More Fields
Strain Species Genotype
CA1199 C. elegans unc-119(ed3) III; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1200 C. elegans ieSi57 II; unc-119(ed3) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) in somatic tissues. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1202 C. elegans ieSi57 II; ieSi58 IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. ieSi57 is a single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. ieSi58 is a single copy transgene inserted into chromosome IV (oxTi177) expressing degron::GFP in the soma. This strain can be used as control for auxin-inducible degradation (AID) in somatic tissues. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1203 C. elegans ieEx21. Show Description
ieEx21 [smu-2p::degron::smu-2::GFP::smu-2 3'UTR + rol-6(su1006)]. Rollers. Pick Rollers to maintain array. Rollers carry a transgene expressing degron- and GFP- tagged SMU-2 in both the soma and the germ line. This strain can be combined with different TIR1 strains to test auxin-inducible degradation (AID) of nuclear protein in various tissues. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1204 C. elegans unc-119(ed3) III; ieSi58 IV. Show Description
ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (oxTi177) expressing degron::GFP in the soma. This strain can be combined with different TIR1 strains to test auxin-inducible degradation (AID) of protein in somatic tissue. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1205 C. elegans unc-119(ed3) III; ieSi59 III. Show Description
ieSi59 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] III. Single copy transgene inserted into chromosome III (oxTi444) expressing degron::GFP at low levels in the soma. This strain can be combined with different TIR1 strains to test auxin-inducible degradation (AID) of protein in somatic tissue. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1206 C. elegans ieSi57 II; ieSi59 III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi59 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] III. ieSi57 is a single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. ieSi59 is a single copy transgene inserted into chromosome III (oxTi444) expressing degron::GFP at low levels in the soma. This strain can be used as control for auxin-inducible degradation (AID) in somatic tissues. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1208 C. elegans ieSi60 II; unc-119(ed3) III. Show Description
ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in pharyngeal muscle. This strain can be used for auxin-inducible degradation (AID) in pharyngeal muscle. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1209 C. elegans ieSi61 II; unc-119(ed3) III. Show Description
ieSi61 [ges-1p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the intestine. This strain can be used for auxin-inducible degradation (AID) in the intestine. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1210 C. elegans dhc-1(ie28[dhc-1::degron::GFP]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. A degron::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be used to examine spatial and temporal requirements for dynein in somatic tissue, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1212 C. elegans dhc-1(ie28[dhc-1::degron::GFP]) I; ieSi60 II. Show Description
ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in pharyngeal muscle. A degron::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be used to examine spatial and temporal requirements for dynein in pharyngeal muscle, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1213 C. elegans dhc-1(ie28[dhc-1::degron::GFP]) I; ieSi61 II. Show Description
ieSi61 [ges-1p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. A degron::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the intestine. This strain can be used to examine spatial and temporal requirements for dynein in the intestine, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1215 C. elegans dhc-1(ie28[dhc-1::degron::GFP]) I; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. A degron::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be used to examine spatial and temporal requirements for dynein in the germ line and early embryos, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1217 C.elegans air-2(ie31[degron::gfp::air-2]) I; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Degron and GFP tag inserted into endogenous air-2 gene locus by CRISPR/Cas9 engineering allows auxin-inducible degradation (AID) of AIR-2 in germ line and early embryos. Reference: Divekar NS, et al. PLoS Genet. 2021 May 20;17(5):e1009567. PMID: 34014923
CA1218 C. elegans syp-3(ok758) I; ieSi11 II; unc-119(ed3) III. Show Description
ieSi11 [syp-3p::EmeraldGFP::syp-3::syp-3 3'UTR + Cbr-unc-119(+)] II. ieSi11 was inserted into ttTi5605 II using MosSCI. Expression of GFP::SYP-3 largely complements syp-3(ok758), but some meiotic nondisjunction is detected above the N2 background (85% embryonic viability; ~1% male self-progeny;). GFP::SYP-3 expression is readily detected in spermatocytes and oocytes in the germline, and localizes to the interface between paired homologous chromosomes during most of meiotic prophase. Reference: Rog O, Dernburg AF. Cell Rep. 2015 Mar 10. pii: S2211-1247(15)00178-3.
CA1219 C. elegans unc-119(ed3) III; ieSi21 IV. Show Description
ieSi21 [sun-1p::sun-1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. ieSi21 was inserted into cxTi10882 IV using MosSCI. Expression of the transgenic SUN-1::mRuby fusion protein complements the sun-1 deletion allele. SUN-1::mRuby is expressed throughout the germline and in the early embryo, where it localizes to nuclear envelope and associates with chromosome pairing centers during early meiotic prophase. Reference: Rog O, Dernburg AF. Cell Rep. 2015 Mar 10. pii: S2211-1247(15)00178-3.
CA1352 C. elegans ieSi64 II; unc-119(ed3) III. Show Description
ieSi64 [gld-1p::TIR1::mRuby::gld-1 3’UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing a modified Arabidopsis thaliana TIR1 tagged with mRuby in the germ line and early embryos. Comparing to CA1472, this strain expresses a higher level of TIR1 and can induce a faster degradation of AID-tagged proteins in the germ line and early embryos. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1353 C. elegans ieSi65 II; unc-119(ed3) III. Show Description
ieSi65 [sun-1p::TIR1::sun-1 3’UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing a modified Arabidopsis thaliana TIR1 in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1369 C. elegans zhp-1(ie62[zhp-1::AID::3xFLAG]) I; meIs8 II; spo-11(ie59[spo-11::AID::3xFLAG]) ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
CA1377 C. elegans zhp-2(ie67[zhp-2::AID::3xFLAG]) I; meIs8 II; spo-11(ie60[spo-11::AID::3xFLAG]) ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
CA1421 C. elegans meIs8 dsb-2(ie58[dsb-2::AID::3xFLAG]) II; ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
CA1423 C. elegans meIs8 II; spo-11(ie59[spo-11::AID::3xFLAG]) ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
CA1472 C. elegans ieSi68 II; unc-119(ed3) III. Show Description
ieSi68 [sun-1p::TIR1::mRuby::htp-1 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing a modified Arabidopsis thaliana TIR1 tagged with mRuby in the germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CB7080 C. elegans eEx754. Show Description
eEx754 [ilys-3p::ilys-3::mCherry::unc-54 3'UTR + sur-5p::GFP]. Pick GFP+ to maintain. Translational reporter for ilys-3. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.
CER41 C. elegans unc-119(ed3) III; cerIs2. Show Description
cerIs2 [lsm-4p::lsm-4::GFP::lsm-4 3'UTR + unc-119(+)]. Reporter contains full-length lsm-4 tagged with GFP. GFP was inserted into a fosmid containing lsm-4. Ubiquitous nuclear GFP expression in somatic and germ cells under normal growth conditions. Cytoplasmic GFP accumulation after exposure to heat-shock. Reference: Cornes E, et al. RNA. 2015 Sep;21(9):1544-53.
CF4582 C. elegans muIs252 II; unc-119(ed3) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of wrmScarlet1-10 (under the control of the eft-3 promoter and unc-54 3'UTR). Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4586 C. elegans muIs252 II; unc-119(ed3) III; vha-13(mu493[wrmScarlet11::vha-13]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::vha-13 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4587 C. elegans muIs253 II; unc-119(ed3) III. Show Description
muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249
CF4588 C. elegans muIs253 muIs252 II; unc-119(ed3) III. Show Description
muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 and wrmScarlet1-10 (both under the control of the eft-3 promoter and the unc-54 3'UTR). Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249
CF4594 C. elegans muIs252 II; unc-119(ed3) III; his-3(mu497[his-3::wrmScarlet11]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4601 C. elegans muIs252 II; unc-119(ed3) III; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4608 C. elegans muIs252 II; unc-119(ed3) III; his-3(mu500[his-3::wrmScarlet11(x3)]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11(x3) generated via CRISPR/Cas9 insertion of three wrmScarlet11 tags into the endogenous his-3 locus in parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4610 C. elegans muIs257 I. Show Description
muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Muscle-specific expression of wrmScarlet1-10 (Under the control of the myo-3 promoter and unc-54 3'UTR). Generated using CRISPR/Cas9 in the SKI-LODGE strain WBM1126. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249
CF4611 C. elegans muIs257 I; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4610. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4614 C. elegans muIs252 II; tbb-2(muIs260[wrmScarlet11::tbb-2]) unc-119(ed3) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11 inserted at the N-terminus of the endogenous tbb-2 locus; detectable in all somatic tissues where wrmScarlet1-10 is present. Figure 3B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
CF4616 C. elegans muIs252 II; unc-119(ed3) III; vha-13(muIs264[wrmScarlet11(x2)::vha-13]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Two tandem repeats of split-wrmScarlet11 inserted at the N-terminus of the endogenous VHA-13 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure 4A from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
CF4625 C. elegans muIs252 II; unc-119(ed3) III; tomm-20(muIs276[tomm-20::wrmScarlet11(MDELYK)]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11(MDELYK) inserted at the C-terminus of the endogenous TOMM-20 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure S6B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
CFJ191 C. elegans kstSi32 I; unc-119(ed3) III; kstEx45. Show Description
kstSi32 [Cbr-unc-119(kst13)] I. kstEx45 [hsp-16.41p::Cas9::gpd-2::TagRFP-T::smu-1 3'UTR + mlc-1p::mCherry + NeoR]. Pick mCherry+ to maintain. Unc. Cbr-unc-119(kst13) is a partial unc-119 used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Reference: El Mouridi S, et al. 2022.
CFJ192 C. elegans unc-119(ed3) III; kstSi37 IV; kstEx46. Show Description
kstSi37 [Cbr-unc-119(kst13)] IV. kstEx46 [hsp-16.41p::Cas9::gpd-2::TagRFP-T::smu-1 3'UTR + mlc-1p::mCherry + NeoR]. Pick mCherry+ to maintain. Unc. Cbr-unc-119(kst13) is a partial unc-119 used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Reference: El Mouridi S, et al. 2022.
CGC135 C. elegans let-7(umn45[let-7p::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.
CGC136 C. elegans mir-84(umn46[mir-84p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) X. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-84 pre-miRNA via CRISPR/CAS9. Left Flanking: GTTGAGACATGTATATGTTTTTGTT, Right Flanking: GCTACTATTCATCATACGTCTGCCT. sgRNA: ATTCATCATACGTCTGCCTG.
CGC137 C. elegans mir-241(umn47[mir-241p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) V. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-241 pre-miRNA via CRISPR/CAS9. Left Flanking: CTATTTTTTTCACTTGGATTAGGGG, Right Flanking: GGGATGCTCTTTTTGTACCAAACCG. sgRNA: CCTCAACTTTGACACCCCCG.
CGC152 C. elegans mir-48(umn59[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9.  Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
CGC153 C. elegans mir-48(umn60[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::linker::mODC(422-461)(E428A/E430A/E431A):: lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9.  Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
CGC159 C. elegans mir-61&mir-250(umn66[mir-61p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722]) II. Show Description
mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC has been removed, leaving the SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3'UTR transcriptional reporter in the locus
CGC162 C. elegans mir-266(umn69[mir-266p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
mScarlet replacement of mir-266 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-266 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CGC164 C. elegans mir-271(umn71[mir-271p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
mScarlet replacement of mir-271 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-271 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CGC166 C. elegans mir-784(umn73[mir-784p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272])]) X. Show Description
mScarlet replacement of mir-784 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-784 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CGC168 C. elegans mir-787(umn75[mir-787p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272])]) X. Show Description
mScarlet replacement of mir-787 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-787 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CGC170 C. elegans mir-788(umn77[mir-788p+SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-788 pre-miRNA via CRISPR/CAS9. Left Flanking: TCTGTGCGTATTACAAATTTTCAGCTGGAA, Right Flanking: GAATAGCAGTTTTCAAAATTGTGAGTTGCT. sgRNA: CTGCAAATGGAAGTTAGAAG.