umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7100 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7100 and CGC66. hd7100 is a 572 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7101 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7101 and CGC66. hd7101 is a 1562 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 900 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAACAGATCTACACAATCCTGGAGCTCCT; Right flanking sequence: AGGCTCATTTTTGAAGCCGAATTTTACTAA. sgRNA #1: CACGAACATCTAGCTCCCTC; sgRNA #2: CTCCACTCGCCAAGGATAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7124 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7124 and CGC66. hd7124 is a 3032 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CTATCAATGCTTTTTTATTGTGTGACAAGA; Right flanking sequence: CGCGAAAAATTCCAGGTTTTTTCCCATTTT. sgRNA #1: TTCGCGTGAGAGTTAGAAGC; sgRNA #2: CTCCATTGACAATCGTCTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7125 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7125 and CGC66. hd7125 is a 1024 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATCACATTCAAATCGAATCGTTCCTTCGAC; Right flanking sequence: TCCTTCTCCAAATCTTCTTATTATCCGTGT. sgRNA #1: TCGAGCGGCAGATTTCCCGG; sgRNA #2: AAACGAAAAACGCCATTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7127 and CGC66. hd7127 is a 1043 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ACAGTACTCTTTAAAGGCTCTCAATCTTGT; Right flanking sequence: TGGAAAAGCAGACAAAAAAGGCGAGAAGAA. sgRNA #1: CATTCTACAAAAATGTATCG; sgRNA #2: GTGATTCGTACCTCACATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7127 and CGC66. hd7101 is a 1043 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTTTGCCTCAGAGTAATAATAAGCTAAACA; Right flanking sequence: GGGATTCAAATCTTGATGTCAATCTTGAAA. sgRNA #1: TTTTAACCCCTCATCACAAG; sgRNA #2: CATTAAGAGTTAAATTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 7162 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTACACCTTCTCTAATGACATTTCCACCG; Right flanking sequence: TATTATCAGCTGCTGATACAGATAAAAGGA. sgRNA #1: AATCCAATGAATGCATCAGC; sgRNA #2: ACTACATCACAGACTGTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3086 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAAGAAGCTTTTCAACCACCCGCCTCCCT; Right flanking sequence: AGGACACATTATGGAGCCACCATACTTCCC. sgRNA #1: GTTATCAATCACACGACTGG; sgRNA #2: CAGGTTGAACTAGTGAATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 14229 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTATAAGGAGCAGAATGTCTTTCCATTGGA; Right flanking sequence: AGGACATGCTTTTCATGCTGAAATCCGACG. sgRNA #1: GCAATTTGACGAGTTTCGGG; sgRNA #2: AAAAGTCAAGATTGGCACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 15206 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTATGGTAGGTCTTTCAAGCCTGCGTGCCT; Right flanking sequence: CTTTGGGTCACCTTATGAGACATGACCGGT. sgRNA #1: TAGAAAACTAGTCATGAGGG; sgRNA #2: CGCTGAGGGATCAATGTGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3554 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCGCAGGGAAATGGATTTATGCCCGATGGT; Right flanking sequence: AGGTCCGCAAAACCCCAGGAAAAAAGTCTA. sgRNA #1: TCATCGAGATTCACATGCAA; sgRNA #2: AGCTACTAGAACTTTCTTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1516 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TACTTGTACAGTCGAGACTGGCTCACACCA; Right flanking sequence: CTGCAGTTGATGATCAACCCGAGAATGTTC. sgRNA #1: AGAATTGTCAGCATTCCAGC; sgRNA #2: TGGTCAGAATCTCTTCTTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 5798 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAGAGGAAGCTGATTAAATTTTCGAAATG; Right flanking sequence: CGACTTTATAAAAGCCGTTGTACCATATTT. sgRNA #1: GGCCACTATGTTATAGTCGG; sgRNA #2: CCATCGTTCTATACTCCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1144 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAATTTACAGTTCACAATCGCGTCACACCC; Right flanking sequence: GGGGACAAGCTGAGCTATGCAGATTATGCT. sgRNA #1: CGAAAATATAATCGGGTTAG; sgRNA #2: ACGGCGAAAACTTTGTGTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2445 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGGAGCTCGTCAACGATGAAAATTCTGCCA; Right flanking sequence: ACCTCTTATGCAATTCCAAAACAATTTTCT. sgRNA #1: GGAAACAACTTCAACATGGG; sgRNA #2: GACAGATGGCCTCAGTTTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

hdIs17 [glr-1::YFP + unc-47::YFP + unc-129::YFP + rol-6(su1006)]. hdIs10 [unc-129::CFP + glr-1::YFP + unc-47::DsRed + hsp-16::rol-6(su1006)]. Rollers. Reduced progeny at 25C (almost sterile). RNAi hypersensitive, effective RNAi in the nervous system. unc-47::DsRed is weak and only visible in adults. hsp-16::rol-6 transgene is not effectively Roll. Maintain at 15 or 20C.

Homozygous viable. Deletion of 1154 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTCATCTTTTATATGCAAATATATTCCT; Right flanking sequence: CGTATGTGAAAGAATATGGAGAGGATCGGG. sgRNA #1: CATTATAAATTGTGGAAGGG; sgRNA #2: ATGCTTCAATCGTTGCTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1165 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCATCAAATTCATTTTTGGATCAATCGGTT; Right flanking sequence: TGGGTTATTCATAAGGTGTGAGTCCCAAAA. sgRNA #1: GTTTTAGGAGCACATCACGG; sgRNA #2: ATCATCACGGCAGACACAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7146 homozygotes), Dpy non-GFP mKate2+ sC1 homozygotes. Derived from parental strains VH7146 and CGC51. hd7146 is a 4918 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATTTATTCCTGTATTTTTCAGTCATTACCT; Right flanking sequence: GCAATTTTTTGTATGATTTTTCATCAATTT. sgRNA #1: TGCATTATCGTCTGGGAAGC; sgRNA #2: AGAAAACCGATAAAATCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain.. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7144 and CGC92. hd7144 is a 5280 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATTGAAGAATAGCAGCAAAAACGGTCACCT; Right flanking sequence: ATTACTTTTTTTTAAAAAGTACAGTATCAA. sgRNA #1: ACAGGTGTTTACAATGCGAG; sgRNA #2: TATTTTCTTACAGTGAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain.. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7147 and CGC63. hd7147 is a 7691 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCTTCAATTCTTCAATTTTTCCAATTCTTC; Right flanking sequence: TCTTTTCTGGTCGACAAAGGTGCCTAAATC. sgRNA #1: ATAAAGTGAAGATTGGTGGG; sgRNA #2: AACAGTGTTTTGGGGTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 885 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAGTTCAAAGGCAAGCACATTGGCGCGGC; Right flanking sequence: TGGAATATATTATTCAAAAACGACAATTGC. sgRNA #1: GACCGCCCGTCTCGAGACAT; sgRNA #2: TTCAGAATGAGTTCAAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1991 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TACGATGGAACCATCACCAGACGGTCAACT; Right flanking sequence: TTTTCTCATTTTTCTCATCGTCGATGCATT. sgRNA #1: CGAGATAATCGCAAATTCAG; sgRNA #2: CCACATATGTTATCAAATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

F10G7.2. External left primer: AGAACTTTGTCGGATCGATTGT. External right primer: TCTCCGTACTCCCAAATGTTCT. Internal left primer: AAAGAGACTTCGCTTGTGGAAG. Internal right primer: ACCTTCTTGTTTCCACTGTCGT. Internal WT amplicon: 1729 bp. Deletion size: 878 bp. Deletion left flank: AACAACTTTATAAAATTGTATTTTTTTTTT. Deletion right flank: ACGTCCAACTCACTTCTGATGCTTTCGCCC. This strain was provided by the Hutter Lab at Simon Fraser University (Burnaby, BC), which should be acknowledged in any publications resulting from its use.

pmcIs1 [ant-1.1p::ant-1.1::GFP + unc-119(+)]. Expression of ant-1.1::GFP under ant-1.1 promotor (Farina et al., Dev Dyn 2008) in most tissues including the gonads and in the spermatozoa. GFP intensity is low and unstable. GFP positive worms should be selected under fluorescence microscope. ant-1.1::GFP expression seems to be more stable when worms are grown at 24°C and in the dark. Reference: Al Rawi S, et al. Science. 2011 Nov 25;334(6059):1144-7.

Partial lethality on low B12 diet; supplemental vitamin B12 is helpful. Reference: Watson E, et al. Elife. 2016 Jul 6;5.

kbIs5 [gpdh-1p::GFP + rol-6(su1006)]. Rollers, though not obvious in all animals. Maintain under normal conditions. GFP expressed intestine and hypodermis only during hypertonic stress; not induced by other stressers. Reference: Lamitina T, et al. Proc Natl Acad Sci USA. 2006 Aug 8;103(32):12173-8.

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. vsIs33 [dop-3::RFP] V. References: Leung CK, et al. PLoS One. 2013 Apr 29;8(4):e62166. Leung CK, et al. J Vis Exp. 2011 May 19;(51).

Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. >75% of animals explode at the vulva at the L4 molt. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).

Strong retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells and failure to generate alae. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).

Precocious heterochronic phenotype, omission of L2-stage program resulting in fewer seam cells by the L3 stage worms. Precocious alae formation. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).

ctIs39 [hbl-1::GFP + rol-6(su1006)]. Rollers and GFP+. Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. >75% of animals explode at the vulva at the L4 molt. ctIs39 [hbl-1::GFP]: integrated reporter codes for 133 amino acids of HBL-1 followed by GFP, and contains 1.4 kb of hbl-1 3' UTR plus an NLS. hbl-1::GFP is elevated in the hypodermal syncytium at the L3 stage. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).

Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).

Strong retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells and failure to generate alae. Vul. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).

Weak retarded heterochronic phenotype with incomplete alae. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).

Pick wild-type GFP+ to maintain. Heterozygotes are WT with GFP+ pharynx, and segregate Dpy GFP+ mIn1 homozygotes, and GFP- low viability non-Egl hermaphrodites. Viability of first generation nDf50 homozygotes (GFP-) segregated from balanced heterozygotes is rescued by maternal contribution of mir-35-41 from balancer. Second generation GFP- animals are low viability. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.

Pick wild-type GFP+ to maintain. Heterozygotes are WT with GFP+ pharynx, and segregate Dpy GFP+ mIn1 homozygotes, and GFP- low viability non-Egl hermaphrodites. Viability of first generation nDf50 homozygotes (GFP-) segregated from balanced heterozygotes is rescued by maternal contribution of mir-35-41 from balancer. Second generation GFP- animals are low viability. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.

wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Gain-of-function allele causing retarded heterochronic defects including extra seam cells and absence of alae in young adult animals. ms354 is a 1120 bp deletion removing most of the hbl-1 3'UTR including all let-7-complementary sites. Sequences flanking the deletion: TTCTAATCATGGCCAGTTTCTTGCA and GTGCGTTCTTCTGTCATCATGTACA. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111.

mCherry reporter inserted into C-terminus of endogenous lin-46 locus. Superficially wild-type. Fluorescent signal is very dim and bleaches very quickly. Reference: Ilbay O, et al. C. elegans LIN-28 controls temporal cell-fate progression by regulating LIN-46 expression via the 5’UTR of lin-46 mRNA. bioRxiv 697490; doi: https://doi.org/10.1101/697490.

GFP reporter inserted into C-terminus of endogenous lin-28 locus. Superficially wild-type. Reference: Ilbay O, et al. C. elegans LIN-28 controls temporal cell-fate progression by regulating LIN-46 expression via the 5’UTR of lin-46 mRNA. bioRxiv 697490; doi: https://doi.org/10.1101/697490.

Egl. Vulvaless due to lin-3. Precocious VPC divisions and adult alae due to lin-28.

Male-female strain. Reference WBG 11(4):89. See also WBPaper00001874. May crawl off the plates. Isolated by Bill Fixsen at a rest area on the turnpike in Conn. Previously called WS9-6 and C. vulgaris NH and C. vulgariensis by the CGC. Walter Sudhaus has tentatively described this strain as C. remanei ssp. vulgaris; this description is not official and is contigent upon its being published. See WBPaper00002633.

yfSi1 [nspf-1p::nspf-1::6xHis::tbb-2 3' UTR + loxP, II:8420157]. C-terminal 6xHis-tagged NSPF-1 allows visualization of NSPF seminal fluid protein localization in males and hermaphrodites. Transgene inserted into ttTi5650 MosSCI site (II:8420157) using CRISPR/Cas9. Reference: Kasimatis KR, et al. (2022) No evidence of sexual conflict for a novel sperm-derived seminal fluid protein in Caenorhabditis nematodes. bioRxiv doi: https://doi.org/10.1101/2022.09.22.509081

Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H2. Isolated from pill bug in Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".

Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H3. Isolated from pill bug in Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".

Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H4. Isolated from pill bug in a Chinese cabbage field, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".

Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H5. Isolated from pill bug under roadside haystack, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".

Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H6. Isolated from pill bug under rotten grass, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".

Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H7. Isolated from soil under rotten grass, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".