syIs90 [egl-17::yfp + unc-119(+)] III. Expressed in vulC and vulD. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs123[unc-119(+) + fos-1a::YFP-TL]. Integration of functional fos-1a tagged with YFP at the N-terminus. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs118 [fos-1a::YFP-TX + unc-119(+)]. YFP inserted into Sal site seven amino acids down stream of start ATG of Cel-fos-L transcript. YFP from plasmid PPD136.64 (Andy Fire's 1999 kit). Promoter is from nucleotide 529 to 8110 of cosmid F29G9. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs179 [N2 genomic DNA (45 ng/uL) + unc-119(+) (1 ng/uL) + lin-4p::YFP (PCR fusion) (1 ng/uL)(100:1)]. lin-4 promoter primers: GCGATATTTTGCTCGATTCC, ACAGGCCGGAAGCATAAACT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs202 [vang-1::YFP + myo-2::DsRed + unc-119(+)]; outcrossing suggests array is integrated in LG V. Reference: Green JL, et al. Cell. 2008 Aug 22;134(4):646-56.

syIs341 [15xUAS::?pes-10::hChR2(Y134R)::YFP::let-858 3'UTR + ttx-3p::RFP + pBlueScript].  channelrhodopsin cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs342 [15xUAS::?pes-10::hChR2(Y134R)::YFP::let-858 3'UTR + ttx-3p::RFP + pBlueScript].  channelrhodopsin cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs567 [15xUAS::destabilized-YFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] YFP cGAL effector.

syIs605 [15xUAS::iC1-C2-TS::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Chloride-conducting channelrhodopsin cGAL effector.

syIs629 [15xUAS::ChR2(C128s)::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Stable step function ChR2 variant cGAL effector.

syIs635 [15xUAS::hChR2(C128s, D156A)::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Stabilized step function Opsins ChR2 variant cGAL effector.

syIs639 [15xUAS::SwiChR::TS::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Step-Waveform Inhibitory Channelrhodopsin cGAL effector.

zfIs18 [mec-4p::ChR2::YFP + lin-15(+)]. Reference: Shipley FB, et al. Front Neural Circuits. 2014 Mar 24;8:28.

rdIs4 [ehn-3a::Venus + unc-119(+)] X. Expresses Venus (YFP) in Z1/Z4 beginning in embryogenesis and continuing through the L1 larval stage. Reference: Large EE and Mathies LD. G3 (Bethesda). 2014 Mar 20;4(3):471-83.

rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.

rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.

rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. ddIs6 [pie-1p::GFP::tbg-1 + unc-119(+)] V. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.

mdIs126 [snt-1p::snt-1(genomic; B-stop)::CFP]. mdIs129 [snt-1p::snt-1(genomic; A-stop)::YFP]. snt-1 mutation in genome is rescued by 2 integrated transgenes. snt-1(genomic; B-stop) = complete snt-1 genomic region with an in-frame stop codon engineered into exon 6B; also referred to as "snt-1(A only)." snt-1(genomic; A-stop) = complete snt-1 genomic region with an in-frame stop codon engineered into exon 6A; also referred to as "snt-1(B only)." Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.

trIs10 [myo-3p::MB::YFP + myo-2p::YFP + ceh-23::HcRed + unc-25::DsRed + unc-129nsp::CFP].

trIs30 [him-4p::MB::YFP + hmr-1b::DsRed2 + unc-129nsp::DsRed2].

trEx1010 [pgp-14p::sms-5B(genomic)::Flag::mCherry + pgp-14p::YFP::pgp-14]. Pick animals with mCherry+ pharynx to maintain. Fluorescence is more apparent in older animals (late stage larvae to young adults). Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951.

gaSi300 [rps-0p::YFP-DD + Cbr-unc-119(+)] I. Expresses YFP tagged at the C terminus with a destabilizing domain (ecDHFR, mutated to function at 20C). YFP expression is absent in normal culture conditions, but expressed in the presence of the stabilizing ligand trimethoprim. Reference: Cho U, et al. PLoS One. 2013 Aug 22;8(8):e72393.

ddIs15 [C47B2.3(genomic)::YFP + unc-119(+)]. Alpha tubulin::YFP.

uIs59 [unc-119p::YFP]. Pan-neuronal YFP expression. Maintain 15-20C. Reference: Calixto A, et al. (2010) Nature Methods 7:554-9.

uIs60 [unc-119p::YFP + unc-119p::sid-1]. Hypersensitive neuronal RNAi by feeding. Superficially wild-type. YFP detectable in neurons. Maintain 15-20 degrees. Reference: Calixto et al. (2010) Nature Methods 7:554-9.

uIs57 [unc-119p::YFP + unc-119p::sid-1 + mec-6p::mec-6]; appears to map to LG V. Hypersensitive neuronal RNAi by feeding. Superficially wild-type. YFP detectable in neurons. Maintain 15-20 degrees; sick at 25 C. Reference: Calixto et al. (2010) Nature Methods 7:554-9.

vbaIs52 [eef-1A.1p::YFP::nrde-3] II. Maintain at 20C or cooler; germline mortal (Mrt) at 25C. YFP::NRDE-3 localizes to the cytoplasm, except in the germline, early embryo, and intestine. Upon introduction of dsRNA, YFP::NRDE-3 labels transcription sites of dsRNA gene targets. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.

vbaIs54 [eef-1A.1p::YFP::nrde-3::SL2::sid-1] II. YFP::NRDE-3 localizes to the cytoplasm in most somatic tissues and upon exposure to dsRNA targetting a gene, moves to the nucleus in cells expressing the transgene. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.

hdIs42[ast-1::YFP + rol-6(su1006)]. GFP expression in neurons; contains full length AST-1 tagged with GFP at the C terminus. Rollers.

hdIs17 [glr-1::YFP + unc-47::YFP + unc-129::YFP + rol-6(su1006)]. hdIs10 [unc-129::CFP + glr-1::YFP + unc-47::DsRed + hsp-16::rol-6(su1006)]. Rollers. Reduced progeny at 25C (almost sterile). RNAi hypersensitive, effective RNAi in the nervous system. unc-47::DsRed is weak and only visible in adults. hsp-16::rol-6 transgene is not effectively Roll. Maintain at 15 or 20C.

vkEx1104 [nhx-2p::YFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.

vkEx1256 [nhx-2p::cpl-1::YFP + nhx-2p::DsRed::KDEL]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.

vkEx1258 [nhx-2p::cpl-1(W32AY35A)::YFP + nhx-2p::DsRed::KDEL]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.

vkEx1260 [nhx-2p::cpl-1::YFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.

vkEx1770 [nhx-2p::F13D12.6::YFP + nhx-2p::DsRed::KDEL]. YFP+ intestine. Reticular dsRed expression in intestine. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.

vkEx1870 [nhx-2p::F13D12.6(G166R)::YFP + myo-2p::mCherry]. YFP+ intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.

vkEx1879 [nhx-2p::cpl-1(W32A Y35A)::YFP + myo-2p::mCherry]. YFP+ accumulation in intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.

vkEx1879 [nhx-2p::cpl-1(W32A Y35A)::YFP + myo-2p::mCherry]. YFP+ accumulation in intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.

vzEx60 [dnj-27p(2kb)::dnj-27::YFP::KDEL]. Superficially wild-type. Pick YFP+ to maintain. Fluorescence should be easily detected under a dissection scope if present, but array has low transmission rate. Reference: Muñoz-Lobato F, et al. Antioxid Redox Signal. 2014 Jan 10; 20(2): 217-235.

zpEx204 [pat-4::YFP + pat-3::CFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. zpEx204 produces a fully functional YFP-tagged pat-4 protein that localizes to the dense bodies in muscle cells, and rescues the lethal phenotype of pat-4(st551) homozygous animals. Reference: Mackinnon AC, et al. Curr Biol. 2002 May 14;12(10):787-97.

opIs76 [cyb-1p::cyb-1::YFP + unc-119(+)]. The fusion protein partially rescues a cyb-1 null allele, so it is at least partially functional. non-Unc strain.

opIs110 [lim-7p::YFP::actin + unc-119(+)] IV. YFP::ACT-5 expressed in somatic sheath cells, marks pre-disc corpses.

opIs257 [rad-54p::rad-54::YFP::rad-54 3'UTR + unc-119(+)].

opIs263 [rpa-1p::rpa-1::YFP + unc-119(+)]. YFP expression in soma and germline.

opIs310 [ced-1p::YFP::act-5::let-858 3'UTR + unc-119(+)].

opIs310 [ced-1p::YFP::act-5::let-858 3'UTR + unc-119(+)].

qaIs3502[unc-119(+) + pie-1::YFP::lmn-1 + pie-1::CFP::H2B] Relative stable expression of YFP::LMN-1 when grown at 24C. Expression of CFP::H2B is silenced. qaIs3502 is presumably not on LG III. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Commercial requests should be addressed to info@embl-em.de

yakEx137 [unc-14p::hif-1(P621A)::YFP + myo-2p::mCherry]. Pick animals with red pharynx to maintain. Non-degradable form of HIF-1 tagged with YFP expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx137 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

hpEx4120 [rgef-1p::GPI::YFP]. Pick YFP+ animals to maintain. TagRFP::ZF tag inserted into endogenous twk-40 locus.

hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. Reference: Gao S, et al. 2015. Nature Communications 6, Article number: 6323.