More Fields
Strain Species Genotype
VC2666 C. elegans ceh-6(ok3388) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K02B12.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3388 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTCTTTCTTCCAGCTTGCC. External right primer: TAGGGCCAGAAAATTGAACG. Internal left primer: AAATGTAGAATTGGGCGAGC. Internal right primer: GGTAGGCGCACATACCATTT. Internal WT amplicon: 1129 bp. Deletion size: 405 bp. Deletion left flank: TCTGAATAATTTCAGGTCGTTCAACTTCCT. Deletion right flank: AAAATGGTATGTGCGCCTACCAATTGAAAA. Insertion Sequence: AAAAGGATTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2670 C. elegans sos-1(ok3565) V/nT1 [qIs51] (IV;V). Show Description
T28F12.3. Apparent homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3565 homozygotes (arrest stage/phenotype undetermined). Any viable non-GFP progeny are not homozygous mutants but rare recombinant heterozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTGGTTGCAGTCAGGGAAG. External right primer: AAAAGCGTGCTCGACAGAAT. Internal left primer: TCGCGATTTGAAAAGTTGTG. Internal right primer: GACAATCACGAAAAGGAAGAGG. Internal WT amplicon: 1126 bp. Deletion size: 884 bp. Deletion left flank: TCTCATCATGATGTCTCGGTATTTTTTTGT. Deletion right flank: CGTATAAGAATGATATGTCAGTCGTTCAAT. Insertion Sequence: ACAAAACAAAATATGCTTGACTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2674 C. elegans plk-3(gk1103) IV. Show Description
F55G1.8. External left primer: ACGTCACACGATCTGCACTC. External right primer: ACCGCCAATTATCTACGACG. Internal left primer: TGTTTCTGATATCGTGGCGA. Internal right primer: TACACAATCCAAGTTGCCGA. Internal WT amplicon: 2311 bp. Deletion size: 1122 bp. Deletion left flank: TAAAGATCGAATTATTCACAGATTAGTTGT. Deletion right flank: ATATGTTGGCTCAATCGTAGTCTTGAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2675 C. elegans gcy-15(gk1102) II. Show Description
ZC239.7. External left primer: GGCTTACCTTCAACCCAACA. External right primer: CGATTCATTGCACACACACA. Internal left primer: AAGCGTCTGCAATTGTCTCC. Internal right primer: GCCATATTGCAACACCACAA. Internal WT amplicon: 2326 bp. Deletion size: 1188 bp. Deletion left flank: GACGATACGCGGAGACTCCTTGAGCACAGC. Deletion right flank: GATATCACAATGATGAATGTATTGTTCGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2676 C. elegans M01B12.5(gk1101) I. Show Description
M01B12.5. External left primer: CGCCAATCCTGGTTTAAATG. External right primer: AGAACCTCTTTTGCGGGTTT. Internal left primer: ATTCCCACGCAAATAAATGG. Internal right primer: TCGAGCTGATCGTGCTACTG. Internal WT amplicon: 2467 bp. Deletion size: 575 bp. Deletion left flank: GGGAATAAATTCAATTTTTTTTCATTTTTT. Deletion right flank: ATTTTTTAAAATAAAAATATTAAATGTTTT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2677 C. elegans Y47G6A.5(gk1098) I. Show Description
Y47G6A.5. External left primer: TAGGGAATATCGATCGGCTG. External right primer: CGCGTCAATCATGGTGTATC. Internal left primer: TTCAACTACCGTAGCCGAGG. Internal right primer: GATCCGAAATGAATAACCGC. Internal WT amplicon: 1768 bp. Deletion size: 720 bp. Deletion left flank: CTCCACCACTTCGTCCGTCTACACAATCAG. Deletion right flank: CATCATATCCTACGCGCAATTTTCAAAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2678 C. elegans Y47G6A.5(gk1100) I; meg-1&K02B9.3(gk1205) X. Show Description
Y47G6A.5, K02B9.1, K02B9.3. External left primer: TAGGGAATATCGATCGGCTG. External right primer: CGCGTCAATCATGGTGTATC. Internal left primer: TTCAACTACCGTAGCCGAGG. Internal right primer: GATCCGAAATGAATAACCGC. Internal WT amplicon: 1768 bp. Deletion size: 371 bp. Deletion left flank: TAACATTTCGCGGCATCCATCAGCAACTTC. Deletion right flank: GCAACTTTTTCAAAATTAAAAAAAAACAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2680 C. elegans F54D10.7(ok3404)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F54D10.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3404 homozygotes (sterile with few eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GCCGAGATTTGGAGAAATGA. External right primer: AAGGCGCAGGACAACTACAT. Internal left primer: CAACAACATTCACAATCTTCATCA. Internal right primer: TGTGTGTCCTTTTCCCGTTT. Internal WT amplicon: 1124 bp. Deletion size: 643 bp. Deletion left flank: CTTAATTCCAGCTTCCTCAAGAGTTTGATT. Deletion right flank: TTTCTTTGTTGAAAGCGTCTTGGATCTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2682 C. elegans rpl-18(ok2217) IV/nT1 [qIs51] (IV;V). Show Description
Y45F10D.12. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2217 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTCTACAGCGAACTCGGGA. External right primer: TTCCACGTATACGCCAACAA. Internal left primer: GTTGTCCGTGGAGAAGGGTA. Internal right primer: TTTTATGCAGATGGCAACCA. Internal WT amplicon: 2215 bp. Deletion size: 1161 bp. Deletion left flank: TTCTACTAGCCTAAAATTTTTTTCACGTTT. Deletion right flank: GAAGGAAGGAACAATAACGATACACTTATC. Insertion Sequence: CATATATTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2683 C. elegans set-6(ok2195) X. Show Description
C49F5.2. External left primer: CGTCGGACAGTTCAATTTCA. External right primer: CTCAGAAGTGACAACGGCCT. Internal left primer: GTCGCCTCCATTTCAGGTTA. Internal right primer: TCATCCATTGGCCATTATCA. Internal WT amplicon: 3363 bp. Deletion size: 1108 bp. Deletion left flank: TTAAAACTGAGAAATATACTTACAAATTTC. Deletion right flank: TCTATAATGTCGTCGAACCTAACAGCTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2688 C. elegans F45C12.1(gk1292) II. Show Description
This strain is homozygous for a deletion (gk1292) in F45C12.1, detectable by PCR using the following primers. External left primer: GCGCGCATAATTATCACCTT. External right primer: CACTGCACGCAGACTTTGAT. Internal left primer: AACTGCACATTCCATCACCA. Internal right primer: GTAGAGGACCACAGGTTCCG. Internal WT amplicon: 1555 bp. Deletion size: 1237 bp. Deletion left flank: CTCGCAAATAAAAAGCTTTTCCATTTTCCA. Deletion right flank: TGGGCCCAAAACCTCTACAGATTTATGCCA. Validation: gk1292 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2689 C. elegans ztf-30(gk1287) III. Show Description
This strain is homozygous for a deletion (gk1287) in C06E1.8, detectable by PCR using the following primers. External left primer: CCCGCAAACAGGAAGAAATA. External right primer: CTGCTGCTCCAAAACATTGA. Internal left primer: GCACAGTTTGTTCCAATCCA. Internal right primer: TTCTTCTTCCTCCTCCGTCA. Internal WT amplicon: 2185 bp. Deletion size: 1044 bp. Deletion left flank: TGTTGTTGCTGTCATTGTTGTTAGTGGCAG. Deletion right flank: AATCATTATAAAAGTAAGAACCTAATCAGA. Insertion Sequence: CAG. Validation: gk1287 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2690 C. elegans Y37F4.6(gk1113) I. Show Description
Y37F4.6. External left primer: GCGGGACTGTGTTTCAATTT. External right primer: CAGAAGTTTGTGGGTTCGGT. Internal left primer: CTCAGCAAAGGCCAATCTTC. Internal right primer: ACTCCATATCTCCGCAGGAA. Internal WT amplicon: 1919 bp. Deletion size: 882 bp. Deletion left flank: AGCAAACTGAATATTACAAAGCCCGCATTT. Deletion right flank: AAACTTGTTAAACACAATGTGATCTAAAAC. Insertion Sequence: AAAAAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2694 C. elegans +/mT1 II; ZK1010.2&ubq-2(ok2028)/mT1 [dpy-10(e128)] III. Show Description
ZK1010.2, ZK1010.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2028 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCTCCAATTCAGGTCGTTCC. External right primer: TCATATCGAATTCATCGGCA. Internal left primer: TCCAAATGTTTTCCCGAGAG. Internal right primer: CTGGACGCTTGTTCAGCATA. Internal WT amplicon: 2149 bp. Deletion size: 896 bp. Deletion left flank: TGAAGCAACTGGGCGTCTCTTCTTCATCTT. Deletion right flank: GATTTTTCTTTAGAGACTAGTTTCAAAGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2695 C. elegans C05D10.2(gk1234) III. Show Description
C05D10.2. External left primer: CAACTATTCTAGAGCCGCCG. External right primer: GCACGACTCTTATCTTCGCC. Internal left primer: ATACTCGGAGCGTGAGTCGT. Internal right primer: TCCGGAAGTGGTGGATAAAC. Internal WT amplicon: 2660 bp. Deletion size: 1407 bp. Deletion left flank: GTCATGATCATCATCATATTTTTATTATCA. Deletion right flank: GCTCCTCAAAAACGATTAACCGTTGAACAA. Insertion Sequence: TTTTTATTATATATTATCATTTTTATTATTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2697 C. elegans C45G9.1(gk1235) III. Show Description
C45G9.1. External left primer: GAAGGCCGAATCAAATGAAA. External right primer: AAACTGCGAGAAAATCCGAA. Internal left primer: CCTTTGCGCGTAAGATATGG. Internal right primer: ATCAATTAGGCTTCGGGCTT. Internal WT amplicon: 1743 bp. Deletion size: 1228 bp. Deletion left flank: TCTCCTATATGGTCATGACGTTATTGGGGA. Deletion right flank: TCTTATGGAAAACAAAATTTAATATTCTAT. Insertion Sequence: TGGAAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2698 C. elegans F33D11.7(gk1229) I. Show Description
F33D11.7. Identified by PCR, validated by CGH. External left primer: TTGGCTGCCTACTCTCCACT. External right primer: TTTACGTGTTCGGCCTTGAT. Internal left primer: GACCATTTCGGCACAACTTT. Internal right primer: ATACGATCTACGTGGCGGAG. Internal WT amplicon: 1225 bp. Deletion size: 945 bp. Deletion left flank: CACGTTGGAGCAACATGCACAAGACACTGA. Deletion right flank: TGTTACAGAAATATTGATACTTATACATAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2699 C. elegans rpn-1(ok2205) IV/nT1 [qIs51] (IV;V). Show Description
T22D1.9. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2205 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTTGACCAACACGAACAGA. External right primer: TGACTGCGCCTTTAAACAAA. Internal left primer: TCAAGCTTCCAGGCTTCATT. Internal right primer: TGGTGGCGACTACTCAACAG. Internal WT amplicon: 2938 bp. Deletion size: 1651 bp. Deletion left flank: TATGAACAAGGGAATAGCCAAAACTCGAGG. Deletion right flank: ATGGCTTGTAAAGTGTTGTGTCCGGTTCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2701 C. elegans F29C12.4(ok3372)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
F29C12.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3372 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAACGAACGGAAAACAACG. External right primer: GTGCATTTTTATTCCCGCAT. Internal left primer: CGCGTACTCCTCTCGGATAA. Internal right primer: TGGGACATATTAGCACCACG. Internal WT amplicon: 1208 bp. Deletion size: 371 bp. Deletion left flank: TTATTTTTAAATTATTTTAATAGTTTTTTT. Deletion right flank: ATTATTGATACACCAGGCCACGTGGATTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2705 C. elegans zwl-1(ok2378) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y39G10AR.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2378 homozygotes (sterile Unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCGCGAAAACAAAACAATTT. External right primer: TGAGGAAATTTCGGCTCATT. Internal left primer: TTTCCCAGAAAATGCCACTC. Internal right primer: GCAACTCTGGCATGCTTTTT. Internal WT amplicon: 2881 bp. Deletion size: 2093 bp. Deletion left flank: CAGCGGTTGTGACAAAGAAAAGTGTGCGAA. Deletion right flank: TTGCAACGGAGAATCGACCGGCTCCTGGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2706 C. elegans wve-1(ok3308) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R06C1.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3308 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAAAGCTGGGACTTCGTTG. External right primer: TTTTGGCTGCTCGCTTTTAT. Internal left primer: GGGTTTCTAGCGATTTTTCCA. Internal right primer: ACGATTTTCGTGCCAATTTC. Internal WT amplicon: 1322 bp. Deletion size: 556 bp. Deletion left flank: TTGGCCTGCTCGGGGAGCACAAGAGCTGTG. Deletion right flank: CTGTAGGTAAAGTGCTTCTATCCAGAATAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2708 C. elegans +/szT1 [lon-2(e678)] I; elt-2(ok3382)/szT1 X. Show Description
C33D3.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3382 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCATGCAACCGTTTTATCCT. External right primer: TTGGGAAAAGCAACTCAACC. Internal left primer: CTCTTGGAACTTTTTCGGGA. Internal right primer: ATAAGCGAGGAAGTGGCAAA. Internal WT amplicon: 1306 bp. Deletion size: 1171 bp. Deletion left flank: TGGAACTTTTTCGGGATATACAAACTCGTA. Deletion right flank: GTTCCAAACGATCAAAACTACGTGTATGCA. Insertion Sequence: CCAAACGATCAAAACTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2709 C. elegans Y110A7A.8(gk1094) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y110A7A.8. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1094 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. (Note: in this strain hT2[qIs48] occasionally recombines such that the GFP and its associated lethality are lost and the non-GFP hT2 left behind still carries the bli-4 mutation of the original hT2. Such a recombination event results in a viable non-GFP animal that is no longer gk1094/hT2[qIs48] but is gk1094/hT2.) External left primer: TTTCATTCTCTTCGCGACCT. External right primer: CACACTCCAGCACTGGAAAA. Internal left primer: TGCAGCAATGAAGAGAAACG. Internal right primer: TTTCGCATATGGGTCGAAAT. Internal WT amplicon: 2229 bp. Deletion size: 1953 bp. Deletion left flank: AGCGAACTGCAGCAATGAAGAGAAACGAGA. Deletion right flank: ATATATTTATTTGTTACTTTCCTCTTCCTG. Insertion Sequence: GAACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2712 C. elegans F52F12.7(ok3347) I. Show Description
F52F12.7. External left primer: ATTGTCGCGGAATTTTATCG. External right primer: CGATTCGTGACCGTATCCAT. Internal left primer: CAAACACCATGACGCAAAAC. Internal right primer: CGTCCGATGACCTGATTAAC. Internal WT amplicon: 1151 bp. Deletion size: 547 bp. Deletion left flank: GGAATGGAATGGAAGCTCTTCCCGAGTGGA. Deletion right flank: CTGATTTGAAAGGATACCTCCCAAAAATGA. Insertion Sequence: TTTATTTGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2725 C. elegans gei-1(gk3062) III; C25A8.5(gk1224) IV. Show Description
C25A8.5, F45H7.2. The allele gk1224 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: GTGGAGCGTTCGGTACATTT. External right primer: TCACACCCCTGACAGGTACA. Internal left primer: AACGGAACCGTTGAGAATTG. Internal right primer: GCCGCCTCACAAGTTAGTTT. Internal WT amplicon: 2303 bp. Deletion size: 1432 bp. Deletion left flank: TTTCCAACGAAAATGTGACTTTTTCAGGAA. Deletion right flank: ATCTACCCATCTTGAGATCAAAACTTTCGA. Insertion Sequence: CAATTTTATTTTAAAAAATGCTCTGTGCCGCTTTTGTCGATACAACTTCTGAAATTTTC AAAACCACCGCGGTGCCTCCCAGTAGGACTTCAAAAATTG. The allele gk3062 was identified by CGH but not confirmed by PCR. Left flanking probe: GAAAAAGATGGATCTAAGATCCACTAATAAGTGAGTACACATACAGTGTG. Right flanking probe: GAAATTTGATTCCGGACCGTATGTACGATGATCTCGATGACCTACCTCTG. Left deleted probe: ATCTACTGTTTGCAGACGACCAAAAGAAACACGTGGCAGACCTGCTCCAA. Right deleted probe: GTTATTTTGTTTTTATCAGCTTCAAGGCGGTCTACATCTGCCTTGCGCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2726 C. elegans pfd-6(ok3600) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F21C3.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3600 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGAATTTGTGGTTGGGGATT. External right primer: ATTTCAACGCTGCTGGAGAC. Internal left primer: ATGATGGCTGACTTTGAGCA. Internal right primer: TGCAAAGTTGGTTTTCACGA. Internal WT amplicon: 1193 bp. Deletion size: 445 bp. Deletion left flank: ATTTTAAAACGTTTAAAGGTAAAATTTATT. Deletion right flank: AAAAGAAGTGAAAGAAAACAAAATTGTGTT. Insertion Sequence: AT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2727 C. elegans +/mT1 II; klp-19(ok2481)/mT1 [dpy-10(e128)] III. Show Description
Y43F4B.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2481 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTCCCATGAAGTTTGTCGT. External right primer: ATTGTGCGTGAACTCTGACG. Internal left primer: TTCTCATCGACCCGATTTTC. Internal right primer: TTTGATTTCAAAAGCCTCCG. Internal WT amplicon: 3279 bp. Deletion size: 1984 bp. Deletion left flank: AGACAAAATAGGACAATGGGAAAAACAGAC. Deletion right flank: GGTGTTCATGATTCTTTGGAACAACGCACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2731 C. elegans ahcy-1(ok3601) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K02F2.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3601 homozygotes (mid- to late-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACGAGGAATACGAATGGTGC. External right primer: CGAAATGAGTGAAGCGTTGA. Internal left primer: CAAGGATGGACAACCACTCA. Internal right primer: CGGGTAGATGGGGAACAATA. Internal WT amplicon: 1126 bp. Deletion size: 715 bp. Deletion left flank: AAAGGGATCTGCTGCTTCCCTCAAGGCTTT. Deletion right flank: AAATTGTATTGCCCTCAAACTTCATATGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2733 C. elegans C08C3.4(ok3550) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C08C3.4. External left primer: TTACTTTTATGCCGGCCAAC. External right primer: AGCACTAGAAATGCGCCAGT. Internal left primer: TGTCGACGAGAACTGACATTG. Internal right primer: CTTTTCTTCAATTTCCGCGA. Internal WT amplicon: 1184 bp. Deletion size: 589 bp. Deletion left flank: GCTGTTTGGGTCACATTGAGACATGGCGCA. Deletion right flank: AGTGGTTTCCTCATTGGGCAGAAGGTGATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2734 C. elegans F40G9.2(ok1784)/sC1 [dpy-1(s2170)] III. Show Description
F40G9.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok1784 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAGCCAGCAGTTTTCAAGG. External right primer: TTTCCAGTTGCCATAGTCCC. Internal left primer: GGAAACGTGCAAAATTCGTT. Internal right primer: ACTCGGCCTCTTCCATTTTT. Internal WT amplicon: 2481 bp. Deletion size: 1696 bp. Deletion left flank: ATTAGCAGACCCAAGTATGGTCTGCTAAATAATTAGC. Deletion right flank: TGCTAAATATTTAACAGACCCAAAACTACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2735 C. elegans +/mT1 II; M142.5(ok3554)/mT1 [dpy-10(e128)] III. Show Description
M142.5. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3554 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCCCCTCAAAAATCACGAC. External right primer: CGATTGGAAATTATCGGGAA. Internal left primer: AATGTTCAGTGTGGGTTCGC. Internal right primer: TTTTTAAATCGGCTTCAAATTCA. Internal WT amplicon: 1168 bp. Deletion size: 467 bp. Deletion left flank: TTTATCGACCCGTTTTTGTGCAGTTTCTTG. Deletion right flank: TACACGGACCACCGAACGGCTCGACAAAAC. Insertion Sequence: ACCGTTTTTGTGCAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2736 C. elegans Y48E1B.2(ok3557)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
Y48E1B.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3557 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCGCGTACTTCTCCAACAAT. External right primer: TCTCGCAATCGGAATCTTCT. Internal left primer: CAGCTCTCTCCACCGTCTTC. Internal right primer: ACGTTCAGGAGGTCACCAAC. Internal WT amplicon: 1169 bp. Deletion size: 674 bp. Deletion left flank: GCAAGCCTCGGGTAGATGCTTCCGGGAAGA. Deletion right flank: CAGAATCTTCTGATAGCTGGGCTCCTGGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2737 C. elegans B0495.7(ok3607)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
B0495.7. Maternal effect lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3607 homozygotes (first-generation homozygotes viable and fertile, but F2 arrests as grotty L1 or L2). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAACTCAGGATTGATCGCGT. External right primer: TTGGTGTGAATCGTCTCGAA. Internal left primer: ACACATTGGCTGATGGCATA. Internal right primer: CGTCCATCTGGATGTTTTGA. Internal WT amplicon: 1316 bp. Deletion size: 797 bp. Deletion left flank: GCAATGATAAGAAGCATTGTAATTACCATT. Deletion right flank: TCCCTTCTTCGGACCAATTCTCACAACGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2739 C. elegans +/szT1 [lon-2(e678)] I; unc-115(ok2640)/szT1 X. Show Description
F09B9.2. Homozygous viable deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2640 homozygotes (Unc). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCTCATTTTGGTGACGGTGA. External right primer: AAAGGGCAATGAGTTTGCAC. Internal left primer: AGACGAGATCTGGCATCCAT. Internal right primer: GAGAAGAAGAAAAGGCGCAC. Internal WT amplicon: 1358 bp. Deletion size: 512 bp. Deletion left flank: GCAGAATAAAAATTAAAAAAAAATGTTTAA. Deletion right flank: TTGAATCAGTAGCTGGCTATAGAGCACAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2740 C. elegans lgc-12(ok3546) III. Show Description
R13A5.4. External left primer: AGCGAGAGCTGGTGAAACAT. External right primer: CTCGGACAATTTTCGCGTAT. Internal left primer: CCAATTTACTCGACCTGTAAAAA. Internal right primer: TGCATCAAATTAGGTGTCCG. Internal WT amplicon: 1216 bp. Deletion size: 744 bp. Deletion left flank: ACGTAAGTTATGGTAAATAACATACTTTTT. Deletion right flank: GCAATACCGTTCCAGCATTTTCACAGTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2741 C. elegans frm-1(gk1225) I. Show Description
ZK270.2. Identified by PCR, validated by CGH. External left primer: AATGGTGACACGATGCTCAA. External right primer: ACACAGACACAGCAAGACGG. Internal left primer: GTTAAATTCCAGTGGCTGCG. Internal right primer: GAAGCCGATGGACAAAGAGA. Internal WT amplicon: 796 bp. Deletion size: 98 bp. Deletion left flank: AAGTGATCATTCGACCTTTAAAAGTGATGT. Deletion right flank: TTTGGGTGTACCAGTTAGATATATTGGGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2742 C. elegans unc-30(gk3024) Y67A10A.104(gk3025) IV; str-183(gk3061) V; ZC374.2(gk1222) X. Show Description
ZC374.2, B0564.10, Y67A10A.104, T13F3.1. The allele gk1222 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TTGGAAGTTTTGGCAGGAAT. External right primer: CTTGCGTTAATCGCATGTGT. Internal left primer: TCCAATTTGAGCGATCAGTG. Internal right primer: AGGACGCGCAGATTGTTAGT. Internal WT amplicon: 2448 bp. Deletion size: 1618 bp. Deletion left flank: CATTTTTCAGTGCTGTTTCTTCCACATTAT. Deletion right flank: TCAGATCTTCTAACTCGCGTTTCTAACTTT. The allele gk3024 was identified by CGH but not confirmed by PCR. Left flanking probe: TTTCGACTGCTGCAAATTTGGCACCTCTACCAACGTGAGTTTTACGGATA. Right flanking probe: TTGTTTGAGCTGCCGGGATGCCAGGAGGAGGGAACAGACAGAGCAGGTAT. Left deleted probe: AAAAATTATAATTTACATTTTTCCAGAGCCCAAGCTGCATTCTCCACATC. Right deleted probe: TTCCTCATCGCTCGGCCAACCTTATCAACCCTGTCAGTACAGTGGACCAC. The allele gk3025 was identified by CGH but not confirmed by PCR. Left flanking probe: GGGATTCGTGGTCGAGATTGCCAGTCCAAGGCTTGGTCGGTTTCAGGTTG. Right flanking probe: GGTTAATGTGAAACTTGATTTAACTGTTCCACGAGTATGCTTTAACAATA. Left deleted probe: TGATTCGCAAAAACAACGAATTGTATAGAACTCACACTTTAAGACATCTA. Right deleted probe: AAATTGCTTACTGACTTTGATGCAAAACAGGTGATTTTTCGGGTTCTAAA. The allele gk3061 was identified by CGH but not confirmed by PCR. Left flanking probe: CAGATTATCTCACTTACTGTTATTGCATATTGTGGGACATGTTGCTACTA. Right flanking probe: GGATCACATACTAAACTTAATTCTTTTCAGACCGCAATACCAATGCTTCT. Left deleted probe: ATATTGTGGGACATGTTGCTACTATAAAATACAACAGCAAATGAGGGTTG. Right deleted probe: ACCTACATCGTCAACTGTTCTACGCTTTGGCAATCCAGGTTTGACGCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2743 C. elegans ZC374.2(gk1220) X. Show Description
ZC374.2. Identified by PCR, validated by CGH. External left primer: CGCTATCCGTTCTCTTTTGC. External right primer: GACAGGTGTGCGAGGTATGA. Internal left primer: ATACCTTTCCGACGTGCAAT. Internal right primer: AATATGACGAAATGTGGCCC. Internal WT amplicon: 2736 bp. Deletion size: 940 bp. Deletion left flank: GATAATGAATGTGAAAGAATGAAGTTAATT. Deletion right flank: CTTACAAATTGCAGAACTATTTATTAGAAT. Insertion Sequence: AGAAAGAATGAAGTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2744 C. elegans acs-1(gk3066) V/nT1 [qIs51] (IV;V). Show Description
F46E10.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3066 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTCGATCAGCAGTTGACCA. External right primer: CAAAGTTGGCAATGGTTGTG. Internal left primer: CAACACAGTTTGCCAGTGCT. Internal right primer: GAGACGACTTGCTGGAGACC. Internal WT amplicon: 2067 bp. Deletion size: 880 bp. Deletion left flank: TTTATTTTAAAAAATATTTAAAAAGTTTTA. Deletion right flank: TATGACTGACATGCAAGTATGCTATGGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2754 C. elegans hsp-60(ok3508)/sC1 [dpy-1(s2170)] III. Show Description
Y22D7AL.5. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok3508 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAATTGATTTTTCCCGCTGA. External right primer: AGGGGAAAAAGAGCCGTAAA. Internal left primer: GAAATTTTGGTTTTCCTGCG. Internal right primer: CAAATGGCTCAGAGCACAAA. Internal WT amplicon: 1227 bp. Deletion size: 611 bp. Deletion left flank: AAAAATTTGAATTTTTCGTGAAAATTTGAA. Deletion right flank: GCTCTCAATCTCTCATTGAAATAACGACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2755 C. elegans F01D4.3(gk1221) IV. Show Description
F01D4.3. Identified by PCR, validated by CGH. External left primer: TCCTCCAATGGTGGTTGACT. External right primer: CCGGATGGAGACAAAAAGAA. Internal left primer: ATCACTTGCTCCGGTTTCAC. Internal right primer: CCAATTCAGTCTGATGGCAA. Internal WT amplicon: 1179 bp. Deletion size: 505 bp. Deletion left flank: TTTCTCCGCAATCGGTACAACAGTTCCAGT. Deletion right flank: CGCTATTCCAAATACATTTTTCTTTTCAGT. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2759 C. elegans C40D2.4(gk3018) II. Show Description
This strain is homozygous for a deletion (gk3018) in C40D2.4, detectable by PCR using the following primers. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 847 bp. Deletion left flank: GGAAATTCATTTTATCGATTTTTCATATAA. Deletion right flank: CTCATAATAATTTAATATATGTGACGTTGA. Validation: gk3018 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2760 C. elegans ZK524.4(gk1212) I. Show Description
ZK524.4. Identified by PCR, validated by CGH. External left primer: GAAGTACCTGCTGCTTTGCC. External right primer: TATATGCAACTGCGCTCCAG. Internal left primer: GCTATTGCTCCAGCAACCAT. Internal right primer: TATGTCAAATGCGCCTGAAA. Internal WT amplicon: 1629 bp. Deletion size: 823 bp. Deletion left flank: AGCATATACAAAATAACACCTAATGACCAT. Deletion right flank: CCCTGATGTGCAACGATGATTTTCGGCGGA. Insertion Sequence: GTTCAGCATGGTCAAATATAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2761 C. elegans nhr-243(gk1213) V. Show Description
Y80D3A.4. Identified by PCR, validated by CGH. External left primer: ATCCAAAACTTCAGAACCTAGCC. External right primer: CCCATTCTCTTCTTCTCCATCTT. Internal left primer: CCGAGTTTTTCAGAACCTAGTCA. Internal right primer: ATTTGAGATTTTCGGCTTATTCC. Internal WT amplicon: 1092 bp. Deletion size: 244 bp. Deletion left flank: TTAAAAAAAGTGTTTTCGGGAATTTCAAAA. Deletion right flank: CTGGCTGAGTTCTAGAAACATAGGTTTTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2762 C. elegans F28D1.1(ok3338) IV/nT1 [qIs51] (IV:V). Show Description
F28D1.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3338 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAGCAGCTTGAACGACATGA. External right primer: AACATACTCGTGAATCCGCC. Internal left primer: GAGGAGGATCACTCGCTGAC. Internal right primer: GTCCAATTCCGAGCACATCT. Internal WT amplicon: 1167 bp. Deletion size: 433 bp. Deletion left flank: ACAGCTCGCCTCGAATTTCTTCCCCATCAT. Deletion right flank: CGTGTAAAGAGCCGTATTTGGTGCACAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2763 C. elegans myrf-1(ok3445)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F59B10.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3445 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCCGTAGTTTCGGTTATGCC. External right primer: AGCTTTGCTGGTATTGACGG. Internal left primer: TCAAGGACATAAAGAGCTGACA. Internal right primer: GTCAGCAACAGGCAATCAGA. Internal WT amplicon: 1381 bp. Deletion size: 636 bp. Deletion left flank: GAAGACAAGCGGCCATAATGGAAACCAAGG. Deletion right flank: ACAGGGCTCCTCCATTTCGTTGCCATCCAA. Insertion Sequence: GCTCCTACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2771 C. elegans Y39G8C.2(gk1099) II. Show Description
Y39G8C.2, K03H6.5. External left primer: AAAGAGTTGAAGGCAGGCAA. External right primer: TGAGGAAAATGACCGAAAGG. Internal left primer: GTCGAGCAGCAGGTAGAACC. Internal right primer: GCAAGTTTCCGGAATTGAAA. Internal WT amplicon: 2604 bp. Deletion size: 1081 bp. Deletion left flank: CGCCGGCGCTCGAGCGTTTTAGCGTGCCGA. Deletion right flank: CTTTGTGTACTGCGGCCGACGCTGCACGGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2772 C. elegans nhr-201(gk1112) V. Show Description
M02H5.3. External left primer: TTGTTCCCCAGCACTTTAGG. External right primer: CTCCCGAAACACGGCTAATA. Internal left primer: TAGAACCACATGGTTTCGCA. Internal right primer: TTCCGGGTGCGAGTATTTAG. Internal WT amplicon: 1776 bp. Deletion size: 743 bp. Deletion left flank: TAAAACTCCAAATGCACTGAAAAGGCTTGC. Deletion right flank: AGCTCATTAATGCTATACAGCTATTTTTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2773 C. elegans bub-3(ok3437) II. Show Description
Y54G9A.6. External left primer: GCCCACTTTCACCACATCTT. External right primer: AATCCACATAAAACGCTGGG. Internal left primer: AACCACGCGGAAAACAATTA. Internal right primer: GCCTATTTTCCTCGATTTTCG. Internal WT amplicon: 1127 bp. Deletion size: 335 bp. Deletion left flank: ACTATGAGATTTTTGCAATTTTCAAAAAAA. Deletion right flank: GAAGCTACGGAAACGGCGCCATCGAGTCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2775 C. elegans cct-2(ok3438)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T21B10.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3438 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGATCCTGAAGTCAATCGGT. External right primer: CAGCAACCTCTCCTTTCTCG. Internal left primer: TCCTCAAAGAAGCCGAGAAA. Internal right primer: AATGAACAAACCGATTCCCA. Internal WT amplicon: 1112 bp. Deletion size: 633 bp. Deletion left flank: AAGATTCTCATTGCCAACACACCAATGGAC. Deletion right flank: GACTCGGCTGAACTTGTCACAAGACTCCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807