mjIs134 [mex-5p::GFP::(Gly)5Ala/his-58/tbb-2 3'UTR + Cbr-unc-119(+)] II. N-terminal Auxin-Inducible Degron and HA tag inserted into the endogenous hrde-1 locus. gfp fluorescence in germline (mex-5::gfp). Control strain for BFF69; does not carry TIR1 transgene necessary for the degradation. hrde-1(pig6) crRNA sequence: CAUAAUUUUGUCGAGCAAGU. Reference: Toker IA, et al. (2020). Transgenerational Regulation of Sexual Attractiveness in C. elegans Nematodes. bioRxiv.

mjIs134 [mex-5p::GFP::(Gly)5Ala/his-58/tbb-2 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. N-terminal Auxin-Inducible Degron and HA tag inserted into the endogenous hrde-1 locus. Germline-expressed TIR1 and germline GFP. Allows for the degradation of hrde-1 and heritable RNAi deficiency in the presence of auxin. hrde-1(pig6) crRNA sequence: CAUAAUUUUGUCGAGCAAGU. Reference: Toker IA, et al. (2020). Transgenerational Regulation of Sexual Attractiveness in C. elegans Nematodes. bioRxiv.

bqSi577 [myo-2p::GFP + unc-119(+)] IV. Cassette for GFP-labeling and FLP-mediated inactivation of endogenous baf-1 inserted by CRISPR/Cas9 after the baf-1 start codon. FRT sites in GFP intron 3 and baf-1 3'UTR are indicated by ">" symbols in genotype. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632

vrIs13 [vrk-1p::VRK-1:GFP:VRK3UTR + unc-119(+)]. F28B12.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1181 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. Klerkx et al, Dev Biol. 2009 335:12-21.

ieSi64 [gld-1p::TIR1::mRuby::gld-1 3'UTR + Cbr-unc-119(+)] II. Essentially wild-type when maintained on NGM plates. All germline stem cells enter into meiosis when treated with Auxin (1mM). References: Chen J, et al. PLoS Genet. 2020 Mar 20;16(3):e1008650. PMID: 32196486. Chen J, et al. 2020 MicroPublication (https://doi.org/10.17912/micropub.biology.000310) .

zbIs2 [pie-1p::lifeact::RFP::pie-1 3' UTR + unc-119(+)]. Lifeact tag labels F-actin without interfering F-actin dynmics. The strain has never been officially published; however, a GFP version of this transgene is described in Pohl C & Bao Z. Dev Cell. 2010 Sep 14;19(3):402-12. PMID: 20833362.

Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct281 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct281 is a 4.7kb deletion removing intron 5, exon 6, and the 3'UTR of the pal-1 gene. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.

ctIs39 [hbl-1p::GFP::NLS::hbl-1 3'UTR + rol-6(su1006)]. Rollers. Reporter encodes the first 133 amino acids of HBL-1 followed by GFP with SV40 NLS and 1.4 kb of hbl-1 3' UTR. Reference: Fay DS, et al. Dev Biol. 1999 Jan 15;205(2):240-53.

ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) in somatic tissues. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. ieSi57 is a single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. ieSi58 is a single copy transgene inserted into chromosome IV (oxTi177) expressing degron::GFP in the soma. This strain can be used as control for auxin-inducible degradation (AID) in somatic tissues. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieEx21 [smu-2p::degron::smu-2::GFP::smu-2 3'UTR + rol-6(su1006)]. Rollers. Pick Rollers to maintain array. Rollers carry a transgene expressing degron- and GFP- tagged SMU-2 in both the soma and the germ line. This strain can be combined with different TIR1 strains to test auxin-inducible degradation (AID) of nuclear protein in various tissues. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (oxTi177) expressing degron::GFP in the soma. This strain can be combined with different TIR1 strains to test auxin-inducible degradation (AID) of protein in somatic tissue. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi59 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] III. Single copy transgene inserted into chromosome III (oxTi444) expressing degron::GFP at low levels in the soma. This strain can be combined with different TIR1 strains to test auxin-inducible degradation (AID) of protein in somatic tissue. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi59 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] III. ieSi57 is a single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. ieSi59 is a single copy transgene inserted into chromosome III (oxTi444) expressing degron::GFP at low levels in the soma. This strain can be used as control for auxin-inducible degradation (AID) in somatic tissues. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in pharyngeal muscle. This strain can be used for auxin-inducible degradation (AID) in pharyngeal muscle. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi61 [ges-1p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the intestine. This strain can be used for auxin-inducible degradation (AID) in the intestine. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. A degron::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be used to examine spatial and temporal requirements for dynein in somatic tissue, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in pharyngeal muscle. A degron::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be used to examine spatial and temporal requirements for dynein in pharyngeal muscle, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi61 [ges-1p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. A degron::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the intestine. This strain can be used to examine spatial and temporal requirements for dynein in the intestine, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. A degron::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be used to examine spatial and temporal requirements for dynein in the germ line and early embryos, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Degron and GFP tag inserted into endogenous air-2 gene locus by CRISPR/Cas9 engineering allows auxin-inducible degradation (AID) of AIR-2 in germ line and early embryos. Reference: Divekar NS, et al. PLoS Genet. 2021 May 20;17(5):e1009567. PMID: 34014923

ieSi11 [syp-3p::EmeraldGFP::syp-3::syp-3 3'UTR + Cbr-unc-119(+)] II. ieSi11 was inserted into ttTi5605 II using MosSCI. Expression of GFP::SYP-3 largely complements syp-3(ok758), but some meiotic nondisjunction is detected above the N2 background (85% embryonic viability; ~1% male self-progeny;). GFP::SYP-3 expression is readily detected in spermatocytes and oocytes in the germline, and localizes to the interface between paired homologous chromosomes during most of meiotic prophase. Reference: Rog O, Dernburg AF. Cell Rep. 2015 Mar 10. pii: S2211-1247(15)00178-3.

ieSi21 [sun-1p::sun-1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. ieSi21 was inserted into cxTi10882 IV using MosSCI. Expression of the transgenic SUN-1::mRuby fusion protein complements the sun-1 deletion allele. SUN-1::mRuby is expressed throughout the germline and in the early embryo, where it localizes to nuclear envelope and associates with chromosome pairing centers during early meiotic prophase. Reference: Rog O, Dernburg AF. Cell Rep. 2015 Mar 10. pii: S2211-1247(15)00178-3.

ieSi64 [gld-1p::TIR1::mRuby::gld-1 3’UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing a modified Arabidopsis thaliana TIR1 tagged with mRuby in the germ line and early embryos. Comparing to CA1472, this strain expresses a higher level of TIR1 and can induce a faster degradation of AID-tagged proteins in the germ line and early embryos. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi65 [sun-1p::TIR1::sun-1 3’UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing a modified Arabidopsis thaliana TIR1 in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.

meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.

meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.

meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.

ieSi68 [sun-1p::TIR1::mRuby::htp-1 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing a modified Arabidopsis thaliana TIR1 tagged with mRuby in the germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

eEx754 [ilys-3p::ilys-3::mCherry::unc-54 3'UTR + sur-5p::GFP]. Pick GFP+ to maintain. Translational reporter for ilys-3. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.

cerIs2 [lsm-4p::lsm-4::GFP::lsm-4 3'UTR + unc-119(+)]. Reporter contains full-length lsm-4 tagged with GFP. GFP was inserted into a fosmid containing lsm-4. Ubiquitous nuclear GFP expression in somatic and germ cells under normal growth conditions. Cytoplasmic GFP accumulation after exposure to heat-shock. Reference: Cornes E, et al. RNA. 2015 Sep;21(9):1544-53.

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of wrmScarlet1-10 (under the control of the eft-3 promoter and unc-54 3'UTR). Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::vha-13 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249

muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 and wrmScarlet1-10 (both under the control of the eft-3 promoter and the unc-54 3'UTR). Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11(x3) generated via CRISPR/Cas9 insertion of three wrmScarlet11 tags into the endogenous his-3 locus in parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Muscle-specific expression of wrmScarlet1-10 (Under the control of the myo-3 promoter and unc-54 3'UTR). Generated using CRISPR/Cas9 in the SKI-LODGE strain WBM1126. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249

muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4610. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11 inserted at the N-terminus of the endogenous tbb-2 locus; detectable in all somatic tissues where wrmScarlet1-10 is present. Figure 3B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Two tandem repeats of split-wrmScarlet11 inserted at the N-terminus of the endogenous VHA-13 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure 4A from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11(MDELYK) inserted at the C-terminus of the endogenous TOMM-20 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure S6B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.

kstSi32 [Cbr-unc-119(kst13)] I. kstEx45 [hsp-16.41p::Cas9::gpd-2::TagRFP-T::smu-1 3'UTR + mlc-1p::mCherry + NeoR]. Pick mCherry+ to maintain. Unc. Cbr-unc-119(kst13) is a partial unc-119 used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Reference: El Mouridi S, et al. 2022.

kstSi37 [Cbr-unc-119(kst13)] IV. kstEx46 [hsp-16.41p::Cas9::gpd-2::TagRFP-T::smu-1 3'UTR + mlc-1p::mCherry + NeoR]. Pick mCherry+ to maintain. Unc. Cbr-unc-119(kst13) is a partial unc-119 used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Reference: El Mouridi S, et al. 2022.

tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.

Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-84 pre-miRNA via CRISPR/CAS9. Left Flanking: GTTGAGACATGTATATGTTTTTGTT, Right Flanking: GCTACTATTCATCATACGTCTGCCT. sgRNA: ATTCATCATACGTCTGCCTG.

Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-241 pre-miRNA via CRISPR/CAS9. Left Flanking: CTATTTTTTTCACTTGGATTAGGGG, Right Flanking: GGGATGCTCTTTTTGTACCAAACCG. sgRNA: CCTCAACTTTGACACCCCCG.