Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
COP2772 C. elegans oma-1(knu1284[delta TZF])::GFP IV; oma-2(ne5034[AID*::oma-2] neSi101 V. Show Description
knu1284 is a CRISPR-engineered in-frame deletion of the TZF domain of oma-1. AID* degron tag (IAA17) inserted into the endogenous oma-2 locus. When OMA-2 is present, this mutant does not appear to have obvious phenotypes. Auxin-inducible depletion of OMA-2 causes a null phenotype: animals do not produce mature embryos and have an empty uterus. Reference: Ertekin A, et al. bioRxiv. 2025 May 12:2025.05.09.653132. doi: 10.1101/2025.05.09.653132. PMiD: 40463014.
MLC1094 C. elegans lucSi102 II; unc-119(ed3) III. Show Description
lucSi102 [hsp16.41::zif-1::SL2::mCherry::his-11::tbb-2 3'UTR] II. Superficially wild-type morphology. Single-copy insertion of a zif-1 transgene under a heat-shock promoter. Used as control for MLC1092 or for conditional depletion of ZF1 degron-tagged proteins (aka ZF) in all tissues via heat-shock expression of ZIF-1. (Wang et al. (2017) A toolkit for GFP-mediated tissue-specific protein degradation in C. elegans. Development 144, 2694-2701.)
NK2902 C. elegans bmdSi15 I; rpl-31(qy189[rpl-31::ZF1::GFP11]) I; zif-1(gk117) III; qyIs463. Show Description
qyIs463 [lin-29p::zif-1::SL2::mCherry]. bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3' UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3' UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). ZF1 and split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus. L4-specific expression of ZIF-1, ubiquitous GFPbeta1-10 and endogenous rpl-31 tagged with ZF-1+GFP-beta11
OP781 C. elegans unc-119(tm4063) III; wgIs781. Show Description
wgIs781 [pzf-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
VC4073 C. elegans fezf-1(gk5147[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2724 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACTAAAGGCAAATCTGGATATAAACCGCC ; Right flanking sequence: ATCGTATAACCTTGCATTCCACATGTTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
YL195 C. elegans pzf-1(vr3) V. Show Description
Superficially wild type.
AGK192 C. elegans unc-119(ed3) III; zdIs13 IV; armIs5. Show Description
zdIs13 [tph-1p::GFP] IV. armIs5 [zfp-1(fosmid)::FLAG + unc-119(+)]. Integrated zfp-1 transgene expressed in the germline. Fosmid-based zfp-1::FLAG transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. ChIP with anti-FLAG antibody detects ZFP-1::FLAG localization to promoters of highly expressed genes. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. Cecere G, et al. Mol Cell. 2013 Jun 27;50(6):894-907.
AGK26 C. elegans unc-119(ed3) III; armEx5. Show Description
armEx5 [zfp-1(fosmid)::GFP + unc-119(+)]. Pick non-Unc to maintain. Fosmid-based zfp-1::GFP transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. Nuclear expression of zfp-1::GFP is observed ubiquitously in somatic cells in all developmental stages; high levels of GFP expression is observed in oocytes with lower levels of expression in the distal germline. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
AGK280 C. elegans zfp-1(ok554) unc-119(ed3) III; armEx14. Show Description
armEx14 [PHD1-PHD2::FLAG + zfp-1(short isoform) + unc-119(+)]. Pick non-Unc animals to maintain. The fosmid-based armEx14 transgene rescues zfp-1(ok554)/nDf17 lethality. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
AGK369 C. elegans zfp-1(ok554) III; armIs8. Show Description
armIs8 [zfp-1(short isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs8 transgene rescues the protruded vulva phenotype of zfp-1(ok554). Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
AGK370 C. elegans zfp-1(ok554) III; armIs9. Show Description
armIs9 [zfp-1(long isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs9 transgene rescues zfp-1(ok554)/nDf17 lethality. Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
AML1 C. elegans zfIs18; zfIs42. Show Description
zfIs18 [mec-4p::ChR2::YFP]. zfIs42 [rig-3p::GCaMP3::SL2::mCherry]. Pick mCherry+ animals to maintain strong expression from zfIs42. Worm expresses light-sensitive Channelrhodopsin (ChR2) and yellow fluorescent protein (YFP) in mechanosensory neurons, ALMR/L, AVM, PLML/R, and PVM. When fed all-trans retinal, blue light stimulation (473 nm at 2 mW * mm^-2) of head induces reversals. GCaMP3 and and mCherry expression in command interneurons AVA, and nearby pharyngeal neurons I1, I4, M4, NSM. Worms were made by crossing the integrated strains QW309 and QW625. Reference: Shipley FB, et al. Front Neural Circuits. 2014 Mar 24;8:28.
BN1097 C. elegans bqSi1030 II; bqSi548 IV. Show Description
bqSi1030 [hsp16.41p::FRT::mCherry::his-58::FRT::vhhGFP4::zif-1 + unc-119(+)] II. bqSi548 [dpy-7p::FLP + unc-119(+)] IV. Can be used for conditional depletion of GFP-tagged proteins in the hypodermis via anti-GFP nanobody fusion to ZIF1 (mediated by recruited ZIF-1 but NOT requiring ZF1 tags). Mechanism features heat-shock inactive ZIF-1 with FRT sites flanking inactivating sequence and hypodermal-specific expression of Cre to remove inactivating sequences to free vhhGFP4::zif-1 GFP degradation. May carry unc-119(ed3) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
BN1117 C. elegans bqSi1030 II; bqSi508 IV. Show Description
bqSi1030 [hsp16.41p::FRT::mCherry::his-58::FRT::vhhGFP4::zif-1 + unc-119(+)] II. bqSi508 [elt-2p::FLP + unc-119(+)] IV. Can be used for conditional depletion of GFP-tagged proteins in the intestine via anti-GFP nanobody fusion to ZIF1 (mediated by recruited ZIF-1 but NOT requiring ZF1 tags). Mechanism features heat-shock inactive ZIF-1 with FRT sites flanking inactivating sequence and intestinal-specific expression of Cre to remove inactivating sequences to free vhhGFP4::zif-1 GFP degradation. May carry unc-119(ed3) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
FT1341 C. elegans xnIs23. Show Description
xnIs23 [cdc-42p::ZF1::GFP::cdc-42 + unc-119(+)]. Transgene insertion expressing ZF1::GFP::CDC-42 ubiquitously in somatic cells. Transgenic cdc-42 protein subject to ZIF-1-dependent degradation. Might still have unc-119(ed3) in the background. Reference: Armenti STet al. Development. 2014 Dec;141(23):4640-7. doi: 10.1242/dev.115048. Epub 2014 Nov 5. PMID: 25377555.
FT1450 C. elegans unc-119(ed3) III; xnIs23; xnEx342. Show Description
xnIs23 [cdc-42p::ZF1::GFP::cdc-42 + unc-119(+)]. xnEx342 [rab-3p::zif-1 + rab-3p::mCherry + rol-6(su1006)]. Pick Rollers to maintain. ZF1::GFP::cdc-42 is expressed ubiquitously and enriched at the plasma membrane. Transgenic cdc-42 is subject to ZIF-1-dependent degradation. Neuronal cells inheriting xnEx342 express ZIF-1 and mCherry. Reference: Armenti ST, et al. Development. 2014 Dec;141(23):4640-7.
FT1481 C. elegans unc-119(ed3) III; xnIs23; xnEx350. Show Description
xnIs23 [cdc-42p::ZF1::GFP::cdc-42 + unc-119(+)]. xnEx350 [elt-2p::zif-1 + elt-2p::mCherry + rol-6(su1006)]. Pick Rollers to maintain. ZF1::GFP::cdc-42 is expressed ubiquitously and enriched at the plasma membrane. Transgenic cdc-42 subject to ZIF-1-dependent degradation. Intestinal cells that inherit xnEx350 express ZIF-1 and mCherry. Reference: Armenti ST, et al. Development. 2014 Dec;141(23):4640-7.
FT1523 C. elegans sec-5(xn51[sec-5::ZF1::YFP + LoxP::unc-119::LoxP]) II; unc-119(ed3) III. Show Description
sec-5(xn51 [sec-5::ZF1::YFP + LoxP::unc-119::LoxP]) II. Knock-in of ZF1::YFP and unc-119(+) into the sec-5 locus, so that endogenous sec-5 protein is subject to ZIF-dependent degradation. Expresses SEC-5::ZF1::YFP maternally and zygotically. Expression in many cells, including early embryos, epithelial cells, excretory cell, and germ line. unc-119 is present in reverse orientation within an intron of YFP. Reference: Armenti ST et al. Development. 2014 Dec;141(23):4640-7. doi: 10.1242/dev.115048. Epub 2014 Nov 5. PMID: 25377555.
FT1547 C. elegans unc-119(ed3) III; xnIs23; xnEx380. Show Description
xnIs23 [cdc-42p::ZF1::GFP::cdc-42 + unc-119(+)]. xnEx380 [hsp-16.41p::zif-1::SL2::mCherry + rol-6(su1006)]. Pick Rollers to maintain. ZF1::GFP::cdc-42 is expressed ubiquitously and enriched at the plasma membrane. Transgeneic cdc-42 is subject to ZIF-1 dependent degradation. In cells inheriting xnEx380, there is heatshock-dependent expression of ZIF-1 and mCherry. Reference: Armenti ST, et al. Development. 2014 Dec;141(23):4640-7.
FT36 C. elegans unc-101(m1) par-6(zu170) I; zuIs43. Show Description
zuIs43[pie-1::GFP::PAR-6::ZF1 + unc-119(+)]. Unc worms. Transgenic PAR-6 is subject to ZIF-1-dependent degradation. GFP present in early embryos but then degrades in somatic lineages. Rescues Mel phenotype of par-6(zu170).
JJ1440 C. elegans unc-119(ed3) III; zuIs20. Show Description
zuIs20 [par-3p::par-3::ZF1::GFP + unc-119(+)]. Transgenic PAR-3 is subject to ZIF-1-dependent degradation. GFP-tagged PAR-3 is degraded in early embryonic somatic cells. Worms carrying the transgene are non-Unc and express GFP very weakly in early embryos (only detectable by antibody staining), and later in adherens junctions of epithelial cells.
JJ1494 C. elegans unc-119(ed3) III; zuIs58. Show Description
zuIs58 [par-6::PAR-6::ZF1::GFP + unc-119(+)]. Transgenic PAR-6 is subject to ZIF-1-dependent degradation.
JJ1578 C. elegans par-6(zu222) unc-101(m1); zuIs54. Show Description
zuIs54 [par-6p::par-6::ZF1::GFP + unc-119(+)]. Unc. GFP-tagged PAR-6 that degrades in early embryonic somatic cells; rescues the Par phenotype of par-6(zu222). Delayed gastrulation of endodermal cells. Reference: Nance J, Munro EM, Priess JR. Development. 2003 Nov;130(22):5339-50.
JJ1600 C. elegans par-3(it71) lon-1(e185) III; him-8(e1489) IV; zuIs20. Show Description
zuIs20 [par-3p::par-3::ZF1::GFP + unc-119(+)]. Lon. Him. Transgenic PAR-3 is subject to ZIF-1-dependent degradation. GFP-tagged PAR-3 that is degraded in early embryonic somatic cells. Rescues the Par phenotype of par-3(it71). Delayed endodermal cell gastrulation. Reference: Nance J, Munro EM, Priess JR. Development. 2003 Nov;130(22):5339-50.
JLF104 C. elegans zyg-9(wow12[ZF1::GFP::SEC::3xFlag::zyg-9]) II; zif-1(gk117) III. Show Description
ZF1-degron, GFP, and 3xFlag tags inserted into endogenous zyg-9 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of zyg-9 protein by providing a source of ZIF-1. GFP fluorescence is observed in microtubules. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171.
JLF145 C. elegans zif-1(gk117) III; air-1(wow14[air-1::ZF1::GFP::3xFLAG]) V. Show Description
ZF1-degron, GFP, and 3xFLAG tags inserted into endogenous air-1 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of air-1 protein by providing a source of ZIF-1. GFP expression is observed in mitotic cells at the spindle poles and along microtubules. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
JLF155 C. elegans zif-1(gk117) III. Show Description
Presumptive null deletion allele of zif-1. ZF1-tagged proteins are not degraded in zif-1(gk117) background. Genotyping primers: ExtFwd: gctcgcaacgactgacaagg // IntRev: GGTACTCGCGGAACACTCACTC // ExtRev: ATTCGTACGGTACTTGCATGAACC
JLF212 C. elegans par-6(wow31[par-6::ZF1::GFP::3xFLAG]) I; zif-1(gk117) III. Show Description
ZF1-degron, GFP, and 3xFLAG tags inserted into endogenous par-6 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of par-6 by providing ZIF-1. GFP fluorescence is observed at the anterior cortex in zygotes and at apical surfaces in epithelia. Reference: Sallee M, et al. eLife. 2021 Jun 17;10:e64437. doi: 10.7554/eLife.64437. PMID: 34137371.
JLF238 C. elegans tpxl-1(wow34[ZF1::GFP::3xFlag::tpxl-1]) I; zif-1(gk117) III. Show Description
ZF1-degron, GFP, and 3xFLAG tags inserted into endogenous tpxl-1 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of tpxl-1 protein by providing a source of ZIF-1. GFP expression is observed in microtubules. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171.
JLF24 C. elegans gip-1(wow5[ZF1::GFP::gip-1]) zif-1(gk117) III. Show Description
ZF1-degron and GFP tags inserted into endogenous gip-1 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of gip-1 protein by providing a source of ZIF-1. GFP fluorescence is observed at microtubule-organizing centers. Presence of ZF1-degron targets tagged proteins for ZIF-mediated degradation. Expression of ZIF-1 causes the tagged GIP-1 protein to be degraded. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
MLC1092 C. elegans lucSi100 II; unc-119(ed3) III. Show Description
lucSi100 [hsp16.41::vhhGFP4::zif-1::SL2::mCherry::his-11::tbb-2 3'UTR] II. Superficially wild-type morphology. Single-copy insertion of a GFP-nanobody::zif-1 fusion transgene under a heat-shock promoter. Allows conditional depletion of GFP-tagged proteins in all tissues via heat-shock expression of anti-GFP nanobody fusion to ZIF1 (mediated by recruited ZIF-1 but NOT requiring ZF1 tags). (Wang et al. (2017). A toolkit for GFP-mediated tissue-specific protein degradation in C. elegans. Development 144, 2694-2701.)
OD2442 C. elegans ltSi794 II; unc-119(ed3) III. Show Description
ltSi794 [dpy-7p::vhhGFP4::zif-1::unc-54 3'UTR + Cbr-unc-119(+)] II. Hypodermal-specific anti-GFP nanobody fused to ZIF-1 (Mediated by recruited ZIF-1 but NOT requiring ZF1 tags) mediates hypodermis-specific degradation of GFP-tagged proteins. Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine hypodermis-specific functions of target genes. Reference: Wang S, et al. Elife. 2015 Sep 15;4:e08649. Wang S, et al. http://biorxiv.org/content/early/2017/01/30/104398
OD2768 C. elegans ltSi910 II; unc-119(ed3) III. Show Description
ltSi910 [elt-2p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Intestinal-specific expression of anti-GFP nanobody fused to ZIF-1 mediates intestine-specific degradation of GFP-tagged proteins (mediated by recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine intestine-specific functions of target genes. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.
OD2770 C. elegans ltSi912 II; unc-119(ed3) III. Show Description
ltSi912 [myo-3p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Muscle-specific expression of anti-GFP nanobody fused to ZIF-1 mediates body wall muscle-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine body wall muscle-specific functions of target genes. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.
OD2772 C. elegans ltSi914 II; unc-119(ed3) III. Show Description
ltSi914 [osm-6p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Sensory neuron-specific expression of anti-GFP nanobody fused to ZIF-1 mediates sensory neuron-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine sensory neuron-specific functions of target genes. Reference: Wang S, et al.  Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.
OD2984 C. elegans ltSi953 II; unc-119(ed3) III. Show Description
ltSi953 [mec-18p::vhhGFP4::zif-1::operon-linker::mKate::tbb-2 3'UTR + Cbr-unc-119(+)] II. Touch response neuron (TRN)-specific expression of anti-GFP nanobody fused to ZIF-1 mediates TRN-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine TRN neuron-specific functions of target genes. Reference: Wang S, et al. http://biorxiv.org/content/early/2017/01/30/104398
OH16150 C. elegans nIs107 III; zfIs10 IV. Show Description
nIs107 [tbh-1::GFP] III. zfIs10 [tdc-1::mCherry] IV. RIC neurons are marked with both GFP and mCherry.
OP534 C. elegans unc-119(tm4063) III; wgIs534. Show Description
wgIs534 [zfp-2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
QW1075 C. elegans lite-1(ce314) X; zdIs5; zfEx416. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I. zfEx416 [rig-3p::GFP::SL2::mCherry]. Pick animals with red fluorescence to maintain zfEx416. Reference: Shipley FB, et al. Front Neural Circuits. 2014 Mar 24;8:28.
QW1655 C. elegans lin-15B&lin-15A(n765) zfIs149 X. Show Description
zfIs149 [flp-18p(3kb)::mCherry::SL2::FLP-18 + lin-15(+)] X. FLP-18 expressing neurons are labeled with cytosolic mCherry. Overexpression of FLP-18 causes uncoordinated locomotion. Animals exhibit exaggerated head and body bends, increased reversal frequency, and enhanced calcium transients in body-wall muscle. These phenotypes are suppressed by loss of NPR-5. Reference: Florman JT & Alkema MJ. PLOS Genet. 2022 Mar 3;18(3):e1010091. doi: 10.1371/journal.pgen.1010091. PMID: 35239681.
QW309 C. elegans zfIs18. Show Description
zfIs18 [mec-4p::ChR2::YFP + lin-15(+)]. Reference: Shipley FB, et al. Front Neural Circuits. 2014 Mar 24;8:28.
QW625 C. elegans zfIs42. Show Description
zfIs42 [rig-3p::GCaMP3::SL2::mCherry + lin-15(+)]. Reference: Shipley FB, et al. Front Neural Circuits. 2014 Mar 24;8:28.
RB774 C. elegans zfp-1(ok554) III. Show Description
F54F2.2A. Homozygous. Outer Left Sequence: attcaatcagcctgtggagg. Outer Right Sequence: tgctgctgctttctcgttta. Inner Left Sequence: gttggcttgctgccaataat. Inner Right Sequence: cctacaagtggcatgcgata. Inner primer WT PCR product: 2733. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RW12167 C. elegans zfh-2(st12167[zfh-2::GFP + loxP + unc-119(+) + loxP] I; unc-119(tm4063) III. Show Description
zfh-2(st12167[zfh-2::GFP + loxP + unc-119(+) + loxP] I.
RW12271 C. elegans zfp-3(st12271[zfp-3::TY1::EGFP::3xFLAG]) X. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
RW12277 C. elegans zfr-1(st12277[Y95B8A.8::TY1::EGFP::3xFLAG]) I. Show Description
Y95B8A.8. eGFP and 3xFLAG tags inserted into endogenous locus by CRISPR/Cas9.
VC3250 C. elegans zfp-3(gk3165) oga-1(gk3513) C34E11.3(gk3514) X. Show Description
This strain in homozygous for a deletion (gk3165) in W05H7.4, detectable by PCR using the following primers. External left primer: TCATTGTACGCTGGCTTCTG. External right primer: CCGCACTGAAATTGGTAGGT. Internal left primer: GATTGAGTCCATCCTTCCGA. Internal right primer: GAGAAATCGTTCAACGGGAA. Internal WT amplicon: 1623 bp. Deletion size: 781 bp. Deletion left flank: ACGTGGCGGACGGCCCGGAAGTGGCAAATC. Deletion right flank: CCGCCTCATTGAAGCAAATGCGCTCTACCG. Validation: gk3165 passed by CGH. Other deletions (gk3513, gk3514) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
ZF1092 C. sp. 25 Show Description
Isolated by Adeline Seah and Takao Inoue from a rotten fruit in an urban garden in Singapore (1.32°N, 103.82°E) on 7/19/2006.
ZF1222 C. sp. 25 Show Description
Isolated by Adeline Seah and Takao Inoue from a rotten fruit in an urban garden in Singapore (1.45°N, 103.72°E) on 7/19/2007.
ZM10113 C. elegans twk-40(bln282[twk-40::TagRFP::ZF1]) III; hpIs727. Show Description
hpIs727 [rig-3p::zif-1::sl2::RFP + ttx-3p::GFP]. twk-40(bln282) is a CRISPR generated allele of the endogenous twk-40 locus, inserting TagRFP and ZF1 allowing visualization of endogenous protein expression and localization as well as ZIF-1-mediated degradation. hpIs727 provides AVA neuron-specific expression of ZIF-1, leading to depletion of TWK-40 from AVA. Animals have loopy forward and reversal movements compared to twk-40(bln282) alone.