGGTT. External right primer: GTTGTACCGCCAACGTCTTT. Internal left primer: ACACGAAAGGGGGAGAAAAT. Internal right primer: GATTGGACGGATCAGAAGGA. Internal WT amplicon: 1448 bp. Deletion size: 987 bp. Deletion left flank: AAATGGTTTACCCTAGGGAGAAAATGGTTT. Deletion right flank: TGAAATGTTTCATTATTACTTTTAGAAAAA. Insertion Sequence: GTGTTTCATTATATTTCATTATTT. Validation: gk3293 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3150 C. elegans ekl-1(ok1197) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F22D6.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1197 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCGTACACATTCATCGTTGC. External right primer: CGGTATGTGTGGATGTCGAG. Internal left primer: GCAATGCTCTTCTCTGTCCC. Internal right primer: GAGATCAATTTGGCCATTCG. Internal WT amplicon: 2672 bp. Deletion size: 1008 bp. Deletion left flank: ATTTTTTAAAGAACTGGAAGAAATGCGAAT. Deletion right flank: TGTGAGTGAATATAACCAAAACACCAATGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3151 C. elegans cpf-1(ok1220)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F28C6.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1220 homozygotes (sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTCTTCCGAGTGAACTGGCT. External right primer: AGCACACATGCAGGTTGAAA. Internal left primer: CCATTTGAAGCAGCCAAGAT. Internal right primer: TACGATTTGAGGGGAGATCG. Internal WT amplicon: 2198 bp. Deletion size: 1785 bp. Deletion left flank: CTTTCTGTCGGAATTGCGAGCATCCCACGA. Deletion right flank: TTAAACTTATATTAAAGGCGCATGCCGTTT. Insertion Sequence: ACTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3152 C. elegans spp-8(ok3758) IV. Show Description
C28C12.5. External left primer: TGTGAATCATGCAAATCGGT. External right primer: TTCACTGCCATTGGTACGAG. Internal left primer: CGCCTACAAACTTGCTCCAT. Internal right primer: CATCTCACCATAGTTCCAAGAGC. Internal WT amplicon: 1196 bp. Deletion size: 699 bp. Deletion left flank: GAATTTTCAGGCTGACACCTCCGCTGTATG. Deletion right flank: TTTATATTTTCAGCAAGGAACAGCTGATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3153 C. elegans sco-1(ok3770)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C01F1.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3770 homozygotes (mid- to late-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCGATGATGTGCGAATTTGT. External right primer: CAATCGAACGCCTTGAAAAT. Internal left primer: CAAATCCATGATTTTCACTCCA. Internal right primer: AAGCTGAGCAATGGTTTTCTTT. Internal WT amplicon: 1241 bp. Deletion size: 653 bp. Deletion left flank: GGACGCTGGCATCAGCCGCACGGTTTTCAG. Deletion right flank: GGAACCACAGAGCAAGTTAATAAAGTTGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3162 C. elegans +/szT1 [lon-2(e678)] I; dnj-14&glit-1(ok237)/szT1 X. Show Description
F55D10.3, K02G10.8. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok237 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGTGTTCGGTAAGCATTGGG. External right primer: AAAGTGTGTTCCGTCCTTGG. Internal left primer: CTGCCGTGGAATCTACCTGT. Internal right primer: GCAGTCGAACAACCACTTCA. Internal WT amplicon: 3216 bp. Deletion size: 2229 bp. Deletion left flank: TTTTGAGAAGGCGGTGGAGGCATGGCAATC. Deletion right flank: TTCGCTAAAAAATTGAGCCAATTTATTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3164 C. elegans ztf-22(gk3296) II. Show Description
Y48C3A.4. External left primer: CCATTTCTAACATAGGGGCTTTATT. External right primer: TATTTCGGCATTTTACCAAATTTTA. Internal left primer: TGTGAAAAAGAGCCAAATTGATAA. Internal right primer: GAGGTTTTTCCTGAAAATTGAAAA. Internal WT amplicon: 1190 bp. Deletion size: 407 bp. Deletion left flank: CAGAGGCGTTGTTGTTGGTGAGTGACTAAT. Deletion right flank: TTTGTAAATTCTGAAAAATTGCCACTTTTA. Validation: gk3296 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3166 C. elegans +/mT1 II; arx-3(ok1122)/mT1 [dpy-10(e128)] III. Show Description
Y79H2A.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1122 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTTGGAAATCGTTTTGGCAT. External right primer: TTAAAACTCCGGCCAATCAG. Internal left primer: AACCACTTTTCCTCGTCCCT. Internal right primer: TTTTCGTGGCAAATTCCTTC. Internal WT amplicon: 2630 bp. Deletion size: 1688 bp. Deletion left flank: TTTTCCACCGATTTTTAATGTTTTCGATGT. Deletion right flank: GTTTTTGCGGTTAAGCCGGTCGAAATTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3167 C. elegans +/szT1 [lon-2(e678)] I; hlh-8(ok1248)/szT1 X. Show Description
C02B8.4. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1248 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCCGCGGTAATTTTTCAAC. External right primer: GCATCAGACAGTGTGGAGGA. Internal left primer: CCTTTCTTTTCACCGAGCAG. Internal right primer: GAGGGGGAATATGTGCTGAA. Internal WT amplicon: 3385 bp. Deletion size: 2391 bp. Deletion left flank: GAGCATGTGCCAACAGACGGGAACGTCAAA. Deletion right flank: AACATGTTCATAAACTTAGCATTTTCCGCT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3169 C. elegans har-1(gk3124) III. Show Description
C16C10.11. External left primer: TTGGCTGCTTGTATCGATTG. External right primer: CGAAAGACTGCGAGGAAAAC. Internal left primer: GTTTCCCTGTCGTATTTCGC. Internal right primer: ATCATTGAATCCGTTGCACA. Internal WT amplicon: 855 bp. Deletion size: 260 bp. Deletion left flank: CAGACAAGTGATTTTTGAACTATTTCGTCA. Deletion right flank: TCCTTCGCCGCTCCACCACCAAGACCAGGT. Validation: gk3124 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3170 C. elegans B0228.8(gk3093) II. Show Description
B0228.8. External left primer: CATACATAGAGTGCCCAAGAGATG. External right primer: ATCGGTTTTTCAAATTTTGTCATT. Internal left primer: ATTTGTTTGCTTCGGAACAGAT. Internal right primer: TTTTTGGAGCTGTTTTGGAAAT. Internal WT amplicon: 1734 bp. Deletion size: 306 bp. Deletion left flank: CAACTTCTGCATAATAATTGCTCAAGAATG. Deletion right flank: CAATACTTATTGATAAGAAAAAGACAAATA. Validation: gk3093 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3177 C. elegans R04B5.5(gk3064) V/nT1 [qIs51] (IV;V). Show Description
R04B5.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3064 homozygotes (mid- to late-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGGAAAACTTGATCTATCGGG. External right primer: CCATTGACTGACTTTTTCTCCC. Internal left primer: AGAAGAGATAAGCGCACGGA. Internal right primer: CATGTTTCCTCTCGGCATTT. Internal WT amplicon: 1679 bp. Deletion size: 894 bp. Deletion left flank: AATGGGACACCGAGTTCTTGTTCTCGGAGC. Deletion right flank: TATTAAAATGCCGAGAGGAAACATGATGTC. Insertion Sequence: AGGACCAATTGGAGTCTTGAATCTTCTTACTGCTAAAGCGATAGGTGCATCAAAAGTAG TAATCACTGATTTGAACGACGAGAGACTTGCTCTTGCACGCCTATTAGNAGCTGATGCT ACAATCAATGTTATGTAATAAAGAAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3179 C. elegans pis-1(ok3720) IV. Show Description
T13F2.3. Unc. External left primer: GCAAGCTTCTCGGTAAAACG. External right primer: GCCCAGCCAATATATTCCAA. Internal left primer: ATTGCTGATTTGGGGACATC. Internal right primer: TCTAATTTCCTGTCAGATTCAGG. Internal WT amplicon: 1277 bp. Deletion size: 588 bp. Deletion left flank: TGTAGTACCAGATGGGCCCGGCGGAGCAAA. Deletion right flank: GCTTGCCTTGCATACATTTGCTGCTGCCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3182 C. elegans kbp-3(ok3713)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
F26H11.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3713 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATCGTCTTCTTCGTCGTCGT. External right primer: ATCGGCTTTTCTCAAGTGGA. Internal left primer: TCGTCTTCCTCATCATCATCC. Internal right primer: TGCTAATTTTGCTGTCGCAT. Internal WT amplicon: 1133 bp. Deletion size: 434 bp. Deletion left flank: CAAAATTTTTACCGCTCTTCAGTGCCGCCC. Deletion right flank: ACATCTAAACAATTTCCTTGCAAATTTACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3183 C. elegans F45H11(gk3128) I. Show Description
F45H11. External left primer: CGCGATGAGACCCATCTATT. External right primer: CGACAATGTGGTCGTTTTTG. Internal left primer: CTTGTGTCGATTTACGGGCT. Internal right primer: ATGGAAGAGTGCAAGTTCGG. Internal WT amplicon: 1685 bp. Deletion size: 107 bp. Deletion left flank: GAGAGACGCAGCAGCTTACTACGCAGTTAT. Deletion right flank: AAATATATTATTGAGAAAAGAAGAAGAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3188 C. elegans C17G10.2(gk3077)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C17G10.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3077 homozygotes (embryonic or early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAGAATGCAAAACCTGAGAACAA. External right primer: TACAGCTGGATTTTCAACTGGAT. Internal left primer: ATACACCCGCTTTCCACAAG. Internal right primer: CCTCCAGCTTTCGATTTACG. Internal WT amplicon: 2029 bp. Deletion size: 368 bp. Deletion left flank: TTCGGTTACTCTTTGTTTTATATTTATTTT. Deletion right flank: TATTCAGTCTATGAAATACGATAAAGAAGA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3189 C. elegans ceh-32(ok343) V/nT1 [qIs51] (IV;V). Show Description
W05E10.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok343 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTACCGGATTTGAGACGAA. External right primer: TCAAGCACTTCAAGCCAATG. Internal left primer: AATTGGAAAACGTTCCATGC. Internal right primer: CGTTAGCTGCTCCATCATCA. Internal WT amplicon: 3023 bp. Deletion size: 2073 bp. Deletion left flank: ATTGTGTTGAAAAAGTTGTGGAATTGCATG. Deletion right flank: ATGGCTCATACTTTTCATCATAAAACATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3192 C. elegans Y50D7A.4(gk3089)/sC1 [dpy-1(s2170)] III. Show Description
Y50D7A.4. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk3089 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTATCCGAATTTTCTGCGG. External right primer: ATTTTCAACGGAATTCGACG. Internal left primer: GAAAATTTTGCATTTTCAAGGC. Internal right primer: TCCGCGATTTTTATAGCATTTT. Internal WT amplicon: 940 bp. Deletion size: 647 bp. Deletion left flank: TTTTGTCAAGCCTCAAATCCCACAATTTTG. Deletion right flank: ATAAATGAGCCAAAATTCGTCAAATTCTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3194 C. elegans sca-1(ok3768) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K11D9.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3768 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGAACCACCACATTGAGGC. External right primer: GGAGAAGCCACTGAAACTGC. Internal left primer: GAGTCCATCGTTGGCTGAAC. Internal right primer: TGAGAAGATGAATGTTTTCGGA. Internal WT amplicon: 1129 bp. Deletion size: 763 bp. Deletion left flank: GAGAGCAGTGGCTGGAAGACCGTCAGTGAC. Deletion right flank: TGAGTCATGGCAGAGGTGAGTGGAACCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3195 C. elegans oig-1(gk3204) III; Y41D4B(gk3099) IV; pqn-11(gk3205) X. Show Description
This strain is homozygous for a deletion (gk3099) in Y41D4B, detectable by PCR using the following primers. External left primer: GAAACGTTGGAAAAACGGAA. External right primer: CTTTGTTCGCTGCGTAATGA. Internal left primer: CAATTTCCATACCCTCGCTC. Internal right primer: CGCACACAAGCCTTAACTCA. Internal WT amplicon: 1594 bp. Deletion size: 191 bp. Deletion left flank: GGAAACTGTGTGTTTCTGAAAATAGAGGTT. Deletion right flank: GACCACCCCAAGTGTCCTAACTCGGAGCCA. Insertion Sequence: AAAA. Validation: No CGH probes for gk3099. Other deletions (gk3204, gk3205) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3196 C. elegans smgl-1(ok2423) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F20G4.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2423 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCAACCAATCCAGCTTTTC. External right primer: CCAAAACGAGAAGACGGAGA. Internal left primer: TTCGACTTTTTCGGCGAT. Internal right primer: ATGGAACATCCTGATGCTGA. Internal WT amplicon: 1173 bp. Deletion size: 637 bp. Deletion left flank: TTCTAAAAATAATTAAATTAGAGTGTTAAA. Deletion right flank: CGTATGGTTGCCACGTCGCGAGATCATGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3198 C. elegans hip-1(gk3264) III. Show Description
T12D8.8. External left primer: GCTGCAGGAATCACTGACAA. External right primer: GAGACGCGAGGAAGAACAAC. Internal left primer: TGGGTCTTCCACCAAAGAAG. Internal right primer: GCGCAAATGCACAGAATATG. Internal WT amplicon: 1339 bp. Deletion size: 689 bp. Deletion left flank: AGCCTTGTGCCGAGTCTGGGTTGATAGAGA. Deletion right flank: GAATTGAAGTGTTTATTCAATTTGTTTGGA. Validation: gk3264 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3199 C. elegans tbx-33(gk3098) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y66A7A.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3098 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATATTGAAAACTAGGAACTTGGCG. External right primer: CCTACCAGAATCAGTATGCACATC. Internal left primer: CTGAATTTGTTCCATTGTTAGAAAGA. Internal right primer: CTTAAAGTCAAAAACAAACGTTCAAA. Internal WT amplicon: 1543 bp. Deletion size: 474 bp. Deletion left flank: AGGATTAGGCATAGGTTTAGGCTTAGGGTT. Deletion right flank: TTGTAGTTGGATTCTGGATTGAGATGCTCG. Insertion Sequence: GGGCTTAGGATAAAGCTTTGGCTCACGCTTAGGTTTAGGATTAGGTATAGGTTTAGGCT TAGGGTTAGGCTTAGGGTTAGGCTTAGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3201 C. elegans atfs-1(gk3094) V. Show Description
This strain is homozygous for a deletion (gk3094) in ZC376.7, detectable by PCR using the following primers. External left primer: TTTCAGTCGTTTCAGGACCC. External right primer: TCATCGAGTTGATCTCACGC. Internal left primer: ATAGAAACCGCCTCCTTTCG. Internal right primer: TTCTCGGCTCGTTTCTTCTC. Internal WT amplicon: 2877 bp. Deletion size: 881 bp. Deletion left flank: ACTGGACCTCGACTCATGGCACACTAAGCC. Deletion right flank: ATCAAGTTATCTTCACGGAAAAATGTTCGA. Validation: gk3094 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807