ZC317.3 Homozygous. Outer Left Sequence: TCAAAATACAGGGGTAGGCG. Outer Right Sequence: ACAATTCCTGGAACTCACGG. Inner Left Sequence: TGAAGAGGTTTTGAAACGCA. Inner Right Sequence: ACTTTCCGAGAGGAATGGGT. Inner Length: 2746. Estimated Deletion Size: 1200. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/

R09B5.11 Homozygous. Outer Left Sequence: ctgtcgcaagtcctgattga. Outer Right Sequence: gtttccggaacaaacttcca. Inner Left Sequence: gaacgagtgtttctgggacg. Inner Right Sequence: atgaggaaggcgtactggtg. Inner Primer PCR Length: 3113. Deletion size: 1273 bp. Left flank: TATCAGTTTGAAGAGGCACTCGAAAACCTT. Right flank: ACTGTTCTATATATAAGCTGAAGTTCAACC. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/

Superficially WT. Suppressor of gna-2. Reduced brood counts at all temperatures (strongly reduced at 26C). Reduced embryo survival following heat shock. Hypomorph.

Superficially WT. Suppressor of gna-2. Reduced brood counts at all temperatures (very strongly reduced at 26C). Exhibits mating-dependent progressive hermaphrodite sterility. Reduced embryo survival following heat shock.

qaIs8400 [let-858p::Ov-GST-3 + rol-6(su1006)]. Called AK1 in the reference article. The Ov-GST-3 gene was amplified from genomic DNA of O. volvulus with 1µM of the sequence specific primer 5'Klon and 3'Klon (5'Klon: 5'-GGCGTACGATGTCAAGATTTCCTCAACAAG-3'; 3'Klon: 5'-GGTCTAGATTTATTTAGGAATGATTGAATCGGTCG-3'; representing bases 4 - 25 and the complementary sequence of bases 821 - 841 of the published Ov-GST-3 cDNA (AF203814); bold underlines indicate restriction sites for Pfl23II (SplI) and XbaI, respectively; dotted underline indicates the start codon for translation; italics indicates the conserved sequence for the polyadenylation signal for transgenic transcript processing; the 8 5'-nucleotides of primer 3'Klon and the fourteen 5'-nucleotides of primer 5'Klon do not correspond to the template and introduce the sequences to the amplicon), 200 µM of each deoxynucleotide (Gibco BRL) and 2.5 units of Taq polymerase (Gibco BRL). After an initial denaturation of 3 minutes at 93°C, 35 cycles of annealing at 55°C for 1 minute, synthesis at 72°C for 2 minutes and a 1 minute denaturation at 93°C were performed, followed by a final extension at 72°C for 5 minutes. The genomic Ov-GST-3 fragment obtained by PCR (see above) was ligated into the pGEM-T Easy vector (Promega) by TA-cloning, cleaved with the restriction enzymes Pfl23II (SplI) and XbaI (restriction sites introduced by the primer) and inserted between the unique Pfl23II (SplI) and XbaI sites of the vector pPD103.05 (kindly provided by A. Fire). The sequence of the genomic Ov-GST-3 fragment in the resulting plasmid pAK1 was confirmed by automated dye terminator, dideoxy sequencing (ABI Prism 377TM Sequencer, PE Applied Biosystems) using the PCR primers (see above). The pAK1 DNA was injected in combination with the marker plasmid pRF4 [rol-6(su1006)] into the gonads of N2 C. elegans at a concentration of approximately 100 ng/µl for each plasmid. Transgenic worms were identified by the selectable Roller marker phenotype and the stable transmitting line AK1ex (AK1 extrachromosomal) was established. Integration of the extrachromosomal arrays was achieved by irradiation of AK1ex worms with 3600 rad (1 rad = 0.01 Gy) of x-rays (x-ray chamber: RUM 9421-070-77002, Philips, Netherlands; dosimeter: PTW-SN4, PTW, Germany). The progeny of these worms was then screened for 100% transmittance of the Roller phenotype to obtain the C. elegans line AK1int (AK1 integrated) with the chromosomally integrated transgenes.

wpIs36 [unc-47p::mCherry] I. wpSi1 [unc-47p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. GABAergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the GABAergic neurons; all other tissues are resistant to RNAi. Superficially wild type with mCherry fluorescence in the GABA motor neurons. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.

wpSi6 [dat-1p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Dopaminergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the dopaminergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.

wpSi10 [unc-17p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Cholinergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the cholinergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.

wpSi11 [eat-4p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Glutamatergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the glutamatergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.

wp78 is a CRISPR/Cas9-engineered 11.5 kb deletion removing the entire coding region of casy-1, the C. elegans homolog of calsyntenin. casy-1(wp78) phenocopies the casy-1(wp60) point mutation and strongly suppresses PVQ degeneration in both ric-7(n2657) and miro-1(wy50180); mtx-2(wy50266) mutants. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.

oyIs14 [sra-6p::GFP] V. wpEx369 [sra-6p::mito::TagRFP + odr-1p::RFP]. Maintain by picking animals with red fluorescence. PVQ neurons are marked with integrated GFP marker. Mitochondria in PVQ neurons are visualized with sra-6p::mito::TagRFP. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. doi: 10.7554/eLife.73557. PMID: 35285800.

wpEx505 [ocr-3p::mEGFP + pha-1(+)]. Maintain at 23-25C to select for array. PVP neurons are marked with mEGFP. Can be used to isolate PVP by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). The ocr-3p::mEGFP plasmid used to generate this strain was provided by Dr. Patrick Laurent.

vab-1 null and itr-1 gain of function. Viable. Unc.

Heterozygotes are Unc with pharyngeal GFP signal. Homozygous hT2[bli-4 let-? qIs48] are inviable. Homozygous unc-43(n498); fog-3(q443) animals are females.

qxIs722 [dpy-7p::dpy-7::SfGFP (single copy)]. qxIs722 is a single copy insertion into ttTi5605 via CRISPR/Cas9. DPY-7::SfGFP expression in cuticle over hyp7. Reference: Miao R, et al. Dev Cell. 2020 Jan 6;52(1):21-37.e5.

Becomes very sick if starved for extended periods of time or if frozen and thawed repeatedly. Primer sequences provided by the C. elegans Reverse Genetics Core Facility for ok410 are: Outer Left Sequence: AAGACTGTCAGCTGGTGGGT. Outer Right Sequence: TTAGCCTTACATTGCCGCTT. Inner Left Sequence: TCATGCGCAACATCTAAAGC. Inner Right Sequence: CGAATAAAGCAATTTCCCGA. Inner primer WT PCR product: 2825.

Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2421 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. ok2421 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.

Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3294 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. ok3294 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.

Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm2868 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. tm2868 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.

syIs50 [cdh-3::GFP + dpy-20(+)]. Heterozygotes are WT and GFP+, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile and Unc). All worms express cdh-3::GFP at the anchor cell. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.

qIs19 [lag-2p::GFP::unc-54 3'UTR + rol-6(su1006)] V. Heterozygotes are Rollers with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, and non-GFP gk324 homozygotes (Sterile and Unc). All worms express lag-2p::GFP at the distal tip cells. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.

syIs78 [ajm-1::GFP + unc-119(+)] is probably on LG I (not on II, III, V or X). Heterozygotes are WT and GFP+, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile, Roller and Unc). All worms express ajm-1::GFP (Junction Associated Protein). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.

ccIs4810 [(pJKL380.4) lmn-1p::lmn-1::GFP::lmn-1 3'utr + (pMH86) dpy-20(+)] X. Heterozygotes are WT with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile and Unc). All worms express Cel-lamin::GFP (lmn-1 gene is expressed at the nuclear periphery). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.

zzIs16 [(pJE3) eff-1::GFP + rol-6(su1006)]. Heterozygotes are Rollers with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, and non-GFP gk324 homozygotes (Sterile, Roller and Unc). All worms express GFP driven by eff-1 promoter. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.

syIs78 [ajm-1::GFP + unc-119(+)] is probably on LG I (not on II, III, V or X). Heterozygotes are slow-growing DpyUnc with cell fusion problems and pharyngeal GFP signal. Segregates arrested hT2 aneuploids, and non-GFP DpyUnc gk324 homozygotes (Sterile, Dpy and Unc). All worms express ajm-1::GFP(Junction Associated Protein). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.

Homozygous sterile deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP bn115 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kim J, et al. (2009) Mol Cell 28:43-8.

Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok597 homozygotes (Emo, Ste). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kim J, Kawasaki I, Shim Y. (2010) J Cell Sci 123:993-1000.

vr25 is a Crispr/Cas9-induced 56 bp deletion in exon 2 of oef-1/F49E8.2 causing a frameshift and presumptive null allele. Accelerated rate of germ cell progression, precocious Z2/Z3 division in L1s, increased brood size and sperm generation, and increased germline apoptosis. Reference: McManus, CE & Reinke, V. Genetics. 2017; https://doi.org/10.1534/genetics.117.1123.

wfIs120 [app-1p::atg-18::unc-54 + unc-119(+)]. Intestine-specific promoter app-1 drives atg-18 expression in the atg-18(gk378) mutant background, providing rescue in intestinal cells. Reference: Chen HD, et al. Autophagy. 2016 Nov 22:1-15.

oxls12 [unc-47p::GFP + lin-15(+)]. Enhanced RNAi. Sterile at 25 degrees. [NOTE: the genotype of YY13 as previously annotated only as rrf-3(mg373)] References: Pavelec DM, et al. Genetics. 2009 Dec;183(4):1283-95. PMID: 19797044. McIntire SL, et al. Nature. 1997 Oct 23;389(6653):870-6. PMID: 9349821.

GFP tag inserted at the N-terminus of endogenous znfx-1 via CRISPR/Cas9. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.

Homozygotes are viable and do not show any gross abnormalities. Grows normally at all temperatures. Deletion removes 1505 bp including the first 4 exons.

Homozygous viable with neuronal defects.

Healthy and fertile in standard lab conditions, but unable to adapt to 1% oxygen. When hif-1(+) animals are incubated in1% oxygen, >94% will complete embryogenesis and larval development. In contrast, hif-1(ia4) mutants exhibit 66% embryonic lethality and 9% larval lethality in 1% oxygen. The requirement of hif-1 is alleviated if the oxygen level is increased to 2%. The ia4 mutation is a 1231 bp deletion of the second, third, and fourth exons, which encode much of the helix-loop-helix and PAS domains. Analysis of ESTs suggests that there are at least 4 alternatively spliced hif-1 transcripts. The ia4 deletion introduces a frameshift and a premature stop in the three longest forms.

enIs74 [mec-7p::GFP + dyn-1p::mfg-e8::mCherry + unc-76(+)] II. mec-7p::GFP labels touch neurons. MFG-E8::mCherry reporter binds exposed phosphatidylserine (PS) “eat me” signal on the surface of apoptotic or necrotic cells, providing a useful marker for identifying apoptotic or necrotic cells. Reference: Furuta Y, et al. PLoS Genet. 2021 Feb 11;17(2):e1009066.

hpIs727 [rig-3p::zif-1::sl2::RFP + ttx-3p::GFP]. twk-40(bln282) is a CRISPR generated tagged allele of endogenous twk-40 locus inserting TagRFP and a ZIF-1 directed degron to the endogenous TWK-40, allowing visualization of endogenous protein expression and localization as well as targeted degradation. The presence of hpIs727 in the background leads to specific degradation of TWK-40 from AVA, causing loopy forward and reversal movement compared to twk-40(bln282) alone.

hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. D motor neurons are marked with red fluorescence. No behavioral change upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).

hpIs721 [rig-3p::FRT::Stop::FRT::snb-1::GFP + nmr-1p::FLP::FLP + myo-2p::RFP]. hpIs811 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::Cherry + twk-40p(short)::Cre]. Transgenic animals have pharyngeal RFP signal; GFP puncta are visible in AVA soma but not along the VNC; RFP signals along AVA neurite.

ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4343 [acr-5p::TeTx::wCherry + unc-4p::TeTx::wCherry + HygromycinR]. Pick animals with wCherry expression in ventral cord neurons to maintain hpEx4343. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Animals carrying hpEx4343 rest as coilers strongly biased towards ventral bend as L1 larvae and are severely Unc as adults. Coiling is somewhat suppressed in the ljIs131 background, but animals still exhibit an obvious bias towards ventral bend during movement. Hygromycin can be used to select for hpEx4343 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.

Uncoordinated behaviour. Fainter, pauses quickly after stimulating touch-response by prodding or tapping plate. References: Humphry JA, et al. Curr Biol. 2007 Apr 3;17(7):624-9. Gao S, et al. Nat Commun. 2015 Feb 26;6:6323.

juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. Animals are WT looking. In WT, GABAergic synapses visualized with juIs1 (GABAergic nervous system specific synaptobrevin::GFP) marker show uniformly spaced and sized puncta. fsn-1(hp1); scd-2(ok565) animals have puncta close to WT shape. This is more evident in larvae than in adults.

Egl. Backward stiff and slow moving. Sluggish. Can move fast when poked. Outer pairs: F59F5.6EL1 (TTGCATCTGCAAAAGAAACG); F59F5.6ER1 (GCTCCGAACGAAAGAAGTTG). Inner pairs: F59F5.6IL1 (AATCTCTAACCATGCGGTCG); F59F5.6IR1 (CGCGGGAATTATGCCTATTA).

hpIs481 [ceh-12p::tomm20::miniSOG::SL2::BFP + unc-129(DB)p::tomm20::miniSOG::SL2::BFP + lin-15(+)]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. unc-129(DB)p is a fragment of the unc-129 promoter driving expression in only DB motor neurons (described in Colavita et al., Science 1998 31;281(5377):706-9). The ceh-12 promoter drives expression in VB motor neurons. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.

hpIs583 [acr-2(s)p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of A- and B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. acr-2s(p) is a 1.8 kb fragment of the acr-2 promoter driving expression in only A- and B- class motor neurons (described in Jospin et al, 2009 PLoS Biol. Dec;7(12):e1000265). Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.

hpIs636 [rig-3p::HisCl1::SL2::mCherry]. mCherry expression in AVA soma and neurites along VNC. Non-specific mCherry expression in gut. HisCl activation leads to reduced forward and reversal activity.

hpSi38 [flp-14(+) + NeoR]. hpIs201[ceh-10p::GFP + lin-15(+)]. GFP expression in RID neuron. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant behavioral defects and RID axon defects. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782

hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. D motor neuron activation and muscle relaxation upon illumination with green light. Muscle activity measured by GCaMP3. Reference: Lu Y, et al. 2022. Current Biology (In Press).

GFP tag inserted at the N-terminus (immediately in front of the ATG start codon) of the unc-2 locus specifically tagging the UNC-2B isoform. hp858 animals exhibit wildtype motor behaviors. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035

Gonadal enlargement and aberrant gonad migration. Phenotype evident at 25C.

Heterozygotes are WT. drh-3 homozygotes are sterile. the fj52 mutation deletes a 405 bp region including the promoter, the first exon and half of the second exon. The deletion can be checked by PCR with the following primers: TTTATTGATTCCGCCGTTGCTC and TGCAGCTCCAGCCACTCTATCA. The fj52 mutation was isolated from a deletion mutant libray of the K. Nishiwaki group. Homozygous hT2[bli-4 let-? qIs48] inviable.