sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Paralyzed Unc.

wpIs36 [unc-47p::mCherry] I. sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)].

wpIs36 [unc-47p::mCherry] I. sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Paralyzed Unc.

wpIs36 [unc-47p::mCherry] I. sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Unc; almost paralyzed. Growth slow.

sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Maintain at 15 degrees. Temperature-sensitive embryonic lethal. 100% dead embryos at 25 degrees. Small, posteriorly displaced first mitotic spindle with defective chomosome segregation and cytokinesis.

sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Unc. Slow moving.

sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Unc.

sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)].

sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Paralyzed Unc. Slow growth.

[D943G] substitution mutation in conserved residue within RNAse III domain. Balancer marked with myo-2p::Venus. Pick fertile wild-type (non-Dpy) Venus+ to maintain. drsh-1(viz43) homozygous animals display heterochronic phenotypes beginning at L3/L4 molt and typically burst at the vulva in L4. Heterozygotes are wild-type with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus viz-43 homozygotes, and Dpy Venus+ tmC18 homozygotes. Reference: Barish S, et al. Human Mol Genet. 2022 Aug 25;31(17):2934-2950. doi: 10.1093/hmg/ddac085. PMID: 35405010.

Homozygous sterile deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm6688 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989.

Homozygous lethal deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm15993 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. 93% of tm15993 homozygotes die before adulthood and those that escape are sterile. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989.

tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.

Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are paralyzed Unc and Egl with relatively dim pharyngeal GFP (Venus) expression. Heterozygotes segregate heterozygous non-Dpy GFP+ paralyzed Unc and Egl, non-GFP embryonic lethal (homozygous n499), and Dpy with brighter GFP+ (tmC20 homozygous). This strain is difficult and time consuming to maintain. Gives relatively few heterozygotes. Remove Dpy from plate to prevent them from taking over. Heterozygotes tend to stack up in parallel clumps. Populations can be enriched by transferring these clumps to new plates and allowing Dpy (tmC20 homozygotes) to crawl out into bacterial lawn, and then picking away Dpy or transferring the clump of Hets to another plate. Derived by balancing n499 from parental strain MT1102 over tmC20 from FX30179.

Lethal/sterile dpy-26 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus n199 homozygotes (variable morphology). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Derived by crossing parental strains FX30140 with CB5101 (males).

uqIs12 [myo-2p::rho-1::Venus]. RHO-1::VENUS aggregates in pharyngeal muscles. Generated in N2 background. References: Huang YC, et al. Elife. 2019 May 3;8. pii: e43059. doi: 10.7554/eLife.43059.

uqEx37 [kin-19p::kin-19::Venus + unc-122p::GFP]. Age-dependent aggregation of KIN-19::Venus in pharynx.

uonEx1 [unc-54::alpha-synuclein::CFP + unc-54::alpha-synuclein::YFP(Venus)]. No additional transformation marker was included in the array. uonEx1 also known as SC+SV in reference publications. Reduced lifespan (25-35% lower) and reduced pharyngeal pumping rate compared to N2. Novel transgenic strain for monitoring the influence of genetic and/or environmental factors on the extent of alpha-synuclein aggregation using FRET signals. Because the two fusion proteins are separate, FRET is only possible when synuclein aggregation brings a CFP tag very close to a YFP tag within an aggregate. We suggest using this strain in conjunction with the positive control (high FRET) strain DDP2 or with strain NL5901 which shows opposite changes in FRET. References: Nagarajan A, et al. CNS Neurol Disord Drug Targets. 2015 Aug 21. Bodhicharla R, et al. CNS Neurol Disord Drug Targets. 2012 Dec;11(8):965-75.

uonEx2 [unc-54::CFP::YFP(Venus)]. No additional transformation marker was included in the array. uonEx2 also known as CV in reference publications. Lifespan and pharyngeal pumping rates are similar to N2. This is a high-FRET positive control strain for use in conjunction with DDP1. Because the CFP and YFP protein sequences are covalently fused together (and show little evidence of cleavage), FRET should be high and largely invariant since both fluorescent moieties are always in close proximity. References: Nagarajan A, et al. CNS Neurol Disord Drug Targets. 2015 Aug 21. Bodhicharla R, et al. CNS Neurol Disord Drug Targets. 2012 Dec;11(8):965-75.

uwaEx1 [eft-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. Ubiquitously-expressed lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaSi5 [myo-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in body wall muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx6 [rab-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in neurons. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx8 [eft-3p::CERULEAN-VENUS + unc-119(+)]. Pick non-Unc to maintain. Ubiquitously-expressed oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx8 [eft-3p::CERULEAN-VENUS::tomm-7 + unc-119(+)]. Pick non-Unc to maintain. Ubiquitously-expressed tomm-7 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaSi1 [eft-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. Ubiquitously-expressed lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx2 [vha-6p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the intestines. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaSi2 [vha-6p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the intestines. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx3 [dpy-7p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the hypodermis. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaSi3 [dpy-7p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the hypodermis. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx4 [myo-2p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in pharyngeal muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaSi4 [myo-2p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in pharyngeal muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx5 [myo-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in body wall muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

rdIs4 [ehn-3a::Venus(delta)]. Temperature-sensitive. Must be maintained at 15°C to produce progeny. Strain develops as hermaphrodites at 15°C (some animals are intersex with male tails), and develops as XX pseudomales at 25°C. GFP expressed in gonadal precursors. Reference: Kroetz MB & Zarkower D. G3 (Bethesda). 2015 Oct 23;5(12):2831-41.

rdIs4 [ehn-3a::Venus(delta)]. Slightly Egl. Male lethal. GFP expressed in gonadal precursors. Reference: Kroetz MB & Zarkower D. G3 (Bethesda). 2015 Oct 23;5(12):2831-41.

eraIs1 [dat-1p::mCherry + dat-1p::hSNCA::Venus]. Inclusions of human alpha-Synuclein::Venus in dopaminergic neurons with marked with mCherry. Overexpression of human SNCA (alpha-Synuclein tagged with Venus) causes degenerative signs in dopaminergic neurons. Reference: Vozdek R, et al. 2022 Apr 27:14:806000. doi: 10.3389/fnagi.2022.806000. PMID: 35572147.

tmEx4487 [unc-18(+) + myo-2p::Venus]. Break points: In(F53B1.2 unc-18 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2.1..8.5) Lon Mec (Unc). Pick fluorescent non-Unc to maintain array. Males carrying the array (Venus in pharynx) can mate. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.

Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Balancer marked with myo-2p::Venus. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(unc-83 C27A7.1 In(unc-23 lon-3)) V. Covered region (Mb) 5.7 (6.5..12.2) Balancer marked with myo-2p::Venus. Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(C01B10.3 eak-7 In(mec-3 unc-31)) IV. Covered region (Mb) 6.2 (6.6..12.8) Balancer marked with myo-2p::Venus. Mec Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(hlh-10 C01G10.10 In(unc-23 lon-3)) V. Covered region (Mb) 6.1 (8.9..15.1) Balancer marked with myo-2p::Venus. Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Balancer marked with myo-2p::Venus. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(F53G12.8 T02E1.7 In(gsp-3 sre-23)) I. Covered region (Mb) 8.1 (0.1..8.3) Balancer marked with myo-2p::Venus. tmIs1219 is inserted in unc-14, but Unc phenotype is not detectable. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(F53G12.8 T02E1.7 In(gsp-3 sre-23)) I. Covered region (Mb) 8.1 (0.1..8.3) Balancer marked with myo-2p::Venus. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Balancer marked with myo-2p::Venus. Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(mak-2 unc-8 In(kvs-5 dmd-9)) IV. Covered region (Mb) 6.5 (0.7..7.2) Balancer marked with myo-2p::Venus. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(ile-1 Y18D10A.2 In(dnj-27 dkf-1)) I. Covered region (Mb) 4 (9.6..13.6) Balancer marked with myo-2p::Venus. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(Y102A11A.6 R09F10.1 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2..8.5) Balancer marked with myo-2p::Venus. Lon Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(flp-34 C04E6.7 In(srbc-66 T10H9.8)) V. Covered region (Mb) 5.6 (1..6.7) Balancer marked with myo-2p::Venus. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(glb-19 lgc-52 In(mec-3 unc-31)) IV. Covered region (Mb) 4.8 (10.5..15.2) Balancer marked with myo-2p::Venus. Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Balancer marked with myo-2p::Venus. Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.