More Fields
Strain Species Genotype
VC2496 C. elegans ilys-3(ok3222) IV. Show Description
C45G7.3. External left primer: ATGCCAAAATCAAATGCACA. External right primer: CCACCTAAACACTTCCGTCC. Internal left primer: CTCCACTTCCTGTTTGCCAT. Internal right primer: TATGGGGTTTCCTGCAGATT. Internal WT amplicon: 1156 bp. Deletion size: 855 bp. Deletion left flank: TGAACTGTATCTTTGGTAGAATGGGTAGTA. Deletion right flank: CAGGGAGCATGCGAAGTGATGGCTCGTAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2497 C. elegans flp-3(ok3265) X. Show Description
W07E11.2. External left primer: CAGTTTCCACGCATTCATTG. External right primer: ATATCTCGGCGGTTCACAAC. Internal left primer: GAGCGAACCATGAAATTGTG. Internal right primer: GCGTAACACCACCATAACCA. Internal WT amplicon: 1113 bp. Deletion size: 457 bp. Deletion left flank: TTCTTTTGCCAAAGCGCATTGTGCCAAATG. Deletion right flank: TCATTTCATCAGCAATGGCTCGTTTGCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2498 C. elegans B0336.11(gk1147) III. Show Description
B0336.11. Identified by PCR, validated by CGH. External left primer: TGTTTCCTGAAGTGGCACAG. External right primer: AGCACTCACTGAAGGGGAGA. Internal left primer: ATTCTGCCTTGTTGCTTGCT. Internal right primer: CCGTTGCTCTCTGTGCTCTA. Internal WT amplicon: 2566 bp. Deletion size: 379 bp. Deletion left flank: CTTAAACAAAAACACCTACTTTCCATGAAG. Deletion right flank: ATACATCAGTTGGTTATCTAGTAATGGCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2499 C. elegans F15A4.8(gk3032) II; T16G1.9(gk3033) V; ZC374.2(gk1152) X. Show Description
ZC374.2, F15A4.8, T16G1.9. The allele gk1152 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TTGGAAGTTTTGGCAGGAAT. External right primer: CTTGCGTTAATCGCATGTGT. Internal left primer: TCCAATTTGAGCGATCAGTG. Internal right primer: AGGACGCGCAGATTGTTAGT. Internal WT amplicon: 2448 bp. Deletion size: 842 bp. Deletion left flank: TCAATGTTCTACTTTTTAACGCATTTACGT. Deletion right flank: GGTTTAGAAGATAACTTTAAATGTTTAAAC. The allele gk3032 was identified by CGH but not confirmed by PCR. Left flanking probe: TCCATAATTCTAGCGACGTTGAAGTTTATCTGTGGTTCATGGCCGGAGTA. Right flanking probe: GTCGTAATTCAGAAAGAAACTCTGAAACCATGTGCTGGTTGGATTCCAGC. Left deleted probe: ATCTGTGGTTCATGGCCGGAGTACAGTGGAAGAGGACCAATTAGTGAACT. Right deleted probe: TTGAGATTAGATACTGGGTTTGCAGAGCCTGTCGTAATTCAGAAAGAAAC. The allele gk3033 was identified by CGH but not confirmed by PCR. Left flanking probe: CGAAGCAGGAGGTCACTTGTTTTGCTTTCCGATAATAATTGAATATCTAG. Right flanking probe: GGATAACCAAACATGTTGAAATTGGCCACGGACGCGTAGCATTCTAAAGA. Left deleted probe: GAAACAAAAGGCCAGGCGATAGAAAATAAGGCAGTAAACGTCAATTAATA. Right deleted probe: AATAATTGTTTACCCATTTCTTGTAAATCATGAGGCAATAGTGCTCTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2501 C. elegans T11F8.4(gk1151) IV. Show Description
T11F8.4. External left primer: TGCAGGGACTACAAGCACTG. External right primer: GCGCGACAACAAGTAGATCA. Internal left primer: GATTCTTGGCGTCTTGCTTC. Internal right primer: TGGCCGATTTAACCGTATTT. Internal WT amplicon: 2247 bp. Deletion size: 645 bp. Deletion left flank: CTATTGTCGCGCCAGGACGAGAAGCAACAT. Deletion right flank: GTAGACTTCGAATTGCAACACGAAGAACTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2502 C. elegans flp-28(gk1075) X. Show Description
W07E11.4. External left primer: CGCAACGGACTTCGACCTGCC. External right primer: ACCTCGATCACTGGATCCTGC. Internal left primer: TCGGAAGTTGGCGTCAACGAC. Internal right primer: GGAAGCTTCGGTGGTTCTTCTC. Internal WT amplicon: 1950 bp. Deletion size: 957 bp. Deletion left flank: AAGTGTTGTCTCTTGATCGGGCGGTAGTTT. Deletion right flank: ACAGCTACAAAATGATGACGATTAAATGTG. Insertion Sequence: TGCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2504 C. elegans flp-15(gk1186) III. Show Description
ZK525.1. External left primer: GGCATAGCAGCAGACTAC. External right primer: CCTGAGTGTTGTGATTCC. Internal left primer: TCACACAAACCCGTTACC. Internal right primer: GGTTGCCAAGACCCGAAG. Internal WT amplicon: 2040 bp. Deletion size: 708 bp. Deletion left flank: TTGCCGAAATTGCCGATTTTCATTCAAGGA. Deletion right flank: AAAAAGCAATCAAACCGTTTGAGATATAAA. Insertion Sequence: AAAAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2505 C. elegans rab-28(gk1040) IV. Show Description
Y11D7A.4. External left primer: TGTAAATAAGACAATTTCGCCCGG. External right primer: GTCTCCTGCTCCGAGAGCTAA. Internal left primer: TGACGCCGGGATCGAGGAATT. Internal right primer: TCGTTTCCATGACGATTCTCTCGTG. Internal WT amplicon: 2420 bp. Deletion size: 998 bp. Deletion left flank: TCCAAATATGAAGGGGAAAATAATCCGATA. Deletion right flank: TTTCAAGTTTCTAAAAGGATTCAAAAAATT. Insertion Sequence: AAAAATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2508 C. elegans ptp-2(ok3252)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F59G1.5. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3252 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAGTATCTGTCGAAACGCGA. External right primer: CCTGAGAAAATGGGAAGCAA. Internal left primer: CGACGACCAGTTAATGCTGA. Internal right primer: TGATGACGTGGAAGAAGTGC. Internal WT amplicon: 1163 bp. Deletion size: 652 bp. Deletion left flank: GGTCGACGACCAGTTAATGCTGAAAAGAAT. Deletion right flank: TCGTTGTTCATTGTAGTGCTGGAATTGGTA. Insertion Sequence: CG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2509 C. elegans ZK430.1(ok3194)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
ZK430.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3194 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TATTTCAGGAGTTGCGGGAC. External right primer: GTCCCATTTCTCTCCGTTCA. Internal left primer: TGATACAGAATTCGCCAACG. Internal right primer: CATTCGGTCGCCTTATTGAT. Internal WT amplicon: 1374 bp. Deletion size: 812 bp. Deletion left flank: TCGAAAAGCTTCTTCTGGAACTTTCTCCGT. Deletion right flank: CTTATAGAAACTATTGAAGATGCTTCGATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2511 C. elegans Y52B11A.2(ok3233) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y52B11A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3233 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCGAGCCTCACTCAAAACT. External right primer: AGTGGTCCATATCTCCGTCG. Internal left primer: GAAAATGTTCACGAAACGCA. Internal right primer: GGAGCAGAAAGAGGTGCTTC. Internal WT amplicon: 1301 bp. Deletion size: 675 bp. Deletion left flank: ACTAATAGAAAATTCAAAAATTGGGTGAGA. Deletion right flank: AAGATCCTAAAACTATTTTAAACTTCTTTT. Insertion Sequence: TAGATCCTAAAACAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2512 C. elegans ugt-60(ok3248) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C07A9.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3248 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGGTTTCGGACTTGTTGC. External right primer: CGCATCCACTTTCTTCAGGT. Internal left primer: CTGAGAGCATCGCGGATAGT. Internal right primer: TGACGCGTCTAGCTCAATTTT. Internal WT amplicon: 1354 bp. Deletion size: 525 bp. Deletion left flank: TATAGCCTCCATGTGCAATCATTAATTTCA. Deletion right flank: AACCTCGATAGAACAAATTCTCGTCAACGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2513 C. elegans +/mT1 II; lis-1(ok2796)/mT1 [dpy-10(e128)] III. Show Description
T03F6.5. Homozygous sterile deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2796 homozygotes (sterile, lays eggs that don't hatch). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTGGGGCACTGAGATTTT. External right primer: CATGAACGTAATTCGGCAAA. Internal left primer: AAGTGCTCATGCGCTTCAAT. Internal right primer: CGATTTCCCAGAAAAATGGA. Internal WT amplicon: 1174 bp. Deletion size: 718 bp. Deletion left flank: CTCTTTTTTTTTAATTAAACATTTTCATAT. Deletion right flank: AGCCCATTCGACGCATTCCACAGCATGCTC. Insertion Sequence: ATATGAAAATATGAAAATGTTTAATTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2514 C. elegans +/mT1 II; Y32H12A.5(ok3136)/mT1 [dpy-10(e128)] III. Show Description
Y32H12A.5. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3136 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGGAGAACGCGAAAACAAGA. External right primer: CAGGACATCGTCCTCCACTT. Internal left primer: GGAACGAAAAGGGGGAATAA. Internal right primer: CGTTCAGTAGCTGCTTCAAGA. Internal WT amplicon: 1358 bp. Deletion size: 299 bp. Deletion left flank: AAAAGCGGCGAGCACGACAAATGTGTGAAA. Deletion right flank: TATACATGGCTCCCATCATAATCATCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2515 C. elegans ruvb-2(ok3232) IV/nT1 [qIs51] (IV;V). Show Description
T22D1.10. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3232 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTGAATTCACGGTTTTGTCG. External right primer: ATTTTCCAGGTTGAACGCAC. Internal left primer: GGGACAGAGCGTTTCCAAT. Internal right primer: CGCTAGACAAGCTGCAGGAC. Internal WT amplicon: 1244 bp. Deletion size: 457 bp. Deletion left flank: AACGAAAAGCATTCGATATCAAGCATATGA. Deletion right flank: CGCATTGTGAGTTTTCCGACCTTTGGTCCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2517 C. elegans npp-18(ok3278) III. Show Description
Y43F4B.4. External left primer: CAGCACATTGCCCTACTGAA. External right primer: TTTTCAATGGAAAGGCAAGC. Internal left primer: GAAAACGTACCCCCTCGATT. Internal right primer: TATTCGGCTCCGAGGAGAG. Internal WT amplicon: 1259 bp. Deletion size: 338 bp. Deletion left flank: TGGATGAAAAGTCTTTAAAATGTATCAATT. Deletion right flank: GAAGATTTTTATTTCCAGGTTTCATTCGAT. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2520 C. elegans aagr-2(ok3193) II. Show Description
R05F9.12. External left primer: AAATCCTCCCATCTAGCGGT. External right primer: GCCAGAAGCTTCCTGTTCAA. Internal left primer: ATCTCCCAACCAATGTCCTG. Internal right primer: TTGAAAATGTTTCTTCGGGG. Internal WT amplicon: 1219 bp. Deletion size: 293 bp. Deletion left flank: ATATCTGGCTTAAAACCAAATTTTTTGAAA. Deletion right flank: AAACATTTTCAAAAAAGTTCATTTTAAGTC. Insertion Sequence: CAAGTCCCCGAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2521 C. elegans +/mT1 II; Y39E4B.10(ok2517)/mT1 [dpy-10(e128)] III. Show Description
Y38E4B.10. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2517 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTTTTGGCCTAAAAATCGCA. External right primer: ACCACATCCAATGCACAAGA. Internal left primer: CGCGGAGCAACTGATTTTAT. Internal right primer: TTCACTGGGCAAGCTCTTTT. Internal WT amplicon: 2301 bp. Deletion size: 1379 bp. Deletion left flank: TTTTAACATTAAAAATGATCTATATTTACC. Deletion right flank: GTTTTCCATCCAATTTCATTGATTTTTGAG. Insertion Sequence: TATATATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2523 C. elegans med-1(ok3216) X. Show Description
T24D3.1. External left primer: CGCGTAAAATCCATGTTGTG. External right primer: TCTAGTGGGTGACAATCGCA. Internal left primer: CGTCCGAAGGCAAATAAAAG. Internal right primer: ATTTCGGCCCTTTTTGTCTC. Internal WT amplicon: 1163 bp. Deletion size: 630 bp. Deletion left flank: TTGAATCAGTTTTCATACTTTATTCCTTCT. Deletion right flank: ACATTTATATTTAATTCTTGTTCTCGATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2524 C. elegans gpd-2(ok3243) X. Show Description
K10B3.8. External left primer: GTTGATTCCGACACTTGGCT. External right primer: GAATCAACGGATTCGGAAGA. Internal left primer: CATGATGCGTTGAAGCAGTT. Internal right primer: GGACGTCTTGTCCTCCGC. Internal WT amplicon: 1327 bp. Deletion size: 389 bp. Deletion left flank: GGAGCAGAGATGATGACCTAAAAATTTAAA. Deletion right flank: GCGCGGAGGACAAGACGTCCGATTCTTCCG. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2525 C. elegans apt-9(ok3247) X. Show Description
W04G3.4. External left primer: ATTGGTGGGCTGTTTCTTTG. External right primer: CAAGCAAAATTGGGGATGTT. Internal left primer: AAGTGGATCCAGAGAACCAAGA. Internal right primer: CGACAAAATATGTAAACCGGG. Internal WT amplicon: 1146 bp. Deletion size: 428 bp. Deletion left flank: CTGGCTGGGAAACGGCTCCCAGAGTAAGAA. Deletion right flank: AAAAAACAAAGCAATTATTCAAATTCTAAT. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2526 C. elegans C50F7.1(ok3258) IV. Show Description
C50F7.1. External left primer: CGCATCTACGTCATTTGCAT. External right primer: ACACGTGGAAATGGAAAACC. Internal left primer: CAACACTAGCTGGGATCGAGA. Internal right primer: GGAACATGGAAAACGTTTAGTTG. Internal WT amplicon: 1330 bp. Deletion size: 752 bp. Deletion left flank: TTTCATAGTTCCATTTGGTTTGATTTCGGG. Deletion right flank: CAACAATTTCAATGTCTAATTTTGGAACTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2527 C. elegans +/mT1 II; Y39E4A.3(ok2650)/mT1 [dpy-10(e128)] III. Show Description
Y39E4A.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2650 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGGTGGAGCGTAATTTTTCA. External right primer: CGACATTTTGCGGACTTTTT. Internal left primer: GGCACGGTTTTCCTCTTTTT. Internal right primer: GTGGCTGGTGATTTTTCCAC. Internal WT amplicon: 1226 bp. Deletion size: 520 bp. Deletion left flank: TTTCTCCAGAAATATCGATTTTTTAAAAGC. Deletion right flank: CGGAAAGCGTCTCCTTCAACGGTAGAAGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2528 C. elegans F37E3.3(gk1149) I. Show Description
F37E3.3. External left primer: TACCTCCCGGATTCTTTGTG. External right primer: TCGATGGAAAATGATGACGA. Internal left primer: TGTCATTCAGAACACGAGGC. Internal right primer: GAATGTTGTTTGCCCGTTCT. Internal WT amplicon: 1361 bp. Deletion size: 802 bp. Deletion left flank: CAATCCGCTAGCACCATTGAACACCAACTC. Deletion right flank: CTGCGATTGAATTTTCTTATCTTTGATTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2530 C. elegans ZC581.2(gk1146) I. Show Description
ZC581.2. External left primer: TGTCTCCCAACTTCTCGTCC. External right primer: CAATGAAGAATGATCGGGCT. Internal left primer: GGAAACTTTGGAGCGTTCTG. Internal right primer: TTTACGACGTGTTCCATCCA. Internal WT amplicon: 1387 bp. Deletion size: 95 bp. Deletion left flank: TTGATCAATGTGAAATTTTGCGCAGAATCA. Deletion right flank: TTCCCGGAAGATGTTGTCATCAAAATTGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2531 C. elegans F47F2.1(gk1140) X. Show Description
F47F2.1. Identified by PCR, validated by CGH. External left primer: TGAAAGTGCTCAACATTCGG. External right primer: CAAGGGGGAGCTATACACCA. Internal left primer: AGCATCACGGTGAGTGGTTA. Internal right primer: CATACATCCGATGCGTTGAG. Internal WT amplicon: 1402 bp. Deletion size: 548 bp. Deletion left flank: AGTAATTGAGAAAGATTTTGGTTGCAATTT. Deletion right flank: TGATGGTCGGAAAGCCCCCATTCCGTGGAA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2532 C. elegans ZC581.9(gk1141) I. Show Description
ZC581.9. External left primer: ATGGTTTTCGCCTCCTTTTT. External right primer: GGTCGTGCTGTTTACCACCT. Internal left primer: CCACGGATAACATGGGTAGC. Internal right primer: CTATCCTCACCTTTGCAGGG. Internal WT amplicon: 1535 bp. Deletion size: 503 bp. Deletion left flank: TTGTTCAGTGGCAAATGAAATATAGTCTTT. Deletion right flank: AGAATGCACAATCGAGCAACTTCCTGTCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2533 C. elegans ZK930.7(gk1145) II. Show Description
ZK930.7. Identified by PCR, validated by CGH. External left primer: GTACCATAAAGCGGTCGGAA. External right primer: TCTCACATGCCAAACTGAGC. Internal left primer: AGCCATTCATCCTGTCCATC. Internal right primer: CCGTTTCCACAGCGAATTAT. Internal WT amplicon: 1512 bp. Deletion size: 612 bp. Deletion left flank: AAAAACAATATTTTTGAAATTCTGTATAAT. Deletion right flank: CGATGGTCGATTTGACGGAGCTTAACCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2534 C. elegans nhr-281(gk1108) X. Show Description
F16B12.8, C24A1.3. External left primer: GCGTCCACAAAAGTGTCAGA. External right primer: GGTTTGAGAATTGCCGGATA. Internal left primer: CAACACCGTGGCATTTAGTG. Internal right primer: CCTTCACTGCACGCTAAACA. Internal WT amplicon: 1959 bp. Deletion size: 1071 bp. Deletion left flank: ACGAGGCTCAGATTGTTTATGAAATCAAAA. Deletion right flank: AAATAAAATGTGTTCTTTGGAGACAGAATA. Insertion Sequence: TTATAGGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2535 C. elegans unc-82(gk1124) IV. Show Description
B0496.3. Identified by PCR, validated by CGH. External left primer: GATGTTGTCGCATTGTGTCC. External right primer: AACTTGATGGATCTGGTGGC. Internal left primer: TGCGCTTCTAATCGTAAGGC. Internal right primer: GGTTCCTCGTCAGGATCAAA. Internal WT amplicon: 2549 bp. Deletion size: 595 bp. Deletion left flank: AGAAACTAGACATAAATCAAGGTATTACTT. Deletion right flank: ACTAAAAGTAAAGGTTACAATTCCAAATTA. Insertion Sequence: AAATAGACATAAATCAAGGTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2536 C. elegans W02B12.11(ok3260) II. Show Description
W02B12.11. External left primer: AAAAGACCGGACAACCACTG. External right primer: AACCTACATCAACTTCGGCG. Internal left primer: CAGCCGGATTTCTTTTCTGA. Internal right primer: CCGTTTCCTCTTCACATGCT. Internal WT amplicon: 1242 bp. Deletion size: 481 bp. Deletion left flank: ATTTACAGCCGGATTTCTTTTCTGATCCCC. Deletion right flank: CAGCGCCGAAGAGGACGGATCTTGTCCAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2537 C. elegans hil-2(ok2548) IV/nT1 [qIs51] (IV;V). Show Description
Y73B6BL.9. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2548 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TACAAAGGTGGGAGGTACGC. External right primer: GAGCATGATGTGACACCCAC. Internal left primer: GGGGCAAAACTATGAGAGCA. Internal right primer: TTTTGCGCTTTTTCAGTGTG. Internal WT amplicon: 2810 bp. Deletion size: approximately 1700 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2538 C. elegans C08B11.3(gk1041)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C08B11.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk1041 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATCTCGATCGACACTTCGCT. External right primer: TAACATATCGACGTTGGGCA. Internal left primer: ACGGCTCGTCTGTTCTGATT. Internal right primer: AATTGACGGATCCACCTGAG. Internal WT amplicon: 2394 bp. Deletion size: 561 bp. Deletion left flank: GATCAATCTGAAATTCATTTTTCAAATTAT. Deletion right flank: TGCAAAATCGATTTCGTTCGGCAATCCAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2539 C. elegans noah-2(ok3197) IV/nT1 [qIs51] (IV;V). Show Description
F52B11.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3197 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCTTAGGCACAGACGTAGG. External right primer: CACTGAGAGCGAGACGACTG. Internal left primer: GCACTGCTTCTTCCTGCTTC. Internal right primer: CAGAGAAGCTCGGTGGAGTC. Internal WT amplicon: 1129 bp. Deletion size: 806 bp. Deletion left flank: TGAATCCCAATTCGGAGGAATGGCTCTCTG. Deletion right flank: AGGAGAAGCTTTCGGCTATCATTCGAGTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2540 C. elegans C13F10.4(ok3257) V/nT1 [qIs51] (IV;V). Show Description
C13F10.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3257 homozygotes (late larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGGACTCCTGATGACCGA. External right primer: CGTGGGCAGAGGTTTATGTT. Internal left primer: TCATCTGGCTGCTGACTGAC. Internal right primer: TGACTACAATGGAAGTGGTTCA. Internal WT amplicon: 1092 bp. Deletion size: 525 bp. Deletion left flank: TTTTCCACCTTCTTCGCCAGCGAACAATAC. Deletion right flank: GTTGAGAAATTGATCGGAGTAATGGGCAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2541 C. elegans K02E11.10(ok3266) V/nT1 [qIs51] (IV;V). Show Description
K02E11.10. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3266 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGCAACTTGTCCTTGTTGGG. External right primer: GGAGTGTGCAGCAAATTTCA. Internal left primer: CTTCGAAGCCTCCTTGAGTA. Internal right primer: GCGTCTTGAGGCCATAGTTC. Internal WT amplicon: 1208 bp. Deletion size: 582 bp. Deletion left flank: CCTGAGCAGGCCCTTGCTGATATCCGGCTC. Deletion right flank: GGCAGGCTAAGATCACAACGGATTTCATCT. Insertion Sequence: TTCCCTGAACTCCTTGAGCAGATCCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2542 C. elegans vps-39(ok2442) V/nT1 [qIs51] (IV;V). Show Description
T08G5.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2442 homozygotes (sterile, eggs don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTTGACATTGCACATTGGG. External right primer: CATACACGCCTTGCGAAGTA. Internal left primer: GGTAGTTTGAATCACCGCGT. Internal right primer: CTTGTTAGCCGGTGGAAGAG. Internal WT amplicon: 2794 bp. Deletion size: 1397 bp. Deletion left flank: CCACGACGGCTTTTCGATTTAAATTTCTAG. Deletion right flank: TTTCGAACAGAAAAGAATACCATTTCACCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2546 C. elegans med-2(ok3199) III. Show Description
K04C2.6. External left primer: ATTCCCAAATTCGAAGAGCA. External right primer: CCATCACAACACCACCACAT. Internal left primer: AAATCTCATTATGACAACGAACAAA. Internal right primer: GCATCCAATCCATGCAATTA. Internal WT amplicon: 1203 bp. Deletion size: 580 bp. Deletion left flank: GTGTGGTCTACAGTAAAAGAGCCCAAAGAA. Deletion right flank: GTATCATTGTAAATTGTATAACTCAATTGT. Insertion Sequence: AAGAGCTACAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2547 C. elegans +/szT1 [lon-2(e678)] I; ced-8(ok3213)/szT1 X. Show Description
F08F1.5. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3213 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAAATATCAGCACCAATGCG. External right primer: TGCAATGTGCTCCTATGCTC. Internal left primer: CTTACCTGCAAAACCGCTTC. Internal right primer: CAATCTTTCATTTTTGGGCG. Internal WT amplicon: 1179 bp. Deletion size: 649 bp. Deletion left flank: CTTTCTCAATCTTACCTGCAAAACCGCTTC. Deletion right flank: GTGACCGCAAACTGATTAGTCTCTTGAAAT. Insertion Sequence: ACCGCAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2550 C. elegans inx-14(ok3267) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F07A5.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3267 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAAAAACCAACCGGTTCAAG. External right primer: ATCACCAAACCGTTCAAAGC. Internal left primer: CTTGAAAAGAGCACCGATGA. Internal right primer: GGTGCTAAACAACATTTCGGA. Internal WT amplicon: 1264 bp. Deletion size: 544 bp. Deletion left flank: ATTAAAAGAATTCCGTCGGCACACAGGTAC. Deletion right flank: CACGAATCAACGTCCAAGAATTTGCAAACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2552 C. elegans F09F7.7(ok3133) III. Show Description
F09F7.7. External left primer: GGTGTCCATCCCAATCAATC. External right primer: CGATCACATTCGTCAAATCG. Internal left primer: CGAGCCGTTCACTCCTTATC. Internal right primer: CAATTCCAACGACAAATCTGAA. Internal WT amplicon: 1340 bp. Deletion size: 939 bp. Deletion left flank: GACAAAACAGACAGAAAAAAGGAATTATCA. Deletion right flank: TTCAGATTCTGACAGAAAATTGTGAATGAG. Insertion Sequence: GA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2554 C. elegans lin-66(ok3326) IV/nT1 [qIs51] (IV;V). Show Description
B0513.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3326 homozygotes (late larval arrest or sterile adult, tends to explode). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCAAGTCCTTCCACCGTCTA. External right primer: TTGATCAAGCACGACAAAGC. Internal left primer: AACAGAGAGCCGACACCATC. Internal right primer: TCTACGGCATTGCAGTGTTC. Internal WT amplicon: 1385 bp. Deletion size: 707 bp. Deletion left flank: TATGATCTCTATGATCTACCAAGGTTAGCC. Deletion right flank: AGTCGCTGTTCGACTACTACGGTAGCCCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2555 C. elegans +/mT1 II; trf-1(ok1721)/mT1 [dpy-10(e128)] III. Show Description
F45G2.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1721 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTGGATTACCAGCGGACTGT. External right primer: AGAGGCAAAAGCAATGATGG. Internal left primer: TCCGATCAAGCTGAACTGTG. Internal right primer: CGCCTTTTCTCCCCTACTTC. Internal WT amplicon: 2848 bp. Deletion size: 954 bp. Deletion left flank: AAAACGGGGGTGAAGCCATTTACTTTCAGG. Deletion right flank: ATTTGGTTATAAGATGATGGCTTGTGCATG. Insertion Sequence: TCTTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2556 C. elegans nep-22(ok3299) X. Show Description
T25B6.2. External left primer: TGCATGGATCTTCTCACTGC. External right primer: TCTGGGTACATTGGGCTACC. Internal left primer: GCCATACGGAACTGGATACG. Internal right primer: AACCTGGTTGGTTCTGCATT. Internal WT amplicon: 1196 bp. Deletion size: 686 bp. Deletion left flank: TGTGCAAAGTTGAAAAAATGGTAACTTTTT. Deletion right flank: CTCAATTTAGTACACAATGTTGCCCAGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2557 C. elegans catp-5(ok3303) X. Show Description
K07E3.7. External left primer: GACAGGAAAACTCCAGCCAG. External right primer: GATCGTCATGGAGAACCGAT. Internal left primer: CGAGGAGAATAAAGCGCATC. Internal right primer: TCAATGAACTTTCTGTTGCCA. Internal WT amplicon: 1344 bp. Deletion size: 366 bp. Deletion left flank: CGGTCGTCTGAATCGTTTTCACCATTTAAC. Deletion right flank: GGCACACAACGAATATCTGGGACGTTGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2559 C. elegans sti-1(ok3354) V. Show Description
R09E12.3. External left primer: TCCCTATTTTCAGGCGATTG. External right primer: CGACGTCACCAAAGAAGACA. Internal left primer: GATCTCGGAAATGCTGCCTA. Internal right primer: AAGACGAGTCCAGAGGACGA. Internal WT amplicon: 1160 bp. Deletion size: 336 bp. Deletion left flank: TGAGTGGTCGAAGGCTCAGCGAGCCTACGA. Deletion right flank: CCCCATGGTCTGTGTTTTTTGCATCTCGCT. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2563 C. elegans Y75B8A.24(ok3320) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y75B8A.24. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3320 homozygotes (grotty sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCTTCCCCTACCTAACAGCC. External right primer: GAGAAGGAAGTTGTCGGTGG. Internal left primer: ACAGAAGCTCATCTGCCGAG. Internal right primer: ACGTCGCATCCTACTCGTCT. Internal WT amplicon: 1206 bp. Deletion size: 389 bp. Deletion left flank: CTCATCTGCCGAGTAACTTCTCAGCACTCT. Deletion right flank: CCAACGCTAGCGGATGGAGCCAAGCACTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2564 C. elegans sao-1(ok3281) V. Show Description
R10D12.14. External left primer: AAGAGCGAGATGACGAGGAA. External right primer: ACCATTTGTCCGAGCAACTC. Internal left primer: GACATCAAAATACCGACGGC. Internal right primer: GAACACGAGAAGCCTGTTCC. Internal WT amplicon: 1196 bp. Deletion size: 595 bp. Deletion left flank: TCCAATGCCGCTTCTCCATCAAATGAATCA. Deletion right flank: ATGATTTTAAAATAGTTTCAGATTTCAAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2565 C. elegans frpr-3(ok3302) V. Show Description
C26F1.6. External left primer: GCCTCAGCAAAATGTAAGCC. External right primer: GTTTGTCCTCGCGGTAGGTA. Internal left primer: GAACGTGATGGTGCTGATGT. Internal right primer: CCGCAAATCCCTTCTATCAG. Internal WT amplicon: 1147 bp. Deletion size: 591 bp. Deletion left flank: CGCACTTCTTATTGTGGTACCAGAATGTTG. Deletion right flank: AAAATACGGTCACACTCATAGACTGATAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2566 C. elegans F23C8.6(ok3325) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F23C8.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3325 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCGGGGTCAAAGTACACACT. External right primer: CCGCAGATACACACACATGA. Internal left primer: CCGAAATTCGAAATTTTAGCC. Internal right primer: TTTTTATCGCTTTCTTGCGAA. Internal WT amplicon: 1309 bp. Deletion size: 702 bp. Deletion left flank: GTCGGCAGAGCAGTTGGCACGTTTGACGGA. Deletion right flank: GTGCTTTTATAAGTTAAATTTCGCAAGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807