More Fields
Strain Species Genotype
VC2857 C. elegans F45H11.6(gk1216) I; F09A5.2(gk3060) X. Show Description
F45H11.6, F09A5.2. The allele gk1216 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TCCTTATCGGGTGACTCCAG. External right primer: TAAGGCGCTGCTTTGATTTT. Internal left primer: GGACGGACACGTTTCAAATC. Internal right primer: TATTATTTGCCTGCTTCCGC. Internal WT amplicon: 1801 bp. Deletion size: 646 bp. Deletion left flank: GATGAAGAATGAGAAAGGAAATATTTGAAG. Deletion right flank: AATAATGTTGTCTGGTACAGGTATCAAATC. The allele gk3060 was identified by CGH but not confirmed by PCR. Left flanking probe: ATCAGCATGTTGGGATGTGTGTCAAATCCATATGAGCCATTGATCGTGGT. Right flanking probe: TGGTGAGTGACCTTTCCATAAACCGAATTACCTCGGAAAATGTTTTTAGA. Left deleted probe: ATCAGCATGTTGGGATGTGTGTCAAATCCATATGAGCCATTGATCGTGGT. Right deleted probe: GAGAAGACATAAAGATTATGTGCTGATGGTGAGTGACCTTTCCATAAACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2858 C. elegans C40D2.4(gk1276) II. Show Description
C40D2.4. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 518 bp. Deletion left flank: TCTCCTCAAATGCTGAAAGTGAATAAAGAA. Deletion right flank: CAAAAAATATTTTTCAAAAGATAACATAAA. Insertion Sequence: AGGTGATCTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2859 C. elegans R09D1.13(gk3177) II. Show Description
This strain is homozygous for a deletion (gk3177) in R09D1.13, detectable by PCR using the following primers. External left primer: GCAATCGGGATGTTCTGAAT. External right primer: TGTTGGAGAAACTGTGCGAG. Internal left primer: ACAACGAAACATCGTCGGAT. Internal right primer: ATAAATATGGATGCCGCCAA. Internal WT amplicon: 2530 bp. Deletion size: approximately 1400 bp. Validation: gk3177 passed by CGH. Left deleted probe: AGGATCAATTTCGACTGGAATGTTGCCTATACTAATATTATCTCGAATGC. Right deleted probe: AATTAATATAACTAGATCCATTGCCATTTTCGGTTTGGCTGGAACATATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2860 C. elegans K09E4.1(gk1223) II. Show Description
K09E4.1. Identified by PCR, validated by CGH. External left primer: TCGGCAAATGTGGTTTTGTA. External right primer: CGAGTTCTCTTCCTCAACCG. Internal left primer: ACACAATGGAGCAGCATCAG. Internal right primer: GGCAATCTTGTGGAACACCT. Internal WT amplicon: 1905 bp. Deletion size: 753 bp. Deletion left flank: CAAATTTTTTTGCCGATTTGCCGGAAATTT. Deletion right flank: GCGATGCGGAACAAGTTCACGCTTGGGACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2861 C. elegans coel-1(gk1236) X. Show Description
C52B9.3. Identified by PCR, validated by CGH. External left primer: ACATTTTTGTGGCCTTTTCG. External right primer: ATTCCCTTCTCATCCCTGCT. Internal left primer: TTTTCACTTGTCCCTCGACTTT. Internal right primer: TCGTTGAATGTATTTGCAGGTC. Internal WT amplicon: 1349 bp. Deletion size: 448 bp. Deletion left flank: AAATGTGTGCTCAGTTTTTGTTTGCGAAAA. Deletion right flank: TATCAGGTTTGTAGATCACGTTTTCCACTA. Insertion Sequence: CCCTTTAAAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2862 C. elegans +/szT1 [lon-2(e678)] I; utx-1(ok3553)/szT1 X. Show Description
D2021.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3553 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATGGATATCAGCGCTCAGG. External right primer: TTGCTACTTGCCAGCACATT. Internal left primer: CAAATGGTTCATAGAAGAACTCAGC. Internal right primer: CTGTTGAAAGTTGAGTGGCG. Internal WT amplicon: 1147 bp. Deletion size: 554 bp. Deletion left flank: GACAATAGGAAGGAAGCTCAAAGTCTGGAA. Deletion right flank: TGGGGCACCAAGTTCACGGCATGAATACTG. Insertion Sequence: AGTCTGGAAAGTCTGGAAAAGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2864 C. elegans Y75B8A.6(ok2294) III. Show Description
Y75B8A.6. External left primer: ACGGATCCCTGAACAGAATG. External right primer: TATATTCACGGGGTTCTGGC. Internal left primer: TTGCTGGAGAGAAAAACGGT. Internal right primer: GGAAACCAGAAATCCGTGAA. Internal WT amplicon: 3060 bp. Deletion size: 903 bp. Deletion left flank: ATACGAAAAAATTCAAAAATTCAAAAAGGA. Deletion right flank: TATATTGAACTCGTTTCACATCAAAATGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2873 C. elegans R03A10.3(ok3439) I. Show Description
R03A10.3. External left primer: TGCTGGAGTAGAGCGGGTAT. External right primer: GCAGAGAGCCTGAAAATTGC. Internal left primer: CCTTGTGGAAGGCCTTGTT. Internal right primer: GCACAGCCCTGATTCCTACT. Internal WT amplicon: 1181 bp. Deletion size: 621 bp. Deletion left flank: CAGTTTTTTTCCGTTTCACTTACCACATCG. Deletion right flank: CCCAACTACAGAATGATGCGAATCGTAGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2876 C. elegans egg-3(ok3651)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F44F4.2. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3651 homozygotes (sterile giving unfertilized eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AATAAGCCGGTGTGATACGG. External right primer: TCGATGTCTGATTGCAGCTC. Internal left primer: ATCGATTTGAAGCGAAGGC. Internal right primer: GTCAATTGAATCCGGAGCAT. Internal WT amplicon: 1211 bp. Deletion size: 555 bp. Deletion left flank: ATGGAATGATCCAAAACGAAGAGATTCATT. Deletion right flank: ACTGAACTTCCCCGGCTCAACAAGCAGTGA. Insertion Sequence: TCTCGAAGAGATTCATTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2878 C. elegans F29B9.2(ok3628) IV/nT1 [qIs51] (IV;V). Show Description
F29B9.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3628 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCAGCTTATCAAGCACACGA. External right primer: AACCGCGTGAAAGAATATGG. Internal left primer: CATCTCCGGACACCACTACA. Internal right primer: GCTTCTTCATGAGGCGATCT. Internal WT amplicon: 1193 bp. Deletion size: 823 bp. Deletion left flank: ATCAAGGAAGGTCAGACACTGCTCATCCCG. Deletion right flank: ACTATTGTGGATCCCATCTCGAAGCACGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2879 C. elegans glb-3(ok3630) V/nT1 [qIs51] (IV;V). Show Description
C06H2.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3630 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTGTGAACAAATGGGCAA. External right primer: AATGCGATTGAGATGAAGCA. Internal left primer: TCGAAGAATGAGTCGAGCAA. Internal right primer: TGGACCTGAAAACCAAATGA. Internal WT amplicon: 1341 bp. Deletion size: 975 bp. Deletion left flank: ATTCCTAAAAACGAATTAACCCAAAGTTTG. Deletion right flank: AATGACAGTCTAGGTGTATCTAGAAATATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2896 C. elegans F32A7.4(ok3586)/hIn1 [unc-101(sy241)] I. Show Description
F32A7.4. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3586 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTGTGCGTTATTTCGGAGC. External right primer: CTTTCATCCGTCATTGCTCA. Internal left primer: GACTATTTCTTCGACATTTTATTGC. Internal right primer: GGGTAGATTTTGAAAAAGAAACG. Internal WT amplicon: 1238 bp. Deletion size: 539 bp. Deletion left flank: ATTTGAGGTAAACGAAAAAATAATATAAAA. Deletion right flank: GGCAAGATTAGCCCCAAACTATGCAGAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2897 C. elegans gpi-1(ok3599)/hIn1 [unc-101(sy241)] I. Show Description
Y87G2A.8. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3599 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGTCTGAGCCTCAACCAAAA. External right primer: CTCTCACTCAAAATGCGGGT. Internal left primer: CAGAATTTTGAGAAAATCCAACG. Internal right primer: AGTTTGTAGCCCCTCAGCCT. Internal WT amplicon: 1205 bp. Deletion size: 621 bp. Deletion left flank: ACCAAATCGGACCGAATGTGCACTTCGTGT. Deletion right flank: ATCAGTTGATTCATCAGGGTACTCGACTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2901 C. elegans F52C12.2&F52C12.6(gk3019) IV/nT1 [qIs51] (IV;V). Show Description
F52C12.2, F52C12.6. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3019 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTCTATTTTTCCCCCGAAG. External right primer: TTGCATCTTGCGGTAGACAG. Internal left primer: TTCGGAGCTTCGTTGTTTCT. Internal right primer: ATCCCGTCTCAATTGTCGTC. Internal WT amplicon: 3351 bp. Deletion size: 2297 bp. Deletion left flank: AATTTTAAAATTTTAATTCCTTGTGGCAAA. Deletion right flank: CGACTCGGAAGGCGAAATGGATTTTGAGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2913 C. elegans cTe154X.1(gk3136) III; flp-10&T06C10.3(gk3137) kin-26(gk1263) IV. Show Description
T06C10.4, T06C10.6, T06C10.3, cTe154X.1. The gk1263 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GATGGAGTCGGTGGTGTTCT. External right primer: ATTTTTCAACTGCGAGCGAT. Internal left primer: GCTGGCAGTATTCGGATGAT. Internal right primer: AAATTTGCCGAAACGTGAAC. Internal WT amplicon: 2806 bp. Deletion size: 1036 bp. Deletion left flank: ACAAAATAAACGAGTTTAAAAAAACATTCA. Deletion right flank: TAACAAGGTACAATGGTTCCTGTAGTACTC. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2914 C. elegans C40D2.4(gk1252) II; Y102A11A.2(gk3151) X. Show Description
C40D2.4, Y102A11A.2. The gk1252 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 547 bp. Deletion left flank: AAATTGCAATCGCTTCCGGTAAAATTACTT. Deletion right flank: GTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATA TGTATATGTATATGTATATGTATATGTATATGTATATGTTTATGTATATGTATATGTAT ATGTAAATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTA TATGTATATGTATATGTATATGCTGAAAGTCGA. The gk3151 allele was identifed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2916 C. elegans F45H11.6(gk1242) I. Show Description
F45H11.6. External left primer: TCCTTATCGGGTGACTCCAG. External right primer: TAAGGCGCTGCTTTGATTTT. Internal left primer: GGACGGACACGTTTCAAATC. Internal right primer: TATTATTTGCCTGCTTCCGC. Internal WT amplicon: 1801 bp. Deletion size: 572 bp. Deletion left flank: GAAATATTTGAAGTAAAAATAATAATACAT. Deletion right flank: TTGAATGCCAGTTTTAAGGCACACACTGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2919 C. elegans clec-198(gk3149) IV; W03G11.3(gk1251) X. Show Description
C49C3.13, W03G11.3. The gk1251 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: AATGGAAAACGTTTGAACTTTGTAG. External right primer: AATTCAATCCATCATTTTCTGTGTT. Internal left primer: CATTGCCAAAAGGTGTCATAAA. Internal right primer: CCATCTTGGTACGATGACTCAA. Internal WT amplicon: 2027 bp. Deletion size: 969 bp. Deletion left flank: TATGATACAATGACTAAATATCGTAATCAG. Deletion right flank: TCCCCAATGACAGAATATGCCAAACTTTGA. The gk3149 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2921 C. elegans F55G1.5(gk1250) IV; pgp-10(gk3148) X. Show Description
C54D1.1, F55G1.5. The gk1250 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GCACGTTGCGAAGTAGATGA. External right primer: GCGGTACAACGATTGAAGGT. Internal left primer: TCGTTGCCTGTTGTATGGAA. Internal right primer: CCGATGAAATGGCAAAATCT. Internal WT amplicon: 1387 bp. Deletion size: 621 bp. Deletion left flank: AGTCGTAATCACCACACCAATGGAGCTATT. Deletion right flank: TGCGTCGGTTTCGCCTAGAGCATTTATTTT. The gk3148 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2928 C. elegans C35D6.4(gk1282) IV. Show Description
This strain is homozygous for a deletion (gk1282) in C35D6.4, detectable by PCR using the following primers. External left primer: GCCCAGGATGACAGTTGTTT. External right primer: GACCTGTGGATCCTCCTTCA. Internal left primer: TCATCATGAGTGGTCGTTCC. Internal right primer: TTGAAGTGAGACGGTCCTCC. Internal WT amplicon: 1678 bp. Deletion size: 552 bp. Deletion left flank: AGTTACTATTACTTTTCGATCCCGCCACTT. Deletion right flank: GAAAAAGAAAGAAGAAGCATTCAAGACATC. Validation: gk1282 passed by CGH with low log2 scores. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2929 C. elegans F56H6.6(gk3146) I; Y38F1A.1(gk1246) II. Show Description
Y38F1A.1, F56H6.6. The gk1246 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GCACCCCATTGTTGAACTTT. External right primer: ATGCCACGTAGCAAAAATCC. Internal left primer: TTCCCAAACACAAGAATCCC. Internal right primer: GCTAAGAGATATCGCGCGTC. Internal WT amplicon: 1616 bp. Deletion size: 617 bp. Deletion left flank: GCTCGACAGGGTTGACATGCCAGAACGCGT. Deletion right flank: TCCCGGTGATTGTAAGGTCTTTAGACATAT. The gk3146 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2930 C. elegans C40D2.4(gk1258) II; sru-36(gk3145) V. Show Description
R07B5.6, C40D2.4. The gk1258 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 942 bp. Deletion left flank: ATGAGTGATTTACTTTTAAAACTTGAAAAT. Deletion right flank: ATATGTATATGTATATGTATATGTATATGT. The gk3145 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2931 C. elegans coel-1(gk1284) X. Show Description
C52B9.3. External left primer: CTTGTTTGTTTGTTGGGGCT. External right primer: CGAAAAGGCCACAAAAATGT. Internal left primer: CGAACGGAAGGTACAAGTCC. Internal right primer: ATGGAACACAAACAATGCGA. Internal WT amplicon: 1813 bp. Deletion size: 182 bp. Deletion left flank: ATCATACCGAACTGCGGTCCTGCTGCCTGT. Deletion right flank: GCCAGAGAGCCCTAGAACTTCTTGTGCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2932 C. elegans coel-1(gk1274) X. Show Description
C52B9.3. External left primer: CTTGTTTGTTTGTTGGGGCT. External right primer: CGAAAAGGCCACAAAAATGT. Internal left primer: CGAACGGAAGGTACAAGTCC. Internal right primer: ATGGAACACAAACAATGCGA. Internal WT amplicon: 1813 bp. Deletion size: 268 bp. Deletion left flank: TCCCACCGGACGGCGCACGCAACAGCCCGT. Deletion right flank: TTTGAAATTCAAACTGATCTTCTAACAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2933 C. elegans C35D6.4(gk1281) IV. Show Description
C35D6.4. External left primer: GCCCAGGATGACAGTTGTTT. External right primer: GACCTGTGGATCCTCCTTCA. Internal left primer: TCATCATGAGTGGTCGTTCC. Internal right primer: TTGAAGTGAGACGGTCCTCC. Internal WT amplicon: 1678 bp. Deletion size: 552 bp. Deletion left flank: TGTTACTATTACTTTTCGATCCCGCCACTT. Deletion right flank: GAAAAAGAAAGAAGAAGCATTCAAGACATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2934 C. elegans F38C2.7(gk1244) IV. Show Description
F38C2.7. External left primer: TGCTCCAGTGTGCACAAAAT. External right primer: TTCACAGAGAGTGTGGCCTG. Internal left primer: AAGAGCTGAGCAATGCCAAT. Internal right primer: TGTTGAAGCAAGCAACCAAG. Internal WT amplicon: 598 bp. Deletion size: 392 bp. Deletion left flank: CACCTGATTCCGTACTTGCAATGCCCAGTT. Deletion right flank: TTCTTGGTTGCTTGCTTCAACAGACATTGT. Insertion Sequence: CTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2935 C. elegans gcy-27(gk1267) IV. Show Description
C06A12.4. External left primer: CTTCCGAAAAAGCTGTGGAG. External right primer: TCGGTTTTAGGTGCAGCTTT. Internal left primer: TTGCAATTGCGTTTCGTAGA. Internal right primer: TGCATTGATACCTTTCGCTG. Internal WT amplicon: 2701 bp. Deletion size: 1198 bp. Deletion left flank: TTGTGACCCCATATAATGCAATTTTCAGTA. Deletion right flank: CCGATACTTGATGAGTATGTTCACAACTAC. Insertion Sequence: GGTGACACTGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2936 C. elegans kin-26(gk1261) IV. Show Description
T06C10.6. External left primer: GATGGAGTCGGTGGTGTTCT. External right primer: ATTTTTCAACTGCGAGCGAT. Internal left primer: GCTGGCAGTATTCGGATGAT. Internal right primer: AAATTTGCCGAAACGTGAAC. Internal WT amplicon: 2806 bp. Deletion size: 783 bp. Deletion left flank: CGGCTTGATCTGATAAACAGTTCCATTTCG. Deletion right flank: GATTGACTAGCATACAACCTTCTTTGATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2937 C. elegans unc-38(ok2896) I. Show Description
F21F3.5. External left primer: TGTGATTTGTTGCGTTTGGT. External right primer: ACATCACCGAACAAGCCATT. Internal left primer: TGGCAAAATTTGGCTGAAGT. Internal right primer: TAAAGCTGAAACTCCGCCTC. Internal WT amplicon: 1313 bp. Deletion size: 796 bp. Deletion left flank: TTATTCAAACTTTGCAACTTCTCGTGTTTC. Deletion right flank: CATCTTACATCAATTTGACACATACTCTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2939 C. elegans Y39A1C.1(gk1241) III. Show Description
Y39A1C.1. External left primer: GGTAATGCCGTCTGGAAATG. External right primer: CTGCGTCTCCTCCTCTTCAC. Internal left primer: CCATTCCCTGAAGTTGCAGT. Internal right primer: TGAGCCAGTATGACGTGAGC. Internal WT amplicon: 935 bp. Deletion size: 413 bp. Deletion left flank: CACAGAAACGTGGAATTTCTCTCCCCAGTC. Deletion right flank: GATTTTTCAAGCAATTTTCAGTAGAAACTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2942 C. elegans +/mT1 II; B0285.1(ok3664)/mT1 [dpy-10(e128)] III. Show Description
B0285.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3664 homozygotes (arrest stage/phenotype undetermined). Note: mT1 may have acquired an early lethal in this strain, so mT1 homozygotes may not be seen. Pick WT and check for correct segregation of progeny to maintain. External left primer: TGACATTCATTTTGCCGCTA. External right primer: TCCTTCTCCCATAGTCGTGC. Internal left primer: CTTAGCTCCATACCACCACCA. Internal right primer: CTCGCCTCTGCAAACAATTT. Internal WT amplicon: 1354 bp. Deletion size: 632 bp. Deletion left flank: GATAGCCACTCGGCCTGTGTAAGTTATTTG. Deletion right flank: TTCATCATAAGAATATCGTCCGTCTTATGG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2948 C. elegans frm-2(ok3690) III. Show Description
frm-2. Homozygous viable deletion, detectable by nested PCR. External left primer: AGAGGGGAATATCCCGATTG. External right primer: AGAACAATGGCCAAATCCAG. Internal left primer: GTTGCATTGGGGGAACAATA. Internal right primer: CGTTCGTTTTTCACTTGACG. Internal WT amplicon: 1105 bp. Deletion size: 411 bp. Deletion left flank: CCTGGAAAGTTTATGGAGTATTTGAAAACA. Deletion right flank: ATTTTGCATGGGTTCGCTGTTGATCATTGG. Insertion sequence at break: AAAACCTTGTATAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2950 C. elegans Y108F1.5(ok3700) X. Show Description
Y108F1.5. Homozygous viable deletion, detectable by nested PCR. External left primer: CACAGCTGAAACCGATGCTA. External right primer: GCCACCACTAGGGAAATTGA. Internal left primer: TCAGGGCATGATGAGAGTCA. Internal right primer: TGGATCAATTTTCAGCCACC. Internal WT amplicon: 1261 bp. Deletion size: 839 bp. Deletion left flank: TTTTTGAAAAACCTACTAATGCCCGCGACT. Deletion right flank: ACTGTAGCCCCAAAAGTACGCAAACACGGA. Insertion sequence at break: CTACCCTAAGAGTCCAGTTTTCAGGTTTCTAGTCGAATTTCGACCAGAATCGGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2953 C. elegans C46H11.3(ok3704) I. Show Description
C46H11.3. Homozygous viable deletion, detectable by nested PCR. External left primer: AATTTTACACCCCCTCCAGC. External right primer: GGAGTCTCCGATTGTCCAAA. Internal left primer: GTCCTTGTTTTTGTTGGTTTTT. Internal right primer: AGCTCAATGCCCACTCACTT. Internal WT amplicon: 1318 bp. Deletion size: 391 bp. Deletion left flank: AATTTTTGAATAAATAATAATATTTCAATA. Deletion right flank: CAGGGATCCATTGTTCGAGTGTTGTCCAAT. Insertion sequence at break: GGATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2957 C. elegans rlbp-1(ok3695) I. Show Description
rlbp-1. Homozygous viable deletion, detectable by nested PCR. External left primer: CTGCTTTCCCGTTTCAATTC. External right primer: CTGCAAATGTGCCCTATTGA. Internal left primer: CTATGCCATCCTTTTCTGGC. Internal right primer: TGAAAGAAATACAGTACTTTGTGAA. Internal WT amplicon: 1224 bp. Deletion size: 489 bp. Deletion left flank: TTCTGGCGCGGTGCCAAATTATAGAAAACT. Deletion right flank: GAACGAGGCCGAACGACAGCAGAATTGGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2958 C. elegans sqrd-1(ok3696) IV. Show Description
sqrd-1. Homozygous viable deletion, detectable by nested PCR. External left primer: TCCGTTGTCCTGCTCTTTTT. External right primer: CCTGTAATGACCCACCATCC. Internal left primer: CCAGATATCATACAAACCCCG. Internal right primer: CCAGTTTTATCGACAAATGCC. Internal WT amplicon: 1346 bp. Deletion size: 850 bp. Deletion left flank: GAAATCCGCGGAAGCTATTTTGTACCAGAT. Deletion right flank: CGTTTCCAATAAATCGTTAAAAATAAAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2960 C. elegans C50F2.3(ok3662) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C50F2.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3662 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATGGCCGACAAAGAAAATG. External right primer: TTTTTCCAACTTTTCCGTGC. Internal left primer: ATGCCGAACTCTGAGACGAT. Internal right primer: AAAAGTTGGCGAAATTGGTG. Internal WT amplicon: 1186 bp. Deletion size: 656 bp. Deletion left flank: TGGAGAGCACTCTGTGACACTTATGAGAGA. Deletion right flank: CGAGAAGTGTCGATTATGATGCAAGAAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2961 C. elegans ttx-1(ok2889)/unc-51(e369) rol-9(sc148) V. Show Description
Y113G7A.6. Apparent homozygous lethal deletion chromosome balanced by flanking markers. Heterozygotes are WT and segregate WT, Unc-51 Rol-9 homozygotes and ok2889 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCTCGGGGAGTTGAATTTTG. External right primer: TTTTTCCCGAATTTTTGCAC. Internal left primer: ATGTCTTCCCGCATGAAAAT. Internal right primer: CCAGTGGTCAGAAAGCCAAT. Internal WT amplicon: 1294 bp. Deletion size: 888 bp. Deletion left flank: GTTGTTTTCTAGAAAATCTGAAAATTTTTA. Deletion right flank: TTACGAATATGAAATTTATCAAGGTCTAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2971 C. elegans spe-19(ok3428)/unc-51(e369) rol-9(sc148) V. Show Description
Y113G7A.10. Apparent homozygous lethal deletion chromosome balanced by flanking markers. Heterozygotes are WT and segregate WT, Unc-51 Rol-9 homozygotes and ok3428 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAAAACGTCCAAAGTGTCCC. External right primer: AGTGATTCCCAGATGTCCCA. Internal left primer: TCTCCGAAATGTCCCAGAAA. Internal right primer: CGAAAAATTCGGAAAAATCG. Internal WT amplicon: 1373 bp. Deletion size: 810 bp. Deletion left flank: ACGTCATCCTCCTGAGTTTTTTCGACTTTC. Deletion right flank: TTAAGCCTATTGAAAAGCTCTGAATTGTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2972 C. elegans R148.3(ok3525)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
R148.3. Apparent homozygous lethal deletion chromosome balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok3525 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGAGACAACAGTGAGCCGAC. External right primer: GCTGCCTTCCATGACTTCTC. Internal left primer: CTCATGCTCAACGTCAGGAA. Internal right primer: TGTCGATCGTCTTCTCATCG. Internal WT amplicon: 1190 bp. Deletion size: 862 bp. Deletion left flank: GACGGCGGAGAATCGAGATTTGACAGATAA. Deletion right flank: TCATCGATGAGAAGACGATCGACACGTCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2973 C. elegans nep-1(ok3705) II. Show Description
ZK20.6. External left primer: CTTGGCTCCACACCAAACTT. External right primer: GGAGTGGGCTCAGATTCTTG. Internal left primer: ATCCAACGAAGAAGAGCTGC. Internal right primer: CAACCACTCCATTCCTGGTT. Internal WT amplicon: 1137 bp. Deletion size: 443 bp. Deletion left flank: AACTGCACCAATTCCTCCGTAGTTGAGAGC. Deletion right flank: CTGAAATTTAGTTAAAAGTTAAATAGTGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2974 C. elegans pqn-26(ok3706) I. Show Description
DY3.5. External left primer: ACCCGAGTAGTTGGTGATGG. External right primer: GCAACTTATCCGCCAACATT. Internal left primer: TGGTACAACCGATGAGCTTG. Internal right primer: GCGCTTGGCATTTCTAAAGT. Internal WT amplicon: 1109 bp. Deletion size: 528 bp. Deletion left flank: ACCACTTGTTGTTGAGATATAACTGATCCA. Deletion right flank: GCGAGTTGTTGCTGTTGGGCAATCTAAAGT. Insertion Sequence: GCCTGTTGAGCTGCGATTTGTTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2975 C. elegans bath-5(gk3138) II; Y41D4B.26(gk1259) IV; unc-83(gk3139) V. Show Description
W01A11.3, Y41D4B.26, F07E5.7. The gk1259 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: AGAGTTCGGGGCTGATTTTT. External right primer: AGGAGGGACTTTTTAGGCCA. Internal left primer: AACTGAGCCACTCGGGTAAA. Internal right primer: TGCTGATTGGAAGAAGTGGA. Internal WT amplicon: 2165 bp. Deletion size: 1624 bp. Deletion left flank: CTGAGCCACTCGGGTAAAACTAAATTTTTT. Deletion right flank: ATTTTTTTCTAGAAACTGGACCGGCGAAAA. Insertion Sequence: CCCTTTCCCCCC. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2982 C. elegans gkDf24 I; ikke-1(gk1264) III. Show Description
F11A6.1, W04G5.6, T22H2.1, T22H2.6, F11A6.2, T22H2.5, T22H2.3, R107.4, T22H2.2, W04G5.5, W04G5.10, W04G5.1, W04G5.15, W04G5.9, W04G5.12, W04G5.13, W04G5.11, W04G5.8, W04G5.7, W04G5.14, F11A6.8, F11A6.11, F11A6.5, F11A6.9, F11A6.13, F11A6.4, F11A6.10, F11A6.14, F11A6.6, F11A6.7, F11A6.12, T22H2.4, T22H2.7. The gk1264 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: ATTCTCGCAACAAATCCGAC. External right primer: CAATCGTCATTACACACGGC. Internal left primer: GCTCCGGTTTAGGGAATTGT. Internal right primer: AGTAGCAGTTTGGAAGCGGA. Internal WT amplicon: 2692 bp. Deletion size: 722 bp. Deletion left flank: TGAAGGTTCATGGAAAAAGCTGCGTAGAAG. Deletion right flank: TGCATTTGATGAAAGTCCTCTGTGATTCTT. The gkDf24 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2998 C. elegans T09E8.1(ok3692) V/nT1 [qIs51] (IV;V). Show Description
T09E8.1. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3692 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGATGGACCGGTCACTAAT. External right primer: GGGGTAGGCAAACATTCTGA. Internal left primer: CGATGCTCGGATTGCTTATC. Internal right primer: CCTCAAGTTGTTCTCAGGTTCA. Internal WT amplicon: 1186 bp. Deletion size: 657 bp. Deletion left flank: AACTTGAACTGACACAAAAAGAACAGAGCT. Deletion right flank: GAATTTGAGAGAATGCGATCAGAGAAAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2999 C. elegans R151.2(gk3067) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R151.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3067 homozygotes (sterile, eggs don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACAAAGATCACTCAATCCATCA. External right primer: AACATCGTCGTTCAGAATCTCAT. Internal left primer: TTTCTCTTGGGACCTTTGGTAA. Internal right primer: AAAATGAGCAGAATCGAATGGT. Internal WT amplicon: 1962 bp. Deletion size: 1090 bp. Deletion left flank: AGTTTTGGCAACTTATCAGTTAGAATAAAA. Deletion right flank: CCTCAAAATTTCAGATTGGTTGAAGCCGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3004 C. elegans F59E12.3(gk1277) II; srxa-9(gk3141) X. Show Description
ZK678.4, F59E12.3. The gk1277 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GCATGCAAGAAATGCAAGAA. External right primer: TGAAGTCGCGCACAAATAAG. Internal left primer: TCACAAATGGAAACGTGTGG. Internal right primer: CAACGAGGCCAAAGTGATTT. Internal WT amplicon: 1320 bp. Deletion size: 588 bp. Deletion left flank: AGGCAATAAATGTTCATTATCGACTGCCAT. Deletion right flank: ATCGATGGACTAAGCTTCTTTGAGGAGCCA. The gk3141 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3007 C. elegans F53H4.5(gk1273) X. Show Description
F53H4.5. External left primer: CTTCCGTCTTAATTTTTGCACC. External right primer: GCAATATCATCGGCTAATGTCA. Internal left primer: GGGCATAGTTTAAGTCACGTCC. Internal right primer: TTTTTCCAAAACGCTCAAAAAT. Internal WT amplicon: 1259 bp. Deletion size: 430 bp. Deletion left flank: CCAATCAGTGCTCCGCTAAGTGTCAGAGCA. Deletion right flank: ATGTAGATCAGAGCTGTGCAGCAGCCGAGA. Insertion Sequence: C. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3008 C. elegans T06G6.5(gk1278) I. Show Description
T06G6.5. External left primer: GCAACCTCTACCGTAACCCA. External right primer: GGGCATATACTCTGGCGAAA. Internal left primer: TTCGCACATATCTGTTGGTTTC. Internal right primer: ATGGGTACATTTTTGGAACTGG. Internal WT amplicon: 1372 bp. Deletion size: 1128 bp. Deletion left flank: ATATCTGTTGGTTTCCATATTTCGAAAATG. Deletion right flank: CCACTTACCATGTAAACACATCTACTCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3009 C. elegans ell-1(ok3699) IV. Show Description
Y24D9A.1. External left primer: TTTTTCGATGATTTTTCGCC. External right primer: AAATTTTCGACAAAAAGCCG. Internal left primer: TTAAAAATTCCGCGTTTTCG. Internal right primer: TTCAAACAAAAATCAGCCCA. Internal WT amplicon: 1340 bp. Deletion size: 717 bp. Deletion left flank: CAAGAGAAATGACTCGAAAATTTTAAATAC. Deletion right flank: CGCCGGAGCCGGCGAATAAGCGCCGTGCTC. Insertion Sequence: AAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807