VH7167 |
C. elegans |
gsto-3(hd7161[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 3555 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAACTGTGGATAGAATTAGGGGTGGACGAA; Right flanking sequence: AATATAGTATTATAGGACCGAAAATATAGA. sgRNA #1: AAACGATTTACTCCGGCTAT; sgRNA #2: CAAAAAATTAGCGTCTTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VH7168 |
C. elegans |
F56B3.6(hd7168[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAACTTCTGGACAACCGGCAGAAACGCCA; Right flanking sequence: GTAGGCACAAAGAAGGCGTAGGCCTCCTGG. sgRNA #1: TGGCGTTTCAGAGCTGCACG; sgRNA #2: AAAGCCAATTGTCTGAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VH7169 |
C. elegans |
mdh-1(hd7169[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 969 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAAGACCTTGAACAATCTTCCATTCGCCA; Right flanking sequence: CGGACATTCTGAAAATTTAGCAATTTACAC. sgRNA #1: TTCCCAGTTACCATCGAGGG; sgRNA #2: GACCAAAACGCGAAGTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VH7171 |
C. elegans |
cyp-33C8(hd7171[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2415 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAACTTTCTCGGAGTTATCCCCTTCGATTT; Right flanking sequence: GGGAGAGGAGTAGGTCCCGGTGGTAAATTT. sgRNA #1: GTCGAGCGATGGAAGACCGG; sgRNA #2: GGAGAGTATTGCCGAACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VH7172 |
C. elegans |
Y71H2AM.6(hd7172[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 911 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAATGTTGAAAATAAAAGTGAAAAACTCT; Right flanking sequence: TGGAATTGGATATTTTTGCCACTTTTAATC. sgRNA #1: GTTGGTGTGGTTTTGCGTGG; sgRNA #2: TTTCTCTCCCGTAAACCACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VH7173 |
C. elegans |
+/nT1 [umnls49] IV; mrps-2 (hd7170 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/nT1 V Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7170 and CGC63. hd7170 is a 966 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CAGAAAGAGCCTTCTCGACACGATTTTCCG; Right flanking sequence: TTCGAAAGTGGCAATCAGGAACTCTAACGA. sgRNA #1: AATGGTTACCTGCTGCGACG; sgRNA #2: GGTTGGGCAATACTCTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VH7174 |
C. elegans |
atg-5(hd7174[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 6488 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAAAGCCGAGATTACAAAGAATATGATGA; Right flanking sequence: GACCTTTTATAACTATTCACCCATACTAAT. sgRNA #1: AAGACGAGTCGGCACAGTTG; sgRNA #2: GTGAAGTTGTTATTGTACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VH7176 |
C. elegans |
fubl-4(hd7176[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 2058 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTAAAAACTTTAATAGATACATTTTTGGC; Right flanking sequence: ATACGCTTCTACAATACAACAATCGTTGAA. sgRNA #1: AAAATTACGCCAAACCTGCT; sgRNA #2: ACATTTGAATTATGTTGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VL752 |
C. elegans |
nhr-45(tm1307) X; wwIs23; wwEx55. Show Description
wwIs23 [nhr-178p::GFP + unc-119(+)]. wwEx55 [nhr-45p::nhr-45(genomic)::nhr-45 3'utr + rol-6(su1006)]. Maintain by picking Rollers. Reference: Arda HE, et al. (2010) Mol Syst Biol 6:367.
|
|
VS21 |
C. elegans |
hjSi20 IV. Show Description
hjSi20 [myo-2p::mCherry::unc-54 3'UTR]. Targeting construct derived from pCFJ90. Single copy transgene by MosSCI, inserted into cxTi10882.
|
|
VS29 |
C. elegans |
hjSi56 IV. Show Description
hjSi56 [vha-6p::3xFLAG::TEV::GFP::dgat-2::let-858 3'UTR]. Targeting construct derived from pCFJ178. Reference: Xu N, et al. J Cell Biol. 2012 Sep 3;198(5):895-911.
|
|
VS30 |
C. elegans |
hjSi158 I. Show Description
hjSi158 [vha-6p::SEL-1(1-79)::mCherry::HDEL::let-858 3'UTR ]. Targeting construct derived from pCFJ352. Reference: Klemm RW, et al. Cell Rep. 2013 May 30;3(5):1465-75.
|
|
VT1142 |
C. elegans |
nDf51 V; mir-84(n4037) X; ctIs39. Show Description
ctIs39 [hbl-1::GFP + rol-6(su1006)]. Rollers and GFP+. Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. >75% of animals explode at the vulva at the L4 molt. ctIs39 [hbl-1::GFP]: integrated reporter codes for 133 amino acids of HBL-1 followed by GFP, and contains 1.4 kb of hbl-1 3' UTR plus an NLS. hbl-1::GFP is elevated in the hypodermal syncytium at the L3 stage. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT3118 |
C. elegans |
unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx246. Show Description
maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3136 |
C. elegans |
unc-119(ed3) III; maEx246. Show Description
maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3145 |
C. elegans |
unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx247. Show Description
maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3178 |
C. elegans |
unc-119(ed3) III; maEx247. Show Description
maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3500 |
C. elegans |
wIs51 V; hbl-1(ma354) X. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Gain-of-function allele causing retarded heterochronic defects including extra seam cells and absence of alae in young adult animals. ms354 is a 1120 bp deletion removing most of the hbl-1 3'UTR including all let-7-complementary sites. Sequences flanking the deletion: TTCTAATCATGGCCAGTTTCTTGCA and GTGCGTTCTTCTGTCATCATGTACA. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111.
|
|
VT3650 |
C. elegans |
lin-46(ma398[lin-46::mCherry]) V. Show Description
mCherry reporter inserted into C-terminus of endogenous lin-46 locus. Superficially wild-type. Fluorescent signal is very dim and bleaches very quickly. Reference: Ilbay O, et al. C. elegans LIN-28 controls temporal cell-fate progression by regulating LIN-46 expression via the 5UTR of lin-46 mRNA. bioRxiv 697490; doi: https://doi.org/10.1101/697490.
|
|
VT3727 |
C. elegans |
lin-28(ma426[lin-28::GFP]) I. Show Description
GFP reporter inserted into C-terminus of endogenous lin-28 locus. Superficially wild-type. Reference: Ilbay O, et al. C. elegans LIN-28 controls temporal cell-fate progression by regulating LIN-46 expression via the 5UTR of lin-46 mRNA. bioRxiv 697490; doi: https://doi.org/10.1101/697490.
|
|
VT3855 |
C. elegans |
lin-46(ma467) maIs105 V. Show Description
maIs105 [col-19::GFP]. Precocious heterochronic phenotypes: fewer seam cells and protruding vulva in young adults and patches of alae in L4 larvae. ma467 is a 12 bp deletion in the 5'UTR of the lin-46 gene, which results in gain-of-function of lin-46. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).
|
|
VT3869 |
C. elegans |
wIs51 V; hbl-1(ma430ma475[hbl-1::mScarlet-I::partial deletion of hbl-1 3'UTR]) X Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Retarded Heterochronic defects: extra seam cells and partial or no alae in young adults. hbl-1(ma430ma475) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1 and part of the 3' UTR removed. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).
|
|
VX300 |
C. elegans |
yfSi1 II. Show Description
yfSi1 [nspf-1p::nspf-1::6xHis::tbb-2 3' UTR + loxP, II:8420157]. C-terminal 6xHis-tagged NSPF-1 allows visualization of NSPF seminal fluid protein localization in males and hermaphrodites. Transgene inserted into ttTi5650 MosSCI site (II:8420157) using CRISPR/Cas9. Reference: Kasimatis KR, et al. (2022) No evidence of sexual conflict for a novel sperm-derived seminal fluid protein in Caenorhabditis nematodes. bioRxiv doi: https://doi.org/10.1101/2022.09.22.509081
|
|
VZ149 |
C. elegans |
vzEx41. Show Description
vzEx41 [dnj-27p(2kb)::dnj-27::dnj-27 3'UTR + unc-122p::GFP]. Superficially wild-type. Pick GFP+ to maintain. Reference: Muñoz-Lobato F, et al. Antioxid Redox Signal. 2014 Jan 10; 20(2): 217-235.
|
|
VZ262 |
C. elegans |
trx-3(tm2820) IV; vzEx96. Show Description
vzEx96 [trx-3p::trx-3::trx-3 3'utr + unc-122p::GFP]. Pick GFP+ to maintain. GFP expression in coelomocytes. Reference: Jiménez-Hidalgo M, et al. Free Radic Biol Med. (2014) 68:205-219.
|
|
VZ892 |
C. elegans |
hlh-30(syb1452 [hlh-30::3xFLAG::eGFP]) IV. Show Description
3xFLAG and eGFP tags inserted into the endogenous hlh-30 locus. Superficially wild-type. Diffuse GFP in basal growing conditions and strong nuclear labeling upon diverse stresses like starvation, Staphylococcus aureus infection, arsenite, diethylmaleate, heat shock or levamisole. GFP expression is only visible at high magnification; not discernible with a fluorescence stereoscope. Insertion can be detected by PCR. Forward primer sequence: 5' acgcacgcaactgcttta; Reverse primer (in 3'UTR): 5' aataacctgcgattctgg; Reverse primer (in eGFP): CTTGAAGAAGATGGTACGCTC. Expected products (For&Rev 3'UTR): 910 bp (WT)/1878 bp (syb1452). Expected products (For&Rev eGFP): no band (WT)/811 bp (syb1452). Insertion allele generated by SunyBiotech and out-crossed twice with VZ Lab N2. Reference: Martina JA, et al. EMBO J. 2021 Feb 1;40(3):e105793
|
|
WBM1119 |
C. elegans |
wbmIs60 III. Show Description
wbmIs60 [pie-1p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (III:7007600). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs60 can be used to direct germline-specific gene expression from the pie-1 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific pie-1 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.
|
|
WBM1126 |
C. elegans |
wbmIs61 I. Show Description
wbmIs61 [myo-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (I:2851000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs61 can be used to direct muscle-specific gene expression from the myo-3 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific myo-3 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.
|
|
WBM1133 |
C. elegans |
wbmIs63 I. Show Description
wbmIs63 [myo-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs61] (I:2851000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs63 exhibits muscle-specific wrmScarlet expression driven the myo-3 promoter. Derived from parental strain WBM1126 by CRISPR-mediated insertion of wrmScarlet downstream of tissue-specific myo-3 promoter inserted as a single copy into the C. elegans genome (wbmIs61). Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.
|
|
WBM1140 |
C. elegans |
wbmIs65 V. Show Description
wbmIs65 [eft-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (V:8645000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs65 can be used to direct soma-specific gene expression from the eft-3 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.
|
|
WBM1141 |
C. elegans |
wbmIs66 IV. Show Description
wbmIs66 [rab-3p::3XFLAG::dpy-10 crRNA::rab-3 3'UTR] (IV:5015000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs66 can be used to direct neuron-specific gene expression from the rab-3 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific rab-3 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.
|
|
WBM1143 |
C. elegans |
wbmIs67 V. Show Description
wbmIs67 [eft-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs65] (V:8645000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs67 exhibits soma-specific wrmScarlet expression driven the eft-3 promoter. Derived from parental strain WBM1140 by CRISPR-mediated insertion of wrmScarlet downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome (wbmIs65). Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.
|
|
WBM1144 |
C.elegans |
wbmIs68 IV. Show Description
wbmIs68 [rab-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs66] (IV:5015000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs68 exhibits neuron-specific wrmScarlet expression driven the rab-3 promoter. Derived from parental strain WBM1141 by CRISPR-mediated insertion of wrmScarlet downstream of tissue-specific rab-3 promoter inserted as a single copy into the C. elegans genome (wbmIs66). Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.
|
|
WBM1153 |
C. elegans |
wbmIs72 III. Show Description
wbmIs72 [pie-1p::3XFLAG::GFP::unc-54 3'UTR *wbmIs60] (III:7007600). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs72 exhibits germline-specific GFP expression driven the pie-1 promoter. Derived from parental strain WBM1119 by CRISPR-mediated insertion of GFP downstream of tissue-specific pie-1 promoter inserted as a single copy into the C. elegans genome (wbmIs60). Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.
|
|
WBM1167 |
C. elegans |
wbmIs79 *wbmIs67 V. Show Description
wbmIs79 [eft-3p::3XFLAG::raga-1::SL2::wrmScarlet::unc-54 3'UTR] *wbmIs67. Somatic-specific RAGA-1 and wrmScarlet expression driven by the eft-3p promoter. Derived by CRISPR-mediated insertion of raga-1 downstream of tissue-specific eft-3 promoter of wbmIs67 insertion in parental strain WBM1143. wbmIs67 [eft-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs65] (V:8645000). Reference: Zhang Y, et al. Elife. 2019 Aug 14;8:e49158. doi: 10.7554/eLife.49158. PMID: 31411562.
|
|
WBM1168 |
C. elegans |
wbmIs80 *wbmIs68 IV. Show Description
wbmIs80 [rab-3p::3XFLAG::raga-1::SL2::wrmScarlet::rab-3 3'UTR] *wbmIs68. Neuron-specific RAGA-1 and wrmScarlet expression driven by the rab-3 promoter. Derived by CRISPR-mediated insertion of raga-1 downstream of tissue-specific eft-3 promoter of wbmIs68 insertion in parental strain WBM1144. wbmIs68 [rab-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs66] (IV:5015000). Reference: Zhang Y, et al. Elife. 2019 Aug 14;8:e49158. doi: 10.7554/eLife.49158. PMID: 31411562.
|
|
WBM1177 |
C. elegans |
wbmIs81. Show Description
wbmIs81 [eft-3p::3XFLAG::GFP::SKL::unc-54 3'UTR *wbmIs65] (V:8645000). Ubiquitous expression of peroxisome-targeted GFP.
SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. Derived from parental strain WBM1140 by CRISPR-mediated insertion of peroxisome-targeted GFP downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome (wbmIs65). Outcrossed six times to WBM lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715.
|
|
WBM1179 |
C. elegans |
wbmIs76 IV. Show Description
wbmIs76 [eft-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (IV:5015000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs76 can be used to direct soma-specific gene expression from the eft-3 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.
|
|
WBM1214 |
C. elegans |
wbmIs88 V. Show Description
wbmIs88 [eft-3p::3XFLAG::dpy-10::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs67]. (V:8645000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of the soma-specific eft-3 promoter. wbmIs88 exhibits soma-specific dpy-10 and wrmScarlet expression driven the eft-3 promoter. Derived from parental strain WBM1143 by CRISPR-mediated modification of tissue-specific transgene. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.
|
|
WBM1215 |
C. elegans |
wbmIs89 IV. Show Description
wbmIs89 [rab-3p::3xFLAG::dpy-10::SL2::wrmScarlet::rab-3 3'UTR, *wbmIs68] (IV:5015000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of the neuron-specific rab-3 promoter. wbmIs68 exhibits neuron-specific dpy-10 and wrmScarlet expression driven the rab-3 promoter. Derived from parental strain WBM1144 by CRISPR-mediated modification of tissue-specific transgene. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.
|
|
WBM1231 |
C. elegans |
wbmIs97 *wbmIs65. Show Description
wbmIs97 [eft-3p::tomm-20(aa1-49)::GFP::unc-54 3'UTR] *wbmIs65. Somatic-specific TOMM-20(1-49)::GFP expression driven by the eft-3p promoter allows imaging of mitochondria without some of the adverse side effects of extrachromosomal arrays. Derived by CRISPR-mediated insertion of TOMM-20::GFP downstream of tissue-specific eft-3 promoter of wbmIs65 insertion in parental strain WBM1140. wbmIs65 [eft-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (V:8645000). Reference: Valera-Alberni M, et al. Life Science Alliance Sep 2024, 7 (11) e202402918; DOI: 10.26508/lsa.202402918. PMID: 39071403.
|
|
WBM1232 |
C. elegans |
wbmIs98 *wbmIs65. Show Description
wbmIs98 [eft-3p::tomm-20(aa1-49)::mCherry::unc-54 3'UTR] *wbmIs65. Somatic-specific TOMM-20(1-49)::mCherry expression driven by the eft-3p promoter allows imaging of mitochondria without some of the adverse side effects of extrachromosomal arrays. Derived by CRISPR-mediated insertion of TOMM-20::mCherry downstream of tissue-specific eft-3 promoter of wbmIs65 insertion in parental strain WBM1140. wbmIs65 [eft-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (V:8645000). Reference: Valera-Alberni M, et al. Life Science Alliance Sep 2024, 7 (11) e202402918; DOI: 10.26508/lsa.202402918. PMID: 39071403.
|
|
WBM1250 |
C. elegans |
raga-1(wbm40[raga-1::AID::EmGFP]) II; wbmIs83 IV. Show Description
wbmIs83 [rab-3p::3xFlag::TIR1::rab-3 3'UTR] *wbmIs66 IV. Auxin-inducible degron (AID) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Neuronal-specific expression of TIR1 allows for auxin-inducible degradation of RAGA-1 in the nervous system. wbmIs66 [rab-3p::3XFLAG::dpy-10 crRNA::rab-3 3'UTR] (IV:5015000). Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https://doi.org/10.1371/journal.pgen.1010938. PMID: 37721956.
|
|
WBM132 |
C. elegans |
wbmEx49. Show Description
wbmEx49 [rab-3p::crtc-1(S76A, S179A)::tdTomato::unc-54 UTR]. tdTOMATO-tagged, non-phosphorylatable CRTC-1 expression in neurons. Pick fluorescent animals to maintain. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
|
|
WBM1339 |
C. elegans |
wbmIs118 I. Show Description
wbmIs118 [myo-3p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs114] I. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in muscle. wrmScarlet expression in muscle. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs114. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
|
|
WBM1340 |
C. elegans |
wbmIs99 IV. Show Description
wbmIs99 [rab-3p::3xFLAG::rpl-22::SL2::wrmScarlet::rab-3 3'UTR, *wbmIs89] IV. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the nervous system. wrmScarlet expression in nervous system. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs89. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
|
|
WBM1364 |
C. elegans |
wbmIs119 V. Show Description
wbmIs119 [eft-3p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs88] V. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in soma. wrmScarlet expression in soma. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs88. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
|
|
WBM1438 |
C. elegans |
ieSi57 raga-1(wbm40[raga-1::AID::EmGFP]) II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Auxin-inducible degron (AID) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Somatic expression of TIR1 allows for auxin-inducible degradation of RAGA-1 in the soma. Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https://doi.org/10.1371/journal.pgen.1010938. PMID: 3772195
|
|
WBM1470 |
C. elegans |
wbmIs131 V. Show Description
wbmIs131 [nep-17p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs119] V. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the intestine. wrmScarlet expression in the intestine. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs119. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
|
|
WBM1471 |
C. elegans |
wbmIs133 V. Show Description
wbmIs133 [rab-3p::3XFLAG::rpl-22::SL2::scarlet::rab-3 3'UTR, *wbmIs127] (V:8645000). N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the nervous system. wrmScarlet expression in nervous system. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs127. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
|
|