More Fields
Strain Species Genotype
VC4369 C. elegans Y55F3BR.1(gk5450[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 8878 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATTGTATTTCAGTCCCGAATCCTGCAAAAA; Right flanking sequence: CACTATTTTCTTATCAAATTCCGTGTTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
BC10565 C. elegans dpy-5(e907) I; sEx10565. Show Description
sEx10565 [rCesY55F3BR.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).