| MAA1 |
C. elegans |
ari-2(ama1) IV. Show Description
ari-2(ama1) is a CRISPR-engineered null allele replacing nearly all of the coding sequence with an insertion of stop codons in every frame (TAGATAAATGA). CRISPR edit was performed with dpy-10 co-CRISPR (Arribere, Bell et al. 2014). crRNAs (5': 5'- AGACATGAGCTGCACGTCCG; 3': 5'- AGTCGAAGAGCTCGCATGGG). Single-stranded repair template contained an insertion of stop codons in every frame (TAGATAAATGA) and 35bp homology on both sites. Generated in N2 background. Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665. |
|
| MAA11 |
C. elegans |
tppp-1(tm5231) I; baIs11 ari-2(ama1) IV. Show Description
baIs11 [dat-1p::GFP + dat-1p::alpha-synuclein] IV. [NOTE: baIs11 was originally publised as baIn11 due to a typographical error that has persisted.] tm5231 is a 190 bp deletion + 1 bp insertion (14075/14076-A-14265/14266) within tppp-1. Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665. |
|
| MAA14 |
C. elegans |
tppp-1(tm4902) I; baIs11 ari-2(ama1) IV. Show Description
baIs11 [dat-1p::GFP + dat-1p::alpha-synuclein] IV. [NOTE: baIs11 was originally publised as baIn11 due to a typographical error that has persisted.] tm4920 is a 321 bp deletion + 2 bp insertion (13890/13891-GA-14211/14212) within tppp-1. Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665. |
|
| MAA17 |
C. elegans |
baIs11 ari-2(ama1) IV; cul-5(ok1706) V. Show Description
baIs11 [dat-1p::GFP + dat-1p::alpha-synuclein] IV. [NOTE: baIs11 was originally publised as baIn11 due to a typographical error that has persisted.] Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665. |
|
| MAA2 |
C. elegans |
vtIs7 I; ari-2(ama1) IV. Show Description
vtIs7 [dat-1p::GFP]. Generated by crossing parental strains BY250 and MAA1. Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665. |
|
| MAA3 |
C. elegans |
baIs11 ari-2(ama1) IV. Show Description
baIs11 [dat-1p::GFP + dat-1p::alpha-synuclein] IV. Generated by crossing parental strains UA44 and MAA1. [NOTE: baIs11 was originally publised as baIn11 due to a typographical error that has persisted.] Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665. |
|