More Fields
Strain Species Genotype
BC5775 C. elegans sEx793. Show Description
sEx793 [B2044 III + pCes1943[rol-6(su1006)]]. line 8. 20 ng/ul B0244 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5776 C. elegans sEx796. Show Description
sEx796 [R04B5 (V) + pCes1943[rol-6(su1006)]]. line 4. Low amount of cosmid R04B5 + 100 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5780 C. elegans sEx798. Show Description
sEx798 [K10D2 (III) + pCes1943[rol-6(su1006)]]. line 4. 20 ng/ul K10D2 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC694 C. elegans sDf5/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, Uncs and L1 lethals. Pick WT to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC700 C. elegans sDf4/bli-4(e937) dpy-14(e188) I. Show Description
Heterozygotes are semi-Dpy and segregate more semi-Dpy, Dpy(ts)Bli(late) and early larval lethals. Pick semi-Dpy to maintain. (Some reports indicate that sDf4 is not transferred through sperm.) This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC986 C. elegans sDp3 (III;f); eT1 (III;V). Show Description
Throws Unc-36 and WT. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BCN9071 C. elegans vit-2(crg9070[vit-2::gfp]) X. Show Description
GFP knocked into C terminal of vit-2 gene by CRISPR/Cas9 using self-excising drug selection cassette method of Dickinson et al. (2015, Genetics). Strain is derived from BCN9070, which was outcrossed to remove a linked background mutation on LG X causing transgenic males to mate poorly. Reference: Perez MF, et al. Nature. 2017 Dec 7;552(7683):106-109.
BFF40 C. elegans mjIs134 II; meg-3(tm4259) meg-4(ax2026) X. Show Description
mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Germ granule defective. ~30% sterility, maintain by picking gravid adults with visible embryos. Nuclear GFP expression in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614
BFF53 C elegans bqSi577 IV. Show Description
bqSi577 [myo-2p::GFP + unc-119(+)] IV. Expresses GFP in pharyngeal muscles. Single-copy insertion in the MosSCI locus cxTi10882 on chromosome IV. Obtained via the outcrossing of strain BN578 with N2. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343.
BJH728 C. elegans unc-26(pek288[R216Q]) IV. Show Description
unc-26(pek288) is a CRISPR-engineered R216Q substitution in unc-26/synaptojanin 1 associated with early-onset Parkinsonism (EOP) (Quadri et al., 2013; Krebs et al., 2013). This allele shows abnormal focal accumulation of ATG-9 in presynaptic nerve terminals, defects in activity-induced synaptic autophagy, and defects in sustained neurotransmission and locomotory behaviors in aging animals. Reference: Yang S, et al. Neuron. 2022 Mar 2;110(5):824-840.e10. PMID: 35065714
BJS737 C. elegans mpk-1(sbj10) III. Show Description
Temperature sensitive allele of mpk-1, bypasses UV sensitivity of csb-1 mutant at 20-25C. Reference: Bianco JN & Schumacher B. Nucleic Acids Res. 2018 May 21. doi: 10.1093/nar/gky404.
BJS78 C. elegans smc-5(sbj3)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP sbj3 homozygotes. Pick wild-type GFP+ to maintain. sbj3 homozygotes are morphologically wild-type but show reduction in viable progeny. Reference: Wolters S, et al. Genetics. 2014 Apr;196(4):985-99.
BJS79 C. elegans smc-5(sbj2)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP sbj3 homozygotes. Pick wild-type GFP+ to maintain. sbj3 homozygotes are morphologically wild-type but show reduction in viable progeny. Reference: Wolters S, et al. Genetics. 2014 Apr;196(4):985-99.
BL5752 C. elegans inIs181; inIs182. Show Description
inIs181 [ida-1p::GFP]. inIs182 [ida-1p::GFP]. This is a strain in which two integrated copies of the same construct were crossed into a single strain in order to have stronger expression. Both arrays contain pTZ3i, which is ida-1::GFP with 2.4 kb of ida-1 promoter driving expression of ida-1::GFP fusion proten with ida-1 introns 3-9 included.
BN30 C. elegans npp-15(ok1954) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. ok1954 homozygotes arrest as larvae. Pick GFP+ heterozygotes to maintain. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44.
BN358 C. elegans ima-2(ok256) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (produce only dead embryos). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Derived from strain XA3503. Reference: ima-2(ok256) is described in Askjaer et al., Mol Biol Cell. 2002 Dec;13(12):4355-70.
BN359 C. elegans ima-2(ok256) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III); qaIs3502. Show Description
qaIs3502 [pie-1p::YFP::lmn-1 + pie-1p::CFP::H2B + unc-119(+)]. Germline expression of YFP::lmn-1. CFP::HIS is silenced in qaIs3502. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (produce only dead embryos). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Derived from strains XA3502 and XA3503. Reference: ima-2(ok256) is described in Askjaer et al., Mol Biol Cell. 2002 Dec;13(12):4355-70.
BN360 C. elegans ima-2(ok256) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III); qaIs3502; ojIs1. Show Description
ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. qaIs3502 [pie-1p::YFP::lmn-1 + pie-1p::CFP::H2B + unc-119(+)]. Germline expression of YFP::lmn-1. CFP::HIS is silenced in qaIs3502. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (produce only dead embryos). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Derived from strains XA3502 and XA3503. Reference: ima-2(ok256) is described in Askjaer et al., Mol Biol Cell. 2002 Dec;13(12):4355-70.
BN40 C. elegans npp-5(tm3039)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous deletion chromosome balanced by GFP- and dpy-10-marked inversion. tm3039 homozygotes are viable but produce progengy that are primarily Lva or Lvl. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm3039 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44.
BN477 C. elegans bqSi471 II; bqSi225 IV. Show Description
bqSi471 [hsp-16.41p::FRT::mCherry::his-58::FRT::peel-1 + unc-119(+)] II; bqSi225 [emr-1p::emr-1::mCherry + unc-119(+)] IV. Expression of emr-1p::emr-1::mCherry marker is visible, but faint. Suitable for spatiotemporal cell ablation by crossing with FLP-expressing strains.
BN578 C. elegans bqSi189 II; bqSi577 IV. Show Description
bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II; bqSi577 [myo-2p::GFP + unc-119(+)] IV. Strain carrying visible markers in the MosSCI loci on chr II (ttTi5605) and chr IV (cxTi10882); facilitates crosses between MosSCI strains with non-visible insertions.
BN69 C. elegans npp-5(tm3039)/mIn1 [mIs14 dpy-10(e128)] II; bqIs51 ltIs37 IV. Show Description
bqIs51 [pie-1p::GFP::npp-5 + unc-119(+)] IV. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Expresses GFP::NPP-5 and mCherry in the germ line. Homozygous deletion chromosome balanced by GFP- and dpy-10-marked inversion. tm3039 homozygotes are viable but produce progengy that are primarily Lva or Lvl; bqIs51 transgene rescues the npp-5(tm3039) phenotype. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm3039 homozygotes. Pick WT with dim GFP in the pharynx and check for correct segregation of progeny to maintain. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44.
BN85 C. elegans npp-5(ok1966)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous deletion chromosome balanced by GFP- and dpy-10-marked inversion. ok1966 homozygotes are viable but produce progengy that are primarily Lva or Lvl. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm3039 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44.
BOX163 C. elegans erm-1(mib9[erm-1[T544D]]) I. Show Description
Homozygous viable. Modification of endogenous erm-1 locus mimics ERM-1(T544) phosphorylation. Variant affects ERM-1 localization and dynamics. Reduced brood size, increased embryonic and larval lethality. Reference: Ramalho JJ, et al. Development. 2020 Jul 22;147(14):dev188011. PMID: 32586975
BOX165 C. elegans erm-1(mib10[erm-1[T544A]]) I. Show Description
Homozygous viable. Modification of endogenous erm-1 locus mimics non-phosphorylated ERM-1(T544). Variant affects ERM-1 localization and dynamics. Reduced brood size, increased embryonic and larval lethality. Reference: Ramalho JJ, et al. Development. 2020 Jul 22;147(14):dev188011. PMID: 32586975
BOX188 C. elegans maph-1.1(mib12[GFP::maph-1.1]) I. Show Description
Endogenous maph-1.1 locus tagged with GFP using CRISPR/Cas9. Animals are homozygous viable and express GFP::maph-1.1 ubiquitously. Reference: Waaijers S, et al. BMC Biol. 2016 Aug 9;14:66. doi: 10.1186/s12915-016-0286-x. PMID: 27506200
BOX213 C. elegans erm-1(mib15[erm-1::eGFP]) I. Show Description
Endogenous erm-1 locus tagged with eGFP. Homozygous viable, partially functional endogenous erm-1 tag. erm-1::GFP animals have a reduced brood size and incomplete outgrowth of the excretory canal, but show no other developmental or morphological abnormalities.
BOX215 C. elegans erm-1(mib16[erm-1[T544D]::GFP]) I. Show Description
Homozygous viable. Endogenous erm-1 locus tagged with eGFP and modified to mimic ERM-1(T544) phosphorylation. Variant affects ERM-1 localization and dynamics. Reduced brood size, increased embryonic and larval lethality. eGFP-tagged ERM-1 is not fully functional: animals have a reduced brood size and incomplete outgrowth of the excretory canal, but show no other developmental or morphological abnormalities. The penetrance of intestinal phenotypes is slightly higher than in untagged T544 mutants, presumably owing to a detrimental influence of the COOH-terminal GFP tag. Reference: Ramalho JJ, et al. Development. 2020 Jul 22;147(14):dev188011. PMID: 32586975
BOX218 C. elegans erm-1(mib19[erm-1[T544A]::GFP]) I. Show Description
Homozygous viable. Endogenous erm-1 locus tagged with eGFP and modified to mimic non-phosphorylated ERM-1(T544). Variant affects ERM-1 localization and dynamics. Reduced brood size, increased embryonic and larval lethality. eGFP-tagged ERM-1 is not fully functional: animals have a reduced brood size and incomplete outgrowth of the excretory canal, but show no other developmental or morphological abnormalities. The penetrance of intestinal phenotypes is slightly higher than in untagged T544 mutants, presumably owing to a detrimental influence of the COOH-terminal GFP tag. Reference: Ramalho JJ, et al. Development. 2020 Jul 22;147(14):dev188011. PMID: 32586975
BP328 C. elegans eff-1(ok1021) II; hmIs4. Show Description
hmIs4 [des-2::GFP + rol-6(su1006)]. Dpy Rollers. eff-1(ok1021) was outcrossed 6 times. PVD neurons are hyperbranched and have disorganized menorah structures. Shows reduced sensitivity to strong mechanical stimuli. eff-1(ok1021) is a null allele and has strong arborization and cell fusion defects. Pick rollers to maintain. Reference: Oren-Suissa M, et al. Science. 2010 Jun 4;328(5983):1285-8.
BP600 C. elegans aff-1(tm2214) II. Show Description
A 1.2 kb deletion in aff-1 (C44B7.3) which introduce stop codon after alanine 47. AFF-1 is a type I membrane protein necessary and sufficient for specific cell fusion events during embryonic and larval development. Temperature sensitivity was not detected. At 20° the fusion of hyp5 in the embryo does not occur as well as anchor cell (AC) fusion, vulval cells fusion of the A and D rings and the terminal fusion between the seam cells late in L4. 6% L1 rod-like lethal and 0% embryonic lethal. Adults are completely Egl, and partially Unc, Pvl. In addition, only 2% of AC in the mutant worms undergo fusion. These animals give very low brood size (16 progeny per worm) and 3.4% of the worms are sterile. This strain gives very small brood size and hence grows slowly. Originally from Shohei Mitani, Tokyo Women's Medical College, Tokyo, Japan.
BR2742 C. elegans pept-1(lg601) X. Show Description
Slow postembryonic development. Reduced brood size. Previously known as pep-2. [NOTE: the genotype of this strain was previously incorrectly annotated as lg1601. The correct allele name is lg601.] Reference: Meissner B, et al. J Biol Chem. 2004 Aug 27;279(35):36739-45.
BR7827 C.elegans endu-2(tm4977) X; byEx1551. Show Description
byEx1551 [vha-6p::endu-2::eGFP::3xFLAG + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. Transgene provides intestinal rescue of endu-2(tm4977) that also rescues mortal germline (Mrt) phenotype. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications.
BR8551 C.elegans endu-2(tm4977) X; byEx1795. Show Description
byEx1795 [unc-119p::endu-2::eGFP::3xFlag + rol-6(su1006)]. Pick Rollers to maintain. Transgene provides neuronal rescue of endu-2(tm4977) that also rescues mortal germline (Mrt) phenotype. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications.
BRC546 C. elegans antIs30 II; unc-119(ed9) III. Show Description
antIs30 [attP-f + Cbr-unc-119(+) + glh-2p::phiC31 + rol-6(partial) + myo-2p::GFP + attP-r] II. antIs30 was inserted into ttTi5605 on LG II using MosSCI. GFP expression in pharynx is very weak (as it is single copy) and is easiest to see during the L1-L3 stages. This strain contains a phiC31 docking site and can be used for precise single-copy integration of transgenes via recombination mediated cassette exchange. The docking site contains inverted phiC31-attP sites flanking phiC31 integrase expressed from the glh-2 germline promoter. Integration constructs need to have inverted phiC31-attB sites that flank the intended sequence to be inserted. Reference: Yang FJ, et al. "phiC31 integrase for recombination mediated single copy insertion and genome manipulation in C. elegans." Genetics 2021.
BRC566 C. elegans antIs31 II; unc-119(ed9) III. Show Description
antIs31 [attP-f + Cbr-unc-119(ant40) + glh-2p::phiC31 + rol-6(partial) + myo-2p::GFP + attP-r] II. Unc. antIS31 has been found to self-excise; check for GFP expression periodically to retain the insertion. GFP expression in pharynx is very weak (as it is in single copy) and is easiest to see during the L1-L3 stages. This strain contains a phiC31 docking site and can be used for precise single-copy integration of transgenes via recombination mediated cassette exchange. The docking site contains inverted phiC31-attP sites flanking phiC31 integrase expressed from the glh-2 germline promoter. Integration constructs need to have inverted phiC31-attB sites that flank the intended sequence to be inserted. antIs31 was derived by CRISPR/Cas9 knockout of Cbr-unc-119 in antIs30 creating ant40, a 691 bp deletion in Cbr-unc-119. Because antIs31 does not rescue unc-119(ed3), BRC566 facilitates the use of Unc-119 rescue as a selection marker for transgene insertions. Reference: Yang FJ, et al. "phiC31 integrase for recombination mediated single copy insertion and genome manipulation in C. elegans." Genetics 2021.
BS3383 C. elegans pmk-3(ok169). Show Description
F42G8.4. No obvious phenotype. Follow by PCR. Predicted gene is a p38 related Map Kinase. Approx. 1.5 kb deletion by agarose gel (not sequenced so end points not known). Nested PCR primers for detecting F42G8.4: F42G8.4EL1 5' - TCGCCCTTTGTATGTCTTCC - 3'. F42G8.4ER1 5' - TTCTCCAGGGATTAACGGTG - 3'. F42G8.4IL1 5' - TTTTCACTGCGTCTCAATCG - 3'. F42G8.4IR1 5' - TTTCAAATTTGCAGGTGTGC - 3'.
BS518 C. elegans ozDf1/sdc-3(y52y180) unc-76(e911) V. Show Description
Heterozygotes are slow growing with WT phenotype. Hets segregate more slow growing WT, embryonic lethals (ozDf1/ozDf1) and DpyUncs which are sick and have a maternal effect lethal (none of the offspring from the DpyUncs survive to reproduce). Maintain by picking WT.
BS5431 C. elegans prp-17(oz273) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile oz273 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
BS5435 C. elegans prp-17(oz273) I/hT2 (I;III); glp-1(oz264) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
glp-1(oz264) is a gain-of-function allele. Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile oz273; oz264 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
BS7011 C. elegans nemp-1(oz534)/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
Segregates WT RFP+ heterozygotes, viable non-RFP nemp-1(oz534) homozygotes, and RFP+ Dpy. Maintain by picking wild-type RFP+. About 10-20% of nemp-1(oz534) homozygotes are sterile.
BS7012 C. elegans nemp-1(oz535)/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
Segregates WT RFP+ heterozygotes, viable non-RFP nemp-1(oz535) homozygotes, and RFP+ Dpy. Maintain by picking wild-type RFP+. About 10-20% of nemp-1(oz535) homozygotes are sterile.
BW1561 C. elegans dpy-18(e364) nob-1(ct223) unc-25(e156) III; eDp6 (III;f). Show Description
Animals with the duplication are WT. Animals without the duplication are Nob (NO Back end; 100% lethal). Pick wild-type to maintain. The Dpy and Unc phenotypes are not visible in the Nob background. ct223 is recessive.
BW1563 C. elegans pal-1(ct281)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct281 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct281 is a 4.7kb deletion removing intron 5, exon 6, and the 3'UTR of the pal-1 gene. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
BW1566 C. elegans pal-1(ct224)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct224 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct224 is a 4.2kb deletion removing exon 1 through exon 6 of the pal-1 gene. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
BW1809 C. elegans gpa-16(it143) I; him-5(e1490) V. Show Description
Temperature-sensitve. Maintain at 15C. Slight Maternal Effect Lethal (Mel) at 15C, more pronounced at 20C. Highly penetrant Mel at 25C and a fraction of the survivors have reversed left-right organs.
BW1927 C. elegans pal-1(ct224)/qC1 [dpy-19(e1259) glp-1(q339)] III; ctIs33. Show Description
ctIs33 [pal-1::GFP + rol-6(su1006)]. Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct224 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct224 is a 4.2kb deletion removing exon 1 through exon 6 of the pal-1 gene. ctIs33 carries a non-rescuing pal-1::GFP fusion containing ~7kb 5' of the SL1 splice site through part of exon 5 fused to GFP. GFP expression is primarily embryonic and limited to a few cells; not visible except at high magnification. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
BW287 Panagrolaimus sp. Show Description
Chinese rhabditis hermaphrodite nematode from Bill Wood's Chinese collection, Beijing. According to David Fitch this strain is Panagrolaimus sp. April 2008: According to sequence data from Howe & Denver 2008 BMC Evol Biol 8:62, strain BW287 is C. briggsae.
BW506 C. elegans ceh-10(ct78) III. Show Description
Withered tail. Adults shorter than WT. Embryonic cell migrations affected: CAN migration with high penetrance. Previously called mig-11.
BW54 C. elegans ct350 II. Show Description
Maintain at 15C. Temperature sensitive embryonic lethal. Sterile at 25C. Congenic strain, N2 and Bergerac BE. This allele should NOT be assumed to define a gene to which someone gave the name zyg-12. This name should not be used unless someone finds a non-complementing Bristol mutation. There is no evidence at present that the ts results from a single gene defect. Has been backcrossed >6 times to Bristol strains and should only contain Bergerac DNA in the unc-85 to dpy-10 region.