Viable, surface abnormal, Bus (resistant to infection by M. nematophilum), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. Reference: Gravato-Nobre et al. (2011) PMID: 20980242.

Viable, Bus (M. nematophilum resistant), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. e2737 is a ~4.5 kb deficiency which removes all of the bus-10 exons, internal ncRNA genes ZK596.4 & ZK596.5, and ZK596.1. Reference: O'Rourke et al (in preparation).

Most L1 larvae are deformed with irregular shapes. Older larvae and adults exhibit variably bent-head. Resembles spon-1(e2623) II. Homozygous viable, but inviable as hemizygotes (e1210/maDf2). Reference: Hodgkin (unpublished).

Viable, but surface abnormal, Bus (resistant to infection by M. nematophilum), Bah (resistant to Yersinia biofilm). Reference: O'Rourke et al. (in preparation)

Viable, but defective in bacterial grinding and hypersensitive to bacterial pathogens. Derived by out-crossing parental strain VC2496. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.

Unc. M-MATING++ 1-10%WT. Previously called unc-67.

Viable, poor bacterial grinding, increased sensitivity to bacterial pathogens. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.

Viable, but with poor bacterial grinding and increased susceptibility to some bacterial pathogens. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.

Weak Bus, viable on Leucobacter Verde1. e3071 is a missense intragenic revertant (P97S) of e2883 (G378E). Reference: Stroud et al (in preparation).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. uIs69 [pCFJ90(myo-2p::mCherry) + unc-119p::sid-1] V. Mapping strain. This strain is homozygous for integrated fluorescence markers on LG I, II, IV and V, all of which are easily and independently scored using a fluorescent dissecting microscope, plus an easily scored visible marker (dpy-17) for LGIII. The good markers on all five autosomes facilitate linkage assignment of unmapped mutations, and enable rapid replacement of chromosomes when outcrossing heavily mutagenized strains such as those from the Million Mutation Project.

Viable, small, slow-growing, bleach-sensitive, resistant to Leucobacter Verde1 and Leucobacter Verde2. Lethality of subs-4(e3048) suppressed by bus-22(e3108) mutation. Reference: O'Rourke et al (in preparation).

No obvious phenotype; derived from VC20689. Reference: O'Rourke et al (in preparation).

eEx730 [ptr-15(+) + sur-5p::GFP]. Pick GFP+ to maintain. Him. Lethal 1118bp deletion allele of ptr-15 rescued by eEx730. Non-GFP animals will be dead eggs and dead hatchlings. References: O’Rourke et al. (in revision 2024), Kuwabara et al. (in prep.)

Viable, Bus (M. nematophilum resistant), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. Reference: O'Rourke et al (in preparation).

eEx730 [ptr-15(+) + sur-5p::GFP]. Pick GFP+ to maintain. Lon. Non-GFP animals will mostly be dead eggs and dead hatchlings, but can segregate rare GFP-negative viable ptr-15 lon-3 homozygotes (which are fertile but grow very poorly). Reference: Kuwabara et al. (in prep.)

crEx498 [dpy-14p::ptr-15(+) + sur-5p::GFP]. Pick animals with nuclear GFP throughout body to maintain. Lethal ptr-15 deletion allele marked with pharyngeal GFP [loxP ::myo-2p::GFP::unc-54 3’UTR + rps-27p::neoR::unc-54 3’UTR::loxP]; lethality rescued by hypodermal expression of PTR-15 form crEx498 array. Non-nuclear GFP animals (only pharyngeal expression) will be dead eggs and dead hatchlings. Derived from parental strain VC4151. References: O’Rourke et al. (in revision 2024).

Unc-weak kinker. Fairly active. Healthy. See WBPaper00002474. Previously called unc-24(e927).

Notched head. Tail abnormalities. Variable expression. Incomplete penetrance. Especially seen in L1. M-MATING++++ >30%WT. See also WBPaper00003843 and WBPaper00003865. Previously called efn-1(e96).

Bacteria. Caenorhabditis pathogen. Previously called Aureobacterium nematophilum. Biosafety Level: BSL-1.

epIs14 [sbp-1p::GFP + rol-6(su1006)]. Rollers. sbp-1 previously known as pin-1. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozgyotes are WT and segregate WT, Dpys, and Ste or Mel. Pick wild-type individuals and check for correct segregation of progeny to maintain. bli-4 is suppressed by dpy-1 in hT2 homozygotes-only see a very few DpyBli.This strain cannot be distributed to commercial organizations. ep220 is likely Mel. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozygotes are WT and segregate WT, Roller Uncs, and ect-2 homozygotes (sterile Uncs which reach adulthood, sometimes giving polynucleate oocytes). ect-2 pka let-21. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Slow growth, low fat stores. Viable at 15C, not at 25C. Slightly Dpy, reduced brood size, low penetrance. Maintain under normal conditions. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Liang et al., (2010) PlosOne 5:3 e9869.

cer1 is a CRISPR-generated 368 bp deletion removing intron 2 and part of exon 3, creating a premature stop codon. Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.

cer2 is a CRISPR-generated 438 bp deletion + 50 bp insertion removing intron 2 and part of exon 3, creating a premature stop codon. Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.

Reduced brood size. Genetic interaction with rpn-9. cer27 is a 1033 bp deletion removing the start codon and nearly all of the ubh-4 coding sequence. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270

Endogenous sftb-1 reporter generated by CRISPR/Cas9 using the Nested CRISPR protocol (Vicencio et al., 2019 Genetics). mCherry was amplified from pJJR83 plasmid and inserted at the 5' end of the sftb-1 gene. External primers used for genotyping: (For: AGCTATCGAAGTTTAGGATGTTGTT) (Rev: CGGTTCCAATCGAGTCTAGGTA) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.

eGFP tag inserted into the endogenous nfki-1 locus. eGFP::NFKI-1 signal is observed in diverse neurons in the animals' head and tail throughout post-embryonic development. No obvious phenotype. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.

Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP cer140 gk401 homozygotes (synthetic sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. Generated by CRISPR-mediated deletion of ubh-4 in gk401 mutant background. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270

Dose-dependent sensitivity (developmental arrest) to pladienolide B and herboxidiene (modulators of pre-mRNA splicing). sftb-1(cer144[S1090A, A1095T, I1096V, F1101Y]) contains four missense mutations reproducing the HEAT repeat 15 of the human SF3B1 protein. Ten silent mutations increase primer specificity for PCR genotyping. Primers used for genotyping: (WT For: GAGCTGCAATTAATACATTTGGATTT) (WT Rev: AAACTCGCATTCCTTCACAT) (cer144 For: GGTACTATTCTGTGGCGTCT) (cer144 Rev: GTAACCGAAAGTGTTCACAGTT) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.

No obvious phenotype. comt-4(cer157) is a complete deletion of the comt-4 gene (coding sequence + introns), which was replaced by GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019), thereby creating a null allele and a transcriptional reporter at the same time. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130

Abnormal locomotion can be rescued with dopamine. cat-2(cer181) is a complete deletion of the cat-2 gene (coding sequence + introns), which was substituted by the sequence of the step 1 repair for GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019). Allele can be detected using the following primers: Fwd: ctatgtgaagtcacacctgtc Rev: cttgctggaagtgtacttggtg. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130

Missense mutations D1135L and S1136W, G1218K and E1219Q, and R1335Q and T1337R were introduced on the Cas9 gene at EG9615 strain, to cause endogenous expression of the Cas9 variant SpG. SpG is efficient for CRISPR on NGN PAM sites. Reference: Vicencio J, et al. Nature Communication, 2022. May 12;13(1):2601. doi: 10.1038/s41467-022-30228-4.

Superficially wild-type. tm2607 is a 196 bp deletion + 1bp insertion that removes part of an essential gene, but produces viable animals. Reference: Fontrodona L, et al. PLoS Genet. 2013 Jun;9(6):e1003543.

P9.p and P10.p fail to fuse with hyp7 during L1 in hermaphrodites. Misshapen head (low penetrance) most visible in L1. Ectopic postdeirid generated by V6 (low penetrance).

muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which completely rescues dauer formation and partially restores longevity of daf-16; daf-2 double mutants. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.

muIs105 [daf-16p::GFP::daf-16 + rol-6(su1006)]. Rollers; Rol phenotype is not always evident). Integrated line derived from CF1449. Maintain at 15C. Forms dauers at 25C. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.

Sterile at 25C; grow at 20C or less. glp-1(e2141) longevity suppressed by daf-16(mu86).

Temperature sensitive. Sterile at 25C. Maintain at 15C. [NOTE: CF1903 carries glp-1(e2144), not e2141 as previously described.]

muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which rescues daf-16 mutants from defective dauer formation and also partially rescues longevity defect of daf-16; glp-1 double mutants. Reference: Berman JR, & Kenyon C. Cell. 2006 Mar 10;124(5):1055-68.

Temperature-sensitive. Sterile at 25C. [NOTE: can be grown at 20C, but 15C might be better for long-term propagation.] kri-1(ok1251) suppresses the longevity of glp-1(e2141) mutants.

muIs6 [lin-39::lacZ + rol-6(su1006)] IV. lin-39 promoter driving lacZ. muIs6 was integrated by gamma irradiation.

Quadruple mutant removing four different dopamine receptor genes.

Homozygous viable, but short-lived. Reference: Lee SJ, et al. Cell Metab. 2009 Nov;10(5):379-91.

muEx473 [kin-19p::kin-19::tagRFP + tph-1p::GFP]. Pick RFP+ GFP+ animals to maintain. Low transmission rate. Translational fusion of KIN-19 displaying age-dependent aggregation. Reference: David DC, et al. PLoS Biol. 2010 Aug 10;8(8):e1000450.

muIs209 [myo-3p::kin-19::tagRFP + tph-1p::GFP]. KIN-19::tagRFP aggregates with age in body-wall muscles. Animals have reduced thrashing compared to controls. Generated in N2 background. References: Huang YC, et al. Elife. 2019 May 3;8. pii: e43059. doi: 10.7554/eLife.43059. David DC, et al. PLoS Biol. 2010 Aug 10;8(8):e1000450.

muIs23 [hsp::lin-39 + (pMH86) dpy-20(+)]. Heat-shock inducible lin-39. muIs23 is a spontaneous integrant whose chromosomal location is unknown. [NOTE: This strain was previously described as carrying lin-39(n1760), but it is actually carrying the g to a substitution of mu26. Strain MT7255 has been confirmed to be carrying the a to t substitution of n1760.]

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::vha-13 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). GFP11 tag inserted into endogenous his-3 locus via CRISPR/Cas9 insertion into parental strain CF4587. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628