More Fields
Strain Species Genotype
JLF104 C. elegans zyg-9(wow12[ZF::GFP::SEC::3xFlag::zyg-9]) II; zif-1(gk117) III. Show Description
ZF-degron, GFP, and 3xFlag tags inserted into endogenous zyg-9 locus. No overt phenotypes in a zif-1(gk117) background. GFP fluorescence is observed in microtubules. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171.
JLF145 C. elegans zif-1(gk117) III; air-1(wow14[air-1::ZF::GFP::3xFLAG]) V. Show Description
ZF-degron, GFP, and 3xFLAG tags inserted into endogenous air-1 locus. No overt phenotypes in a zif-1(gk117) background. GFP expression is observed in mitotic cells at the spindle poles and along microtubules. Presence of ZF-degron targets tagged proteins for ZIF-mediated degradation. Expression of ZIF-1 causes the tagged AIR-1 protein to be degraded. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
JLF212 C. elegans par-6(wow31[par-6::ZF::GFP::3xFLAG]) I; zif-1(gk117) III. Show Description
ZF-degron, GFP, and 3xFLAG tags inserted into endogenous par-6 locus. No overt phenotypes in a zif-1(gk117) background. GFP fluorescence is observed at the anterior cortex in zygotes and at apical surfaces in epithelia. Presence of ZF-degron targets tagged proteins for ZIF-mediated degradation. Expression of ZIF-1 causes the tagged PAR-6 protein to be degraded. Reference: Sallee M, et al. eLife. 2021 Jun 17;10:e64437. doi: 10.7554/eLife.64437. PMID: 34137371.
JLF238 C. elegans tpxl-1(wow34[ZF::GFP::3xFlag::tpxl-1]) I; zif-1(gk117) III. Show Description
ZF-degron, GFP, and 3xFLAG tags inserted into endogenous tpxl-1 locus. No overt phenotypes in a zif-1(gk117) background. GFP expression is observed in microtubules. Presence of ZF-degron targets tagged proteins for ZIF-mediated degradation. Expression of ZIF-1 causes the tagged TPXL-1 protein to be degraded. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171.
JLF24 C. elegans gip-1(wow5[ZF::GFP::gip-1]) zif-1(gk117) III. Show Description
ZF-degron and GFP tags inserted into endogenous gip-1 locus. No overt phenotypes in a zif-1(gk117) background. GFP fluorescence is observed at microtubule-organizing centers. Presence of ZF-degron targets tagged proteins for ZIF-mediated degradation. Expression of ZIF-1 causes the tagged GIP-1 protein to be degraded. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
OP781 C. elegans unc-119(tm4063) III; wgIs781. Show Description
wgIs781 [pzf-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
VC4073 C. elegans fezf-1(gk5147[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2724 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACTAAAGGCAAATCTGGATATAAACCGCC ; Right flanking sequence: ATCGTATAACCTTGCATTCCACATGTTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
YL195 C. elegans pzf-1(vr3) V. Show Description
Superficially wild type.
ZM10113 C. elegans twk-40(bln282[twk-40::TagRFP::ZF]) III; hpIs727. Show Description
hpIs727 [rig-3p::zif-1::sl2::RFP + ttx-3p::GFP]. twk-40(bln282) is a CRISPR generated tagged allele of endogenous twk-40 locus inserting TagRFP and a ZIF-1 directed degron to the endogenous TWK-40, allowing visualization of endogenous protein expression and localization as well as targeted degradation. The presence of hpIs727 in the background leads to specific degradation of TWK-40 from AVA, causing loopy forward and reversal movement compared to twk-40(bln282) alone.
ZM10355 C.elegans twk-40(bln282[twk-40::TagRFP::ZF]) III; hpEx4120. Show Description
hpEx4120 [rgef-1p::GPI::YFP]. Pick YFP+ animals to maintain. TagRFP::ZF tag inserted into endogenous twk-40 locus.
AGK192 C. elegans unc-119(ed3) III; zdIs13 IV; armIs5. Show Description
zdIs13 [tph-1p::GFP] IV. armIs5 [zfp-1(fosmid)::FLAG + unc-119(+)]. Integrated zfp-1 transgene expressed in the germline. Fosmid-based zfp-1::FLAG transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. ChIP with anti-FLAG antibody detects ZFP-1::FLAG localization to promoters of highly expressed genes. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. Cecere G, et al. Mol Cell. 2013 Jun 27;50(6):894-907.
AGK26 C. elegans unc-119(ed3) III; armEx5. Show Description
armEx5 [zfp-1(fosmid)::GFP + unc-119(+)]. Pick non-Unc to maintain. Fosmid-based zfp-1::GFP transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. Nuclear expression of zfp-1::GFP is observed ubiquitously in somatic cells in all developmental stages; high levels of GFP expression is observed in oocytes with lower levels of expression in the distal germline. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
AGK280 C. elegans zfp-1(ok554) unc-119(ed3) III; armEx14. Show Description
armEx14 [PHD1-PHD2::FLAG + zfp-1(short isoform) + unc-119(+)]. Pick non-Unc animals to maintain. The fosmid-based armEx14 transgene rescues zfp-1(ok554)/nDf17 lethality. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
AGK369 C. elegans zfp-1(ok554) III; armIs8. Show Description
armIs8 [zfp-1(short isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs8 transgene rescues the protruded vulva phenotype of zfp-1(ok554). Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
AGK370 C. elegans zfp-1(ok554) III; armIs9. Show Description
armIs9 [zfp-1(long isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs9 transgene rescues zfp-1(ok554)/nDf17 lethality. Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
AML1 C. elegans zfIs18; zfIs42. Show Description
zfIs18 [mec-4p::ChR2::YFP]. zfIs42 [rig-3p::GCaMP3::SL2::mCherry]. Pick mCherry+ animals to maintain strong expression from zfIs42. Worm expresses light-sensitive Channelrhodopsin (ChR2) and yellow fluorescent protein (YFP) in mechanosensory neurons, ALMR/L, AVM, PLML/R, and PVM. When fed all-trans retinal, blue light stimulation (473 nm at 2 mW * mm^-2) of head induces reversals. GCaMP3 and and mCherry expression in command interneurons AVA, and nearby pharyngeal neurons I1, I4, M4, NSM. Worms were made by crossing the integrated strains QW309 and QW625. Reference: Shipley FB, et al. Front Neural Circuits. 2014 Mar 24;8:28.
FT1341 C. elegans xnIs23. Show Description
xnIs23 [cdc-42p::zf1::GFP::cdc-42 + unc-119(+)]. Transgene insertion expressing ZF1::GFP::CDC-42 ubiquitously in somatic cells. Might still have unc-119(ed3) in the background. Reference: Armenti ST, et al. Development 2014 (in press).
FT1450 C. elegans unc-119(ed3) III; xnIs23; xnEx342. Show Description
xnIs23 [cdc-42p::ZF1::GFP::cdc-42 + unc-119(+)]. xnEx342 [rab-3p::zif-1 + rab-3p::mCherry + rol-6(su1006)]. Pick Rollers to maintain. ZF1::GFP::cdc-42 is expressed ubiquitously and enriched at the plasma membrane. In embryos inheriting xnEx342, ZF1::GFP::cdc-42 is degraded and mCherry is expressed in neurons. Reference: Armenti ST, et al. Development. 2014 Dec;141(23):4640-7.
FT1481 C. elegans unc-119(ed3) III; xnIs23; xnEx350. Show Description
xnIs23 [cdc-42p::ZF1::GFP::cdc-42 + unc-119(+)]. xnEx350 [elt-2p::zif-1 + elt-2p::mCherry + rol-6(su1006)]. Pick Rollers to maintain. ZF1::GFP::cdc-42 is expressed ubiquitously and enriched at the plasma membrane. In embryos inheriting xnEx350, ZF1::GFP::cdc-42 is degraded and mCherry is expressed in the intestine. Reference: Armenti ST, et al. Development. 2014 Dec;141(23):4640-7.
FT1523 C. elegans sec-5(xn51[sec-5::zf1::YFP + LoxP::unc-119::LoxP]) II; unc-119(ed3) III. Show Description
sec-5(xn51 [sec-5::zf1::YFP + LoxP::unc-119::LoxP]) II. Knock-in of zf1::yfp and unc-119(+) into the sec-5 locus. Expresses SEC-5::ZF1::YFP maternally and zygotically. Expression in many cells, including early embryos, epithelial cells, excretory cell, and germ line. unc-119 is present in reverse orientation within an intron of YFP. Reference: Armenti ST, et al. Development 2014 (in press).
FT1547 C. elegans unc-119(ed3) III; xnIs23; xnEx380. Show Description
xnIs23 [cdc-42p::ZF1::GFP::cdc-42 + unc-119(+)]. xnEx380 [hsp-16.41p::zif-1::SL2::mCherry + rol-6(su1006)]. Pick Rollers to maintain. ZF1::GFP::cdc-42 is expressed ubiquitously and enriched at the plasma membrane. In embryos inheriting xnEx380, ZF1::GFP::cdc-42 is degraded and mCherry is expressed after heatshock. Reference: Armenti ST, et al. Development. 2014 Dec;141(23):4640-7.
FT36 C. elegans unc-101(m1) par-6(zu170) I; zuIs43. Show Description
zuIs43[pie-1::GFP::PAR-6::ZF1 + unc-119(+)]. Unc worms. GFP present in early embryos but then degrades in somatic lineages. Rescues Mel phenotype of par-6(zu170).
JJ1440 C. elegans unc-119(ed3) III; zuIs20. Show Description
zuIs20 [par-3p::par-3::ZF1::GFP + unc-119(+)]. GFP-tagged PAR-3 that is degraded in early embryonic somatic cells. Worms carrying the transgene are non-Unc and express GFP very weakly in early embryos (only detectable by antibody staining), and later in adherens junctions of epithelial cells.
JJ1494 C. elegans unc-119(ed3) III; zuIs58. Show Description
zuIs58 [unc-119(+) + par-6::PAR-6::ZF1::GFP].
JJ1578 C. elegans par-6(zu222) unc-101(m1); zuIs54. Show Description
zuIs54 [par-6p::par-6::ZF1::GFP + unc-119(+)]. Unc. GFP-tagged PAR-6 that degrades in early embryonic somatic cells; rescues the Par phenotype of par-6(zu222). Delayed gastrulation of endodermal cells. Reference: Nance J, Munro EM, Priess JR. Development. 2003 Nov;130(22):5339-50.
JJ1600 C. elegans par-3(it71) lon-1(e185) III; him-8(e1489) IV; zuIs20. Show Description
zuIs20 [par-3p::par-3::ZF1::GFP + unc-119(+)]. Lon. Him. GFP-tagged PAR-3 that is degraded in early embryonic somatic cells. Rescues the Par phenotype of par-3(it71). Delayed endodermal cell gastrulation. Reference: Nance J, Munro EM, Priess JR. Development. 2003 Nov;130(22):5339-50.
JLF155 C. elegans zif-1(gk117) III. Show Description
Presumptive null deletion allele of zif-1. ZF1-tagged proteins are not degraded in zif-1(gk117) background. Genotyping primers: ExtFwd: gctcgcaacgactgacaagg // IntRev: GGTACTCGCGGAACACTCACTC // ExtRev: ATTCGTACGGTACTTGCATGAACC
NK2902 C. elegans bmdSi15 I; rpl-31(qy189[rpl-31::ZF1::GFP11]) I; zif-1(gk117) III; qyIs463. Show Description
qyIs463 [lin-29p::zif-1::SL2::mCherry]. bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). ZF1 and split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus.
OH16150 C. elegans nIs107 III; zfIs10 IV. Show Description
nIs107 [tbh-1::GFP] III. zfIs10 [tdc-1::mCherry] IV. RIC neurons are marked with both GFP and mCherry.
OP534 C. elegans unc-119(tm4063) III; wgIs534. Show Description
wgIs534 [zfp-2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
QW1075 C. elegans lite-1(ce314) X; zdIs5; zfEx416. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I. zfEx416 [rig-3p::GFP::SL2::mCherry]. Pick animals with red fluorescence to maintain zfEx416. Reference: Shipley FB, et al. Front Neural Circuits. 2014 Mar 24;8:28.
QW309 C. elegans zfIs18. Show Description
zfIs18 [mec-4p::ChR2::YFP + lin-15(+)]. Reference: Shipley FB, et al. Front Neural Circuits. 2014 Mar 24;8:28.
QW625 C. elegans zfIs42. Show Description
zfIs42 [rig-3p::GCaMP3::SL2::mCherry + lin-15(+)]. Reference: Shipley FB, et al. Front Neural Circuits. 2014 Mar 24;8:28.
RB774 C. elegans zfp-1(ok554) III. Show Description
F54F2.2A. Homozygous. Outer Left Sequence: attcaatcagcctgtggagg. Outer Right Sequence: tgctgctgctttctcgttta. Inner Left Sequence: gttggcttgctgccaataat. Inner Right Sequence: cctacaagtggcatgcgata. Inner primer WT PCR product: 2733. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RW12167 C. elegans zfh-2(st12167[zfh-2::GFP + loxP + unc-119(+) + loxP] I; unc-119(tm4063) III. Show Description
zfh-2(st12167[zfh-2::GFP + loxP + unc-119(+) + loxP] I.
RW12271 C. elegans zfp-3(st12271[zfp-3::TY1::EGFP::3xFLAG]) X. Show Description
CRISPR/Cas9 engineered tagged endogneous locus.
RW12277 C. elegans zfr-1(st12277[Y95B8A.8::TY1::EGFP::3xFLAG]) I. Show Description
Y95B8A.8. eGFP and 3xFLAG tags inserted into endogenous locus by CRISPR/Cas9.
VC3250 C. elegans zfp-3(gk3165) oga-1(gk3513) C34E11.3(gk3514) X. Show Description
This strain in homozygous for a deletion (gk3165) in W05H7.4, detectable by PCR using the following primers. External left primer: TCATTGTACGCTGGCTTCTG. External right primer: CCGCACTGAAATTGGTAGGT. Internal left primer: GATTGAGTCCATCCTTCCGA. Internal right primer: GAGAAATCGTTCAACGGGAA. Internal WT amplicon: 1623 bp. Deletion size: 781 bp. Deletion left flank: ACGTGGCGGACGGCCCGGAAGTGGCAAATC. Deletion right flank: CCGCCTCATTGAAGCAAATGCGCTCTACCG. Validation: gk3165 passed by CGH. Other deletions (gk3513, gk3514) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
ZF1092 C. sp. 25 Show Description
Isolated by Adeline Seah and Takao Inoue from a rotten fruit in an urban garden in Singapore (1.32°N, 103.82°E) on 7/19/2006.
ZF1222 C. sp. 25 Show Description
Isolated by Adeline Seah and Takao Inoue from a rotten fruit in an urban garden in Singapore (1.45°N, 103.72°E) on 7/19/2007.