Homozygotes are viable and do not show any gross abnormalities. Grows normally at all temperatures. Deletion removes 1505 bp including the first 4 exons.

Homozygous viable with neuronal defects.

Healthy and fertile in standard lab conditions, but unable to adapt to 1% oxygen. When hif-1(+) animals are incubated in1% oxygen, >94% will complete embryogenesis and larval development. In contrast, hif-1(ia4) mutants exhibit 66% embryonic lethality and 9% larval lethality in 1% oxygen. The requirement of hif-1 is alleviated if the oxygen level is increased to 2%. The ia4 mutation is a 1231 bp deletion of the second, third, and fourth exons, which encode much of the helix-loop-helix and PAS domains. Analysis of ESTs suggests that there are at least 4 alternatively spliced hif-1 transcripts. The ia4 deletion introduces a frameshift and a premature stop in the three longest forms.

enIs74 [mec-7p::GFP + dyn-1p::mfg-e8::mCherry + unc-76(+)] II. mec-7p::GFP labels touch neurons. MFG-E8::mCherry reporter binds exposed phosphatidylserine (PS) “eat me” signal on the surface of apoptotic or necrotic cells, providing a useful marker for identifying apoptotic or necrotic cells. Reference: Furuta Y, et al. PLoS Genet. 2021 Feb 11;17(2):e1009066.

hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. D motor neurons are marked with red fluorescence. No behavioral change upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).

ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4343 [acr-5p::TeTx::wCherry + unc-4p::TeTx::wCherry + HygromycinR]. Pick animals with wCherry expression in ventral cord neurons to maintain hpEx4343. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Animals carrying hpEx4343 rest as coilers strongly biased towards ventral bend as L1 larvae and are severely Unc as adults. Coiling is somewhat suppressed in the ljIs131 background, but animals still exhibit an obvious bias towards ventral bend during movement. Hygromycin can be used to select for hpEx4343 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.

Uncoordinated behaviour. Fainter, pauses quickly after stimulating touch-response by prodding or tapping plate. References: Humphry JA, et al. Curr Biol. 2007 Apr 3;17(7):624-9. Gao S, et al. Nat Commun. 2015 Feb 26;6:6323.

juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. Animals are WT looking. In WT, GABAergic synapses visualized with juIs1 (GABAergic nervous system specific synaptobrevin::GFP) marker show uniformly spaced and sized puncta. fsn-1(hp1); scd-2(ok565) animals have puncta close to WT shape. This is more evident in larvae than in adults.

Egl. Backward stiff and slow moving. Sluggish. Can move fast when poked. Outer pairs: F59F5.6EL1 (TTGCATCTGCAAAAGAAACG); F59F5.6ER1 (GCTCCGAACGAAAGAAGTTG). Inner pairs: F59F5.6IL1 (AATCTCTAACCATGCGGTCG); F59F5.6IR1 (CGCGGGAATTATGCCTATTA).

hpIs481 [ceh-12p::tomm20::miniSOG::SL2::BFP + unc-129(DB)p::tomm20::miniSOG::SL2::BFP + lin-15(+)]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. unc-129(DB)p is a fragment of the unc-129 promoter driving expression in only DB motor neurons (described in Colavita et al., Science 1998 31;281(5377):706-9). The ceh-12 promoter drives expression in VB motor neurons. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.

hpIs583 [acr-2(s)p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of A- and B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. acr-2s(p) is a 1.8 kb fragment of the acr-2 promoter driving expression in only A- and B- class motor neurons (described in Jospin et al, 2009 PLoS Biol. Dec;7(12):e1000265). Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.

hpSi38 [flp-14(+) + NeoR]. hpIs201[ceh-10p::GFP + lin-15(+)]. GFP expression in RID neuron. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant behavioral defects and RID axon defects. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782

hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. D motor neuron activation and muscle relaxation upon illumination with green light. Muscle activity measured by GCaMP3. Reference: Lu Y, et al. 2022. Current Biology (In Press).

GFP tag inserted at the N-terminus (immediately in front of the ATG start codon) of the unc-2 locus specifically tagging the UNC-2B isoform. hp858 animals exhibit wildtype motor behaviors. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035

Gonadal enlargement and aberrant gonad migration. Phenotype evident at 25C.

Heterozygotes are WT. drh-3 homozygotes are sterile. the fj52 mutation deletes a 405 bp region including the promoter, the first exon and half of the second exon. The deletion can be checked by PCR with the following primers: TTTATTGATTCCGCCGTTGCTC and TGCAGCTCCAGCCACTCTATCA. The fj52 mutation was isolated from a deletion mutant libray of the K. Nishiwaki group. Homozygous hT2[bli-4 let-? qIs48] inviable.

Heterozygotes are WT and GFP+. csr-1 homozygotes are basically sterile, but some of them occasionally lay a small number of dead eggs. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. Homozygous nT1[qIs51] inviable.

zxIs127 [sng-1p::SNG-1::CRY2olig(535) + myo-2p::mCherry]. Strain should be kept in the dark; it is very light-sensitive. Pan-neuronal expression of a truncated variant of Arabidopsis thaliana Cryptochrome-2 fused to synaptogyrin. If illuminated with blue light, synaptic vesicles cluster, resulting in inhibition of synaptic transmission. Synaptic transmission is restored within 15 minutes in the absence of light (ca. 6.5min time constant), resulting in normal wild type behavior afterwards. Reference: Vettkotter D, et al. Nat Commun 13, 7827 (2022). https://doi.org/10.1038/s41467-022-35324-z. PMID: 36535932

zxIs12 [F49H12.4P::ChR2(H134R)::mCherry + F49H12.4P::GFP]. Strain expresses Channelrhodopsin-2 (ChR2(H134R)::mCherry) and GFP (as marker) in PVD and AQR, as well as in a non-identified tail neuron, using the F49H12.4 promoter. When grown in the presence of all-trans retinal and illuminated with blue light, animals show strong forward locomotion escape behavior, which can be quantified using locomotion video tracking. The strain can be used to analyze function of PVD cells, and to estimate the role of specific genes in the function of this polymodal nociceptor, downstream of depolarization via ChR2. All-trans retinal needs to be added with OP50 bacteria when seeding plates to render ChR2 functional. References: Husson S, et al. Curr Biol. 2012 May 8;22(9):743-52. Smith CJ, et al. Neuron. 2013 Jul 24;79(2):266-80. Cohen E, et al. Molecular and Cellular Neuroscience 2104 59C: 85-96.

zxIs12 [F49H12.4P::ChR2(H134R)::mCherry + F49H12.4P::GFP]. Strain expresses Channelrhodopsin-2 (ChR2(H134R)::mCherry) and GFP (as marker) in PVD and AQR, as well as in a non-identified tail neuron, using the F49H12.4 promoter (see also ZX679). When grown in the presence of all-trans retinal and illuminated with blue light, animals show strong forward locomotion escape behavior, which can be quantified using locomotion video tracking. The strain can be used to analyze function of PVD cells, and to estimate the role of specific genes in the function of this polymodal nociceptor, downstream of depolarization via ChR2. All-trans retinal needs to be added with OP50 bacteria when seeding plates to render ChR2 functional. This strain is in lite-1(ce314) background, which eliminates the photophobic behavioral response that will be startled by blue light when longer light stimuli are used (>1s). To not confuse the photophobic behavior induced by LITE-1, with the PVD evoked escape behavior, this strain is needed for experiments with prolonged photostimulation. References: Husson S, et al. Curr Biol. 2012 May 8;22(9):743-52. Smith CJ, et al. Neuron. 2013 Jul 24;79(2):266-80. Cohen E, et al. Molecular and Cellular Neuroscience 2104 59C: 85-96.