More Fields
Strain Species Genotype
VC3032 C. elegans nas-11(ok3723) X. Show Description
K11G12.1. External left primer: AAAACACAGGCACCTTGGTC. External right primer: TCTGATTGGGGAACTTGGAT. Internal left primer: CAAAGAATGGAAAGGCAAAG. Internal right primer: ACTAGGATGAGATGGGCAGC. Internal WT amplicon: 1336 bp. Deletion size: 982 bp. Deletion left flank: TCATGTAAGCTCGGAACATGTGAACAAACT. Deletion right flank: AAAACGGGCAGAATTGTAGATTTGCTGCCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3033 C. elegans coel-1(gk1291) X. Show Description
This strain is homozygous for a deletion (gk1291) in C52B9.3, detectable by PCR using the following primers. External left primer: ACATTTTTGTGGCCTTTTCG. External right primer: ATTCCCTTCTCATCCCTGCT. Internal left primer: TTTTCACTTGTCCCTCGACTTT. Internal right primer: TCGTTGAATGTATTTGCAGGTC. Internal WT amplicon: 1349 bp. Deletion size: 873 bp. Deletion left flank: TGGTGATGGGTTTTTAAAGTAACTTTTCAG. Deletion right flank: GTAAACTTAAGCCGTAATTGACACTCTAAT. Validation: CGH diagnostic for gk1291 equivocal. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3034 C. elegans srgp-1(gk3017) IV. Show Description
This strain is homozygous for a deletion (gk3017) in F12F6.5, detectable by PCR using the following primers. External left primer: GAAGTCACTTGAAGCATCAGAAAA. External right primer: TCAGAATCAAGCTTCTTTGTTGAG. Internal left primer: TCAAAAACCAATTTCGTTAGAGC. Internal right primer: TGATTTTTATTGCCTTTTTCCAA. Internal WT amplicon: 2179 bp. Deletion size: 1203 bp. Deletion left flank: GTACCAAAAAAAGAGAGAATGCGTCTTCCT. Deletion right flank: GATGATAGATTCTACATATGAATCAGCTGA. Validation: gk3017 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3037 C. elegans C33C12.9(ok3740) II. Show Description
C33C12.9. External left primer: AAAACAAAGCAACTCCAGGC. External right primer: CCCAAAGTTTTGACACCCAT. Internal left primer: AGCCTGTGATTCTAGCCAGC. Internal right primer: AGATTCGGTCAAAAACCCAG. Internal WT amplicon: 1235 bp. Deletion size: 598 bp. Deletion left flank: CGTCAATAAAAAGGTTTTTGTGGTGCGTTG. Deletion right flank: AGGTTTGTAGCTTAAATTTGAAGATTTTCG. Insertion Sequence: GTGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3038 C. elegans C02F5.7(ok3741) III. Show Description
C02F5.7. External left primer: GGAGCATACTTGCGTTGGAT. External right primer: GTGTCGAGACCGGGTACTGT. Internal left primer: ATCTAACTGGCAGCGCGT. Internal right primer: CGAACGATTGCTTCTTTTGA. Internal WT amplicon: 1100 bp. Deletion size: 707 bp. Deletion left flank: TCTAACTGGCAGCGCGTCGACTTATTCACA. Deletion right flank: AGTACTGGAATTATCTGGATGCACACTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3039 C. elegans col-184(ok3742) X. Show Description
F15A2.1. External left primer: ATTCGTCTGTTCCGTTTCCA. External right primer: GATGACACAACCCCCTCACT. Internal left primer: CTTAATTGCATCGCAACCAC. Internal right primer: TGGATTTGACCATTTCAGGC. Internal WT amplicon: 1248 bp. Deletion size: 462 bp. Deletion left flank: CTCAAGGATGCCCAGACGGGCCACCAGGAG. Deletion right flank: AGGATGGTACTCCAGGAGAACCAGGTGCCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3041 C. elegans F48C1.4(ok3745) I. Show Description
F48C1.4. External left primer: AACGATAGGAGACACGGTGG. External right primer: TGTGGTTGTTTTCGTTGCAT. Internal left primer: CAAGTTGAGAGTCCGCAGTG. Internal right primer: ACCATAAACTTGTTCGCGCT. Internal WT amplicon: 1143 bp. Deletion size: 523 bp. Deletion left flank: TTAGACAACTAACCATAGAGCGTGCAAATC. Deletion right flank: TGTTTCAGTGTTCTCCTTCCTGAAAAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3042 C. elegans C06A12.3(ok3746) IV. Show Description
C06A12.3. External left primer: CAATGCAACGCCAATTGTTA. External right primer: CTCATCAATGCCTTGCTCCT. Internal left primer: TCCATTGTTTGAAGAGTGCTG. Internal right primer: CGAATTGGCTAAAAACTCGAA. Internal WT amplicon: 1192 bp. Deletion size: 336 bp. Deletion left flank: TATGTTCCATTGTTTGAAGAGTGCTGTTCT. Deletion right flank: TGAATAGAAAACGTCACGAAGTGGTGAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3043 C. elegans C27C7.2(ok3747) I. Show Description
C27C7.2. External left primer: ACACAAATTGCCAGATGCAG. External right primer: TCAAGAAAAAGCAACAGCCA. Internal left primer: TTCCACATCTTGCTTTGATTTG. Internal right primer: CGGAAAATTCCTGCACAACT. Internal WT amplicon: 1166 bp. Deletion size: 411 bp. Deletion left flank: TATGAAGACTACTGTAGAATTACCGTAATT. Deletion right flank: GTTGCTTTTGCTATGCATAAGTTCATGGTT. Insertion Sequence: TTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3044 C. elegans dbl-1(ok3749) V. Show Description
T25F10.2. External left primer: TCCGACTTTTCAGCCTGATT. External right primer: AGCATCGTAGCCCTCTGAAA. Internal left primer: GATATGTCCAGTGGCTGCCT. Internal right primer: CTCACTGGGTGCCATAATCC. Internal WT amplicon: 1134 bp. Deletion size: 783 bp. Deletion left flank: CCAATGTCTGCTGCTGCCGATCAACACGCG. Deletion right flank: AAAAAATCGAAAAAAGGTTTGTGATTTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3045 C. elegans sulp-7(ok3752) X. Show Description
W04G3.6. External left primer: ACGAGTACGGAGGTTGAAGC. External right primer: GCACCAACTGGACCACTTCT. Internal left primer: ATCCCTTGGACTTGCTGTTG. Internal right primer: CGAGATTCCTTATTTGACCGA. Internal WT amplicon: 1322 bp. Deletion size: 734 bp. Deletion left flank: ATATATGTATATTTCAGATAATCATGGGTC. Deletion right flank: CTTTCTGGAAGCTTTATTAGCCTAAAGCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3046 C. elegans aly-1(ok3754) IV. Show Description
C01F6.5. External left primer: CAACTCCCCCAAATTGGTAA. External right primer: GACGAAGGGATGATATGGGA. Internal left primer: TTTTTGATGTCACCTACCTATTCTA. Internal right primer: TTTGTTCGCCGTTCAATATG. Internal WT amplicon: 1251 bp. Deletion size: 617 bp. Deletion left flank: TCTCCAGATACTCCATCCACCTAGTCTATC. Deletion right flank: CGTGAACTTCAACGAGCACGGAAAACCAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3049 C. elegans hel-1(ok3698)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
C26D10.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3698 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAACCAAGTTCTGGCCATCT. External right primer: TTCCATTCTCCTTCCACCTG. Internal left primer: GGCGGAGAACATCATCACTT. Internal right primer: TTTCGGATCGTTTCGCTACT. Internal WT amplicon: 1141 bp. Deletion size: 721 bp. Deletion left flank: TGTCGCACTCGTCCAGGACGAAGTACTTGA. Deletion right flank: GAAATTTAGTAAATAACCTCACAAAAACAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3054 C. elegans F52B11.2(ok3718) IV/nT1 [qIs51] (IV;V). Show Description
F52B11.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3718 homozygotes (early- to mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTCCTGAAATATGGCGGAGA. External right primer: TCTTCTGGCCCTTCAACAGT. Internal left primer: ACACGAAGCACTGGCTTTTT. Internal right primer: GTCCGACAGTCCGTTCGT. Internal WT amplicon: 1267 bp. Deletion size: 518 bp. Deletion left flank: AATGTATTATTTTCCATTTTCCGAATTTTT. Deletion right flank: CGGATTCAAGGGCACCGAACCGTATCCAGT. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3056 C. elegans zip-2(ok3730) III. Show Description
K02F3.4. External left primer: ATTGTTCAGCTATCGGCTCC. External right primer: AGCTGCTGGAGTTGGAGGTA. Internal left primer: ACTCACCGCTCCAGGATG. Internal right primer: TGAGGTTGGTGAATAAGGGA. Internal WT amplicon: 1145 bp. Deletion size: 476 bp. Deletion left flank: GACACGACGTTCCCTACCGAAAGCGGACCG. Deletion right flank: AATTTAAACATTAAAAACCATTTCAGTTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3058 C. elegans thn-1(ok3735) IV. Show Description
F28D1.3. External left primer: TTCCTATCAATCACCCCCAG. External right primer: AGTTTTACGCGGCTGTTGTT. Internal left primer: TTTCCTAAACCTTACGGCCC. Internal right primer: CCGTGTTCCTTTTGAAGCTC. Internal WT amplicon: 1285 bp. Deletion size: 583 bp. Deletion left flank: TTTAGCATGAACTTTCAGAACTCGGAGCAA. Deletion right flank: CAGTTGATACCTTTCTACTATCGAATGACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3059 C. elegans ZK6.11(ok3738) V. Show Description
ZK6.11. External left primer: ATCAGTCATAAGGCGATGGG. External right primer: CCATTTCAATAAACCGGTCG. Internal left primer: AAGGCTTCAAGGCTGTCAGA. Internal right primer: GTGGCTCGGTTTCACACTTT. Internal WT amplicon: 1209 bp. Deletion size: 496 bp. Deletion left flank: CAGCGTACAGATATGCCAGAGCAGTAGAGT. Deletion right flank: TAAATATTATACGGCGGGTAAACTTTAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3060 C. elegans +/szT1 [lon-2(e678)] I; C33A11.1(ok3681)/szT1 X. Show Description
C33A11.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3681 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTGGTTGTCCTTTGCTGTT. External right primer: CTGTTACGCTGTGCTGGAAA. Internal left primer: ACATGGGTTTGTCCCTTTTT. Internal right primer: CCCCCATAATTTTCATATCACG. Internal WT amplicon: 1298 bp. Deletion size: 1022 bp. Deletion left flank: TCATTTTTATTTGAATCATCAACTTTTAAA. Deletion right flank: AGCTCAAGATGAAAAAAGAAAAAGAGCAGG. Insertion Sequence: ATATTTTGACTTCCTTTTTTATTTTTTTTTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3061 C. elegans C17E4.20(ok3726) I. Show Description
C17E4.20. External left primer: TTCCGTTGGGGTAAAATCAA. External right primer: ACACGAAGGACGAAAGTTGG. Internal left primer: GGAATCAAAACGGATGGTTG. Internal right primer: GCGGTATTAGGAATTTTTGGG. Internal WT amplicon: 1157 bp. Deletion size: 609 bp. Deletion left flank: GCGATGTTGAATGAAGCTATGGAAGATGAT. Deletion right flank: CAAATGGAAAAGAACTCTGAGCTACAGGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3062 C. elegans F25H8.2(ok3636) IV/nT1 [qIs51] (IV;V). Show Description
F25H8.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3636 homozygotes (sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGCAAACATGCTCCAATGA. External right primer: ATTATCCGATCTGGCAGGTG. Internal left primer: AACAAACGACACTCCGATTTC. Internal right primer: ATCTCGTTTTCGCCCTCTGT. Internal WT amplicon: 1333 bp. Deletion size: 333 bp. Deletion left flank: GAATGATTAGATTTCTAGCGTAATGTTCAC. Deletion right flank: AGAAGTTTTATAGGCATCGATGATACCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3070 C. elegans rab-1(ok3750) V/nT1 [qIs51] (IV;V). Show Description
C39F7.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3750 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTTACGACGTGAATTTGGGG. External right primer: TTCTTGCACTGTTCGTCTGG. Internal left primer: AGGGGAGAGAAAAGACAGCA. Internal right primer: CTCCTGTTGCTGACCGATTT. Internal WT amplicon: 1245 bp. Deletion size: 538 bp. Deletion left flank: ATAATCCTGGGCAGCTTGAGTCTCCACAGC. Deletion right flank: AAATTGGGAAAAAAATTGTTAGAAACCGAA. Insertion Sequence: AGCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3071 C. elegans hsf-1(ok600)/hIn1 [unc-101(sy241)] I. Show Description
Y53C10A.12. Replaces strain VC358. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok600 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAAACAACAAATCCTCGGCT. External right primer: GCTCAATGCGTCAACAACAT. Internal left primer: GTGGATGAGGTGGAAGTCGT. Internal right primer: GTCGCGAAACGGTAATCAAT. Internal WT amplicon: 2605 bp. Deletion size: 877 bp. Deletion left flank: ATGAGTCAATGGACCGGATCCCATGTACAT. Deletion right flank: TTCTAAGAAATTTTTATTTTCTGAAAAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3072 C. elegans scd-2(ok3702) V. Show Description
T10H9.2. External left primer: ATCACAAACCAATTGGGGAA. External right primer: TAATCCGGCTGGAAGAAATG. Internal left primer: CCCTGCGTATGCTAATTGGT. Internal right primer: TCCGGTCTAGTGGTAATCCG. Internal WT amplicon: 1147 bp. Deletion size: 660 bp. Deletion left flank: CTGATTTTATCGTTGAACGACGCGATAATC. Deletion right flank: CTTGTACAACATTACGTTTTTGATCTTCGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3074 C. elegans cdk-2(ok3728) I. Show Description
K03E5.3. External left primer: AAAATGCGTATTTCGCAACC. External right primer: AATTTCGTTCGATGACACCC. Internal left primer: CTTGTGTCGATTTACGGGCT. Internal right primer: TGAAGAGGAAAGACTCGGTAAAA. Internal WT amplicon: 1155 bp. Deletion size: 246 bp. Deletion left flank: GAATTAAAATAATTTATTAATTTAAATAAC. Deletion right flank: TTCCAAAAAAAAACATAAATTTCGATTATT. Insertion Sequence: CAAAAAAAAACATAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3075 C. elegans tsp-3(ok3729) III. Show Description
Y39E4B.4. External left primer: AAACCGCATTTGTCCGAATA. External right primer: TGCCCCCACTAACCAATATC. Internal left primer: TGTCTTAAAGCAAACGTGCAA. Internal right primer: ACTACTGCCGGCTCTATCGG. Internal WT amplicon: 1181 bp. Deletion size: 351 bp. Deletion left flank: GTTTTGATAAAGGCTTCGAATCGGAAATTC. Deletion right flank: AGGCTCCATACTTTCTGTTTATGGTTATCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3076 C. elegans Y38E10A.8(ok3731) II. Show Description
Y38E10A.8. External left primer: GGAAACCACGACGCTATCAT. External right primer: CCGCGATCCAATTCTCTAAA. Internal left primer: ACCTGATAAATCCATCCGCA. Internal right primer: GTCCGACACTTTTTGGGTTC. Internal WT amplicon: 1216 bp. Deletion size: 550 bp. Deletion left flank: ACTTTATTCATAGAGATTTGAAGCCAGAGA. Deletion right flank: AAACGATGCGCGGAACCCAAAAAGTGTCGG. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3078 C. elegans F10E9.1(ok3764) III. Show Description
F10E9.1. External left primer: AGCTGAAAAATGCTGTCGGT. External right primer: TTAAATGTGCAATGGTCCGA. Internal left primer: TACTGCACCACCGTTCAAAA. Internal right primer: CAGCTTCCTCATTTTCTGTTCTT. Internal WT amplicon: 1235 bp. Deletion size: 625 bp. Deletion left flank: AGTTGCTGGACAAAACAGCCGTGAGGAAGC. Deletion right flank: GGATACTTGAAATAAAAGGGAGCAGGAATC. Insertion Sequence: TTGAAATAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3079 C. elegans nhr-58(gk3046) V. Show Description
R11G11.2. External left primer: CGGACATTTTCCGTTCAACT. External right primer: GCATTCTGGTCCGTTTTGAT. Internal left primer: GGTGCCCAGTTGTAGAGCAT. Internal right primer: AGAAAGGAAAGACGCAGGTG. Internal WT amplicon: 1957 bp. Deletion size: 694 bp. Deletion left flank: TTTGGCACATGTGGGGGAGGATGGACAAGC. Deletion right flank: AAACTATCTACAGTAGTTCTACAGTATTCC. Validation: gk3046 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3082 C. elegans T27D12.1(ok3748) II. Show Description
T27D12.1. External left primer: GGAGCCGTCTCTCTCCTTCT. External right primer: ATGGGTCAAAAATTGCTTGC. Internal left primer: ACGTACGCTCTCTTCTACCG. Internal right primer: ACTGCAAGTAGCCGACACCT. Internal WT amplicon: 1304 bp. Deletion size: 672 bp. Deletion left flank: TCCTCTTCTCCCCAATCTATCTCTCCAAGG. Deletion right flank: CTAAAAAAAACTTGTACAAATCTTTGCTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3084 C. elegans C34B4.1(ok3727) V/nT1 [qIs51] (IV;V). Show Description
C34B4.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3727 homozygotes (Unc, mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTGCAGCCGAAAGTATCGT. External right primer: TGGACTGACTTCAGACGACG. Internal left primer: AAGGCATAAGCTGCTCCTTG. Internal right primer: GCCTGAAAACAAAGCAGGAA. Internal WT amplicon: 1143 bp. Deletion size: 711 bp. Deletion left flank: GTGACAGATCGAATATCTGATATACTGATT. Deletion right flank: CTTCAATGTCATACTCGTAATCTTCCGCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3086 C. elegans yop-1(ok3629) I. Show Description
Y71F9B.3. External left primer: AGCCCTGACTGGTTCACATC. External right primer: AAAAAGGGAATTTTGGTGGG. Internal left primer: GCAAAAGGTCTTGGACGATG. Internal right primer: TCATTCCATGTGATCTCGGA. Internal WT amplicon: 1215 bp. Deletion size: 860 bp. Deletion left flank: AGCGGCTTCATTTGGTGCTCGGCGTCGTCG. Deletion right flank: TTCTCCGTTCAAATCGTCGCCGTTTTCCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3090 C. elegans mop-25.1(ok3762) X. Show Description
R02E12.2. External left primer: TTTTGGGCGTTTTTCTTACG. External right primer: ACAGAAGCTGTTGCCGAGTT. Internal left primer: GGAAATTTTGAACGACCACAG. Internal right primer: GAGTTGTTTTACAGGAATTCTCCA. Internal WT amplicon: 1136 bp. Deletion size: 392 bp. Deletion left flank: TTTCAAATATTCCATGACCACCCAAAAAAA. Deletion right flank: CATCCGCACAAGCTGTCTTCATCGTACTGT. Insertion Sequence: ATCTCGCATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3092 C. elegans ethe-1(ok3755) IV. Show Description
C33A12.7. External left primer: ATGTCCTTTTCCATCCACCA. External right primer: CACGTCTATTTTGGCCGTTT. Internal left primer: TTTGCAGGAACCGCTTTATC. Internal right primer: GCAGGTAGACATAGGCAGGTG. Internal WT amplicon: 1353 bp. Deletion size: 748 bp. Deletion left flank: CGATTTTGAACTGAGCACTGACTTCATTGT. Deletion right flank: ACATCTCTTTCATATGCACGAAAATGTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3093 C. elegans glb-14(ok3757) V. Show Description
F21A3.6. External left primer: CAAATTGGCGAACTTCATCC. External right primer: AAATCCGTGATTTTTCGCAC. Internal left primer: CAAGCCTGTTTATAGACTTTTGGG. Internal right primer: AATTCCACTTTCCGAGCAGA. Internal WT amplicon: 1231 bp. Deletion size: 542 bp. Deletion left flank: ATACTGATGAATAATGCGTATCTAATAACT. Deletion right flank: CTGCAAGGCACGGCAGGCATTTTTGCGCCT. Insertion Sequence: GCAAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3094 C. elegans K09E4.1(gk3179) II; gkDf32 X. Show Description
This strain is homozygous for a deletion (gk3179) in K09E4.1, detectable by PCR using the following primers. External left primer: TCGGCAAATGTGGTTTTGTA. External right primer: CGAGTTCTCTTCCTCAACCG. Internal left primer: ACACAATGGAGCAGCATCAG. Internal right primer: GGCAATCTTGTGGAACACCT. Internal WT amplicon: 1905 bp. Deletion size: 341 bp. Deletion left flank: CCTGGCTTCATGGCGATCTCAGGCAGGCGC. Deletion right flank: ACCAGCTGGTTCACCTGGTGCTCGGCGAGC. Insertion Sequence: TGGTTC. Validation: No CGH probes for gk3179. Other deletion (gkDf32) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3095 C. elegans R04B5.5(gk3180) V. Show Description
R04B5.5. External left primer: CTGGAAAACTTGATCTATCGGG. External right primer: CCATTGACTGACTTTTTCTCCC. Internal left primer: AGAAGAGATAAGCGCACGGA. Internal right primer: CATGTTTCCTCTCGGCATTT. Internal WT amplicon: 1679 bp. Deletion size: 247 bp. Deletion left flank: ATTCCAAAGCCTGGGCCAAATCAGGTGCTT. Deletion right flank: TGTGAGCACTGCAAAACTGGAAGATACAAT. Validation: gk3180 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3103 C. elegans F38E9.5(gk3181) X. Show Description
This strain is homozygous for a deletion (gk3181) in F38E9.5, detectable by PCR using the following primers. External left primer: GAGCAGCCAAAGGCTCATAC. External right primer: GGCTAGTCTCGGACTGGTTG. Internal left primer: GTGCTTCATTCTGTTCCGGT. Internal right primer: TTCCAATGATTCGAGGGTTC. Internal WT amplicon: 1591 bp. Deletion size: approximately 500 bp. Validation: gk3181 passed by CGH. Deleted probe: GAAGAAAGCATTTAGAAGTTATAGCTTTGGACTAGCATCCGTTTTAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3106 C. elegans cpn-3(ok3766) I. Show Description
F28H1.2. External left primer: TTTTTAAGTCCGGCAAATGG. External right primer: ATGTTTTTGCTGTGAAGCCC. Internal left primer: AGGCGCACACTATTTTTCGT. Internal right primer: CCGGCGTATAGAAACCAGAG. Internal WT amplicon: 1306 bp. Deletion size: 543 bp. Deletion left flank: GATCAAGAAGCTCTCCGGTGAGAACATCTC. Deletion right flank: ACAAAGCTCGATTCTTCTCTCTTTTCTGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3108 C. elegans mel-46(ok3760) IV. Show Description
T06A10.1. External left primer: CAGCTTGTCTCCCGAATCTC. External right primer: AGGCCAACAATAGCCAAAAA. Internal left primer: CTCGTCTTTCTCGCGTTTTC. Internal right primer: TTTGAGCAATTCTGGACTAAAAA. Internal WT amplicon: 1270 bp. Deletion size: 448 bp. Deletion left flank: GACGTGAAGGCTTCACGAATGTGTTGGAGC. Deletion right flank: ACAGAAAAATGGGCGGGGCACAGTTTTGCA. Insertion Sequence: AGAAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3110 C. elegans ztf-22(gk3235) II. Show Description
Y48C3A.4. External left primer: CCATTTCTAACATAGGGGCTTTATT. External right primer: TATTTCGGCATTTTACCAAATTTTA. Internal left primer: TGTGAAAAAGAGCCAAATTGATAA. Internal right primer: GAGGTTTTTCCTGAAAATTGAAAA. Internal WT amplicon: 1190 bp. Deletion size: 369 bp. Deletion left flank: TTTGGAGCAACGTGTTTAAAGTGTTGAAGA. Deletion right flank: GGTTGGCAAGTGTTAAAATGTCCAAATATC. Validation: gk3235 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3111 C. elegans gpb-2(ok3691)/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
F52A8.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3691 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATAATCAAGCCCAAATGCG. External right primer: CCAACAACTTGGGTTATGGC. Internal left primer: TTCCATCAGGAGAAGTTCGG. Internal right primer: ATCGCTTGCGGGTAAGATTT. Internal WT amplicon: 1318 bp. Deletion size: 393 bp. Deletion left flank: TTGTCACTTCTTCTCGAGGAGTACACTAGC. Deletion right flank: ACATGTTGAATCTCCACTTCCAGTTAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3112 C. elegans C41A3.1(ok3769) X. Show Description
C41A3.1. External left primer: AAGCTTGGCGATCAGGTAGA. External right primer: CAGTTGACTCAATTTCCGCA. Internal left primer: ACGGCATAATACCGAACCAG. Internal right primer: TGCTCGTCAACAATGTTCGT. Internal WT amplicon: 1141 bp. Deletion size: 689 bp. Deletion left flank: CTCAATCCGACTCTGCGATGGAGGATATTT. Deletion right flank: GATCTGCCAGCTATTTGCTTGTGGGTTTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3113 C. elegans tax-4(ok3771) III. Show Description
ZC84.2. External left primer: GCGGTTCGGATACGAAAATA. External right primer: GTGCCTGCAAGGAGACCTAC. Internal left primer: GCAAATTATACACAGGATCCATCTAC. Internal right primer: CCTGCTCCAAAAGTAAGCCA. Internal WT amplicon: 1290 bp. Deletion size: 442 bp. Deletion left flank: ACTTGGGATGGTCGAAATATTGGCATTTTC. Deletion right flank: AGAGCTTACCCGAGTGAGTTTTTAGATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3115 C. elegans srgp-1(gk3182) IV. Show Description
F12F6.5. External left primer: GAAGTCACTTGAAGCATCAGAAAA. External right primer: TCAGAATCAAGCTTCTTTGTTGAG. Internal left primer: TCAAAAACCAATTTCGTTAGAGC. Internal right primer: TGATTTTTATTGCCTTTTTCCAA. Internal WT amplicon: 2179 bp. Deletion size: 470 bp. Deletion left flank: AATGGAAACCTCATGGAAAGACTCGAAGCA. Deletion right flank: TATTCCCAATATTCATGTTCGAACAGTTTT. Insertion Sequence: CTCGATATTCTCTTCGTAATCAGGGATTATTCCGAGTTTCTGGTTCACAATCGGAAATT AATCGATTCAGAGAAGCTTATGAAAGAGGAGAGGATCTATTCCAGTATCTGGGAGGATC TATTCCAGTATCTATTCCAG. Validation: gk3182 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3116 C. elegans fbxb-101(ok3765) I. Show Description
Y63D3A.3. External left primer: TCGCCCCAAAAATAAGTGAC. External right primer: TCCGCCTTCAACTAAACCAC. Internal left primer: CACATGGGGATTGAGGTCAT. Internal right primer: CTTTGCCGCATGCAAAAT. Internal WT amplicon: 1172 bp. Deletion size: 467 bp. Deletion left flank: TAAAATGAGAACTTTGAAGCTTAGGTACCA. Deletion right flank: AAGCTATGAACTTATATACTACATATTTTT. Insertion Sequence: CGAAAGAAAGAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3118 C. elegans M05B5.2(ok3716)/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
M05B5.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3716 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGGCAGTTTCAGGGTTCAAA. External right primer: CTAAGGCACTTGGCTTTTGC. Internal left primer: GGGAGGAAATTTCAAAAATGA. Internal right primer: AAAAATTTAACGCGTCGCTG. Internal WT amplicon: 1169 bp. Deletion size: 569 bp. Deletion left flank: GGAATGGCAAATTGACAGCATGAGGGTTTC. Deletion right flank: TTTTTGGGATGTTCAGCGACGCGTTAAATT. Insertion Sequence: TTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3119 C. elegans +/mT1 II; C07A9.4(ok3733)/mT1 [dpy-10(e128)] III. Show Description
C07A9.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3733 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTGCGATGTTTGAAAACGAA. External right primer: TTTCGGGTTGCCGAATAATA. Internal left primer: TCTTCTATTGGCAATGCAACC. Internal right primer: CTGTGAAGGTGGTGGTTACG. Internal WT amplicon: 1278 bp. Deletion size: 537 bp. Deletion left flank: CAAAATGCCAAAAATGCTAGAGCAACAAGA. Deletion right flank: ATAACACCAACATGTAGATGACCCCGGTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3121 C. elegans T07D10.1(gk3249) I; F59E12.3(gk3183) II; Y116A8C.5(gk3250) IV; unc-83(gk3251) gkDf35 V; gkDf32 X. Show Description
This strain is homozygous for a deletion (gk3183) in F59E12.3, detectable by PCR using the following primers. External left primer: GCATGCAAGAAATGCAAGAA. External right primer: TGAAGTCGCGCACAAATAAG. Internal left primer: TCACAAATGGAAACGTGTGG. Internal right primer: CAACGAGGCCAAAGTGATTT. Internal WT amplicon: 1320 bp. Deletion size: 585 bp. Deletion left flank: GAACTGACAACAAGTATCTCAACCTACACG. Deletion right flank: CCCCCGTTTATGCGCCCAGGGCATCCCACA. Validation: gk3183 passed by CGH. Other deletions (gkDf32, gkDf35, gk3249, gk3250, gk3251) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3123 C. elegans kin-21(gk3184) IV. Show Description
This strain is homozygous for a deletion (gk3184) in W08D2.8, detectable by PCR using the following primers. External left primer: TGAACCATTTCACTAGCCCC. External right primer: GCTCTATCCGTTCTTCGTGC. Internal left primer: AATGATGTTCGGAAAGGCTG. Internal right primer: CATTCGGGAGTAGATGCGAT. Internal WT amplicon: 2184 bp. Deletion size: 652 bp. Deletion left flank: ATTCTCCAAAGGATTATTCAATGAGAAAAC. Deletion right flank: CTAAGTGAACTCATGTAATCAACAAAATAG. Validation: gk3184 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3124 C. elegans Y74C9A.3(gk3247) I; C03C10.2(gk3027) III; gkDf34 V. Show Description
This strain is homozygous for a deletion (gk3027) in C03C10.2, detectable by PCR using the following primers. External left primer: ACTACCGTGCTCTTGGCACT. External right primer: TCAACCTCACCCCATTTCTC. Internal left primer: GCATGTGTCTACCATCCACG. Internal right primer: GCAGTGATTTCGGGCTGTAT. Internal WT amplicon: 2385 bp. Deletion size: 826 bp. Deletion left flank: ATGCATTGAAAGATATTCATGATATGGGAT. Deletion right flank: TCAAAACCGAATCCGGTGTATGCATTCCAT. Validation: gk3027 passed by CGH. Other deletions (gk3247, gkDf34) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807