More Fields
Strain Species Genotype
VC970 C. elegans +/szT1 [lon-2(e678)] I; pdi-6(ok1373)/szT1 X. Show Description
B0403.4. Homozygous viable deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1373 homozygotes (homozygotes are slow-growing, short, Unc, Egl, starve a plate only with difficulty). Viable hemizygous ok1373 males are also segregated. Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC971 C. elegans +/mT1 II; act-5(ok1397)/mT1 [dpy-10(e128)] III. Show Description
T25C8.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1397 homozygotes (arrest stage/phenotype undetermined; may be sterile adult). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC972 C. elegans arx-4(ok1093)/sC1 [dpy-1(s2170)] III. Show Description
Y6D11A.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok1093 homozygotes (arrest stage/phenotype undetermined)). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC974 C. elegans set-2(ok1484) III. Show Description
C26E6.9. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC975 C. elegans egas-2(ok1477) V. Show Description
Y69H2.12. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC976 C. elegans exc-9(gk395) IV. Show Description
F20D12.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC977 C. elegans his-69(gk394) III. Show Description
E03A3.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC978 C. elegans set-31(ok1482) V. Show Description
C15H11.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC979 C. elegans F18A12(gk911) II. Show Description
F18A12. External left primer: TAGTCGGCGCTTCAGGTACT. External right primer: CTGGGCTCTTTACTTCCGTG. Internal left primer: TTTCATGGCTTCTATCCGCT. Internal right primer: TTATCTGGAATCGGCTTTGG. Internal WT amplicon: 1859 bp. Deletion size: 721 bp. Deletion left flank: AATAAGGAAACATACCCGAAAAACTCGAGG. Deletion right flank: AAAAAATGGGGTTTTAATATTGTTTTTATA. Insertion Sequence: AAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC980 C. elegans fsn-1(gk429) III. Show Description
C26E6.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC983 C. elegans hda-2(ok1479) II. Show Description
C08B11.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC984 C. elegans rpn-9(gk401)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T06D8.8. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk401 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC985 C. elegans vps-54(ok1463) V. Show Description
T21C9.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC986 C. elegans vps-54(ok1473) V. Show Description
T21C9.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC987 C. elegans egas-2(ok1480) V. Show Description
Y69H2.12. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC988 C. elegans ceh-60(ok1485) X. Show Description
F22A3.5. Superficially wild type. External left primer: TATGGCGGTTCAAAATGTCA. External right primer: AAAGGTGAAGGTCACATCCG. Internal left primer: TCGAATTTTGCCCAGTTTTC. Internal right primer: TTCAGGCTCTCGGATGAACT. Internal WT amplicon: 2621 bp. Deletion size: 612 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC989 C. elegans gut-2(gk402)/+ V. Show Description
T10G3.6. Heterozygous strain. Homozygote is Pvl and sterile. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC990 C. elegans cnb-1(ok276) V. Show Description
F55C10.1. Slow-growing with small broods. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC992 C. elegans spv-1(ok1498) II. Show Description
ZK669.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC993 C. elegans gly-5(gk406) III. Show Description
Y39E4B.12a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC994 C. elegans inx-9(ok1502) IV. Show Description
ZK792.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC995 C. elegans ceh-12(gk391) I. Show Description
F33D11.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC996 C. elegans pas-5(ok1808) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F25H2.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1808 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGAGTGTTCACAAACCCAA. External right primer: TGGATTCTTTCCGAGGTGTC. Internal left primer: GCTCTGTCACCTCGAAGACC. Internal right primer: GCGGACGTATTGAATGTGTG. Internal WT amplicon: 2116 bp. Deletion size: 880 bp. Deletion left flank: GAGTACGATCGTGGAGTCAACACTTTTTCT. Deletion right flank: TTATTTGTCGTTCTTTTATACATTTTTGAA. Insertion Sequence: AAAAAATAGAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC997 C. elegans set-4(ok1481) II. Show Description
C32D5.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC998 C. elegans dnj-7(ok1495) X. Show Description
C55B6.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC999 C. elegans tag-340(ok1496) III. Show Description
F26F4.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VF9 C. elegans pcs-1(tm1748) II; hmt-1(gk161) III. Show Description
Acute hypersensitivity to heavy metals (Cd, As, Cu). Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
VH7018 C. elegans col-144(hd7006[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1165 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAACATATACATAGGTTACTACGATCCCA; Right flanking sequence: AGTAAGGTCATTCTGCGTCTCTCTTCATTT. sgRNA #1: AGAACCGCAATTACGATTAT; sgRNA #2: CAAAAGAATCTGCCGATGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7019 C. elegans W10C8.4(hd7005[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1936 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGGTTTACAAAGTTTTAGCGGCCGACACCT; Right flanking sequence: AGGAATGATTCAAGATATATATATATATAG. sgRNA #1: TCTTATCTTAGAAACCCGCG; sgRNA #2: CTGTGTGTGAATACCAATCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7020 C. elegans gst-28(hd7007[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 991 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTACTGAGTATCTGGACGAGCCTCTACCCA; Right flanking sequence: CGGAAGTCCTCGAATGGAACATCTGCCAAG. sgRNA #1: CAATTCCAGCTATCAGGAAG; sgRNA #2: TTCCATCTCCGTGTGTCATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7022 C. elegans ctf-18(hd7009[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 3842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCATTGTGTAATCTTTTCATTGCTCCG; Right flanking sequence: AAATGTTAGAAACACAATCTCACAACAATA. sgRNA #1: AAGAAGAAGAGACTATCTGC; sgRNA #2: CTAATGGATACAGCAAGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7025 C. elegans F28H1.4(hd7025[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 3045 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAGTTGGGTGAAAAAGATCTTGCGAATTA; Right flanking sequence: AGGGAACTGTTCGAGAAAAAATGGGACAAG. sgRNA #1: GAGGGTGATACGTACATGTA; sgRNA #2: AAGAAAATGGGGAAACACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7026 C. elegans lbp-5(hd7016[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1790 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGCTGATAATAAAACTTTCTTCAAATGCG; Right flanking sequence: GGCGGGCAACAAGGTTAAACGATGGCCAAT. sgRNA #1: AACTTTCTTCAAATGCGAGT; sgRNA #2: TTTAACGTGGAAGAGATGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7028 C. elegans F33D11.1(hd7023[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 515 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTGAATCAAGCCCCAGTTGGCAGTCATTT; Right flanking sequence: TGGGATCTTCAACTTCGGATGATTGTTTGC. sgRNA #1: CATACAATGCCACACACGCG; sgRNA #2: GTGTTCATTCCGATTGTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7030 C. elegans F43C1.7(hd7013[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 984 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGATAAAAATTAGGTATTTCAGGTTTTCCA; Right flanking sequence: GGGTTACTGTAGACGAAATGAATCCGAAAA. sgRNA #1: AACAACTTGAAGGAACTCAA; sgRNA #2: CATAAATATTAAAGCCGGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7031 C. elegans dlat-1(hd7031[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ V. Show Description
Heterozygous strain, might not be homozygous viable. Deletion of 1998 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGCATCGTGTGTGGCTTCTCGAGGAACTC; Right flanking sequence: TTTATCACACCGATTTTTTTTTATTTTCGC. sgRNA #1: CTTGAAGTGACGAAGCCAGA; sgRNA #2: CAAGGCGCGCGTGTTTAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7032 C. elegans npp-1(hd7032[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ IV. Show Description
Heterozygous strain, might not be homozygous viable. Deletion of 3583 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGAGGAGGGTGCCAGCAAACGCGCCCCT; Right flanking sequence: TGGCAGAAAATTGTTTTTAAAACTTATACA. sgRNA #1: CGAATTTTGTCTGTGTACGA; sgRNA #2: CTGTTTCGACCTAAGATGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7033 C. elegans F36G9.3(hd7033[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2120 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTTTTGGGTTTCAAAATGAAGTATTTACCA; Right flanking sequence: TTTCAATATTCTCAATTCTGGCACTCATAT. sgRNA #1: TAAAACTAGACGGACGAGTC; sgRNA #2: GGATTGTGAGCACCCAGTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7034 C. elegans F17C8.6(hd7034[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 872 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGAAGATTTTGCATTGATTTTTAGATAGT; Right flanking sequence: TGCAACCATTTTAAGATTGTTTATTTGAAA. sgRNA #1: AAAGTACACGTATGCCACCT; sgRNA #2: CCATACCATCAGGAGGCATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7035 C. elegans col-176(hd7035[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1915 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGTGTACTTCCTTCTTCTCATGACCTCCG; Right flanking sequence: CCGGGCGGCTATCCGCCAGGCCCAAACGGC. sgRNA #1: AAAACATAGGTGGTCGGGCA; sgRNA #2: ACACAACGGCCGTCTACTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7036 C. elegans ZC373.5(hd7036[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1827 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAGTTTCGAAGTAATCTCAATAAAATCCG; Right flanking sequence: TGGCAAGCACTCTTGTTGTGTTGGTCTCTT. sgRNA #1: GTTCGAAGACCATTCATGCT; sgRNA #2: TTCTCTAATCTCTCCGTCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7037 C. elegans arrd-15(hd7037[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 7272 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATTTCAAAGCATATTCCACGTACTTTAGT; Right flanking sequence: TGGCAAACCTTCAAAACTGCTCTTTTCGGT. sgRNA #1: TCTCAAATACTTCGCGTGCT; sgRNA #2: TGCTAATGAGGTCATCGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7038 C. elegans T07E3.3(hd7038[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1206 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGCCAAACTTCAAAATGGCTCCATTGCCA; Right flanking sequence: CATCAGTTTAGTCTTTTTTTTTCCCAAATC. sgRNA #1: TCGAAATAACATTTCACACG; sgRNA #2: CGAGTAAAGTGCAATAAAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7039 C. elegans trcs-1(hd7039[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2438 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACTTTATAAATCAAATTAACGGAGATCGTA; Right flanking sequence: GGGAGATCAAAACGTGTTTAGAATCTTTGC. sgRNA #1: GCGAGACCCAATGCGAAATT; sgRNA #2: TTCACATTAGGCTATTTCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7040 C. elegans ZK512.2(hd7040[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ III. Show Description
Heterozygous strain, might not be homozygous viable. Deletion of 2129 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGGCCTTTCTCTTCAAAGCCTTCTTCTCCT; Right flanking sequence: CTATGCTTTTTCTTGTATATTTCAAACATT. sgRNA #1: TGGAACTGGTAGAAAAGCAG; sgRNA #2: CATAAAATGGGTCAGAAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7041 C. elegans ech-3(hd7017[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1031 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCACTATGGGTGCGATTGTGGCGAATCCCA; Right flanking sequence: TGGCTGATAGAGAATCCACGTATTACTCGT. sgRNA #1: GGCACACTCGGGTTTCAAAG; sgRNA #2: TCATCCGGAAATATGCATGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7042 C. elegans mpz-6(hd7015[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1556 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTGACATAGTGACACGCATTGGAAGCCG; Right flanking sequence: GGGAAACTCCGCCCACAAACGCTGAAAGTT. sgRNA #1: AACTATTTCAATGGTTCAGT; sgRNA #2: CCACACTCTCCGAGCAAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7043 C. elegans mpz-5(hd7014[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1364 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAATAAGAAAGTTTTTTTTTTAATTTTTAA; Right flanking sequence: ATGCCCGTTGCCATGCCGTTGTTCCGATAG. sgRNA #1: AAAGCTGTCTCACAAAGTAA; sgRNA #2: GAGGAGGAAAGGAATTAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7044 C. elegans otpl-5(hd7011[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2727 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGAAATGAACAAAAAGTTACGGAGGAGGC; Right flanking sequence: ATTTCCCATCAAACTGCCTGATAGCTACTC. sgRNA #1: GAACTCCCACCCTCCCTTAA; sgRNA #2: CCAAAGTTCAATTCAGTAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7045 C. elegans cal-3(hd7045[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 6270 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AACGTACGTTATACGTAATAGAAGCACGTG; Right flanking sequence: CTCGGGGCGAATTCAAATAAAGATGCGGCT. sgRNA #1: CGTAATAGAAGCACGTGAGA; sgRNA #2: CGCAATTTGATCACACTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.