More Fields
Strain Species Genotype
VC4561 C. elegans cox-7C(gk5632[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
[NOTE: Please see RG5024 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1095 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ACATCAAAGTCAGAGTTTTATGGCTCACCG. Right flanking sequence: GGGGCTTGTAAGATGAGAAGCACCCGTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4565 C. elegans psmd-9(gk5633[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 854 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAAACGACATATTTTTAAATGCAATCTTTG. Right flanking sequence: TCCGGTGCTAATGTCTAATGTGATTTTTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4566 C. elegans timp-1(gk5634[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 690 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACAGGTCGCCAGTTGAACCTTTCCCGGCG. Right flanking sequence: CTTGGAAGAAGTTTGTGGATTCGGTTGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4567 C. elegans F02E9.10(gk5635[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 2929 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAGTTTCAAGCGACGGGTCCACCACCGGTT. Right flanking sequence: TGCGGTATTCCTTCTTCGTTCATCATATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4568 C. elegans F08B4.7(gk5639[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1233 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATTCAAAATATTCAGATAATCACACCATGC. Right flanking sequence: GTGTGTCAACAGGGCACGAGAAATACGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4569 C. elegans F32B5.6(gk5640[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 4226 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCGTCGTCTCTATCAGTATTATGGAGACG. Right flanking sequence: TTGGTAGGCTCTCAATTATATCCTTATCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4570 C. elegans F26H11.8(gk5641[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 537 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACCATAAATATAATCGAATCAAAATTCCT. Right flanking sequence: TCTTCGTCGTCGTCCTCGTCTTCCTCATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4571 C. elegans F33D4.6(gk5642[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 3735 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGAAAATTGCACAAAAGTCAAGGGCAGAAA. Right flanking sequence: AAGAGATGTCTCATCTGAAACATACATTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4572 C. elegans ccch-2(gk5643[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 922 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATATGTACCAGTAAATGGGCGGAGCCTAAC. Right flanking sequence: CTAGCACTGACTTCTCTTAACTTTATTCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4573 C. elegans sucl-2(gk5644[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1315 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATAGAAAATAGAATTAGACACAAAAGCTGA. Right flanking sequence: CGGGGCACTCAAGTGAATGAAATTGACTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4574 C. elegans rfc-4(gk5645[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1735 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATGTACCGTACACCATTTCAAACACTCTCG. Right flanking sequence: GTCGCCCATCGATTTTCGCTCCTTGAAGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4575 C. elegans F26E4.4(gk5646[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
[NOTE: Please see RG5025 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1524 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAAAAAAACTGGATAACAATAAATTGGCAA. Right flanking sequence: TGGAAAACGCACGCGACGCGTGACCGCAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4576 C. elegans maph-1.1(gk5647[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 4814 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTTATTCATTTTGATATGTGTCTCTAGGCA. Right flanking sequence: GAATGCTCTTCAAAATCACTATTTTTAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4577 C. elegans idhg-1(gk5648[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
[NOTE: Please see RG5056 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2420 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GAAACACGTGCGGCGCTTGCAAATCAATCG. Right flanking sequence: TTACGTTCTTTTCCTCTGTTTTTTTTTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4578 C. elegans prx-12(gk5649[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ X. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1339 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GATACGGACAGTGTCCTCGCTCCTCCGGCA. Right flanking sequence: ACAGGATGCCCGGCAAACGTTCAGCATTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4579 C. elegans rpb-8(gk5650[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 782 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCATGAGAAGGTACAGATTCATGTCGACCT. Right flanking sequence: GGGATATCTAAAAATGGGAGATGAGCGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4580 C. elegans F25G6.9(gk5651[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 4606 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGTAACCGAACAAAATAGGAGACACCAGTC. Right flanking sequence: CGCGGGTTCCACGGGATTCATGTCGAAAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4582 C. elegans atp-3(gk5653[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1382 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CTGTTTTCTTTCAAAACATTATTAAGAAGT. Right flanking sequence: TGGCTGAGTATCACTCTCTTAACCATAAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4583 C. elegans F32E10.5(gk5654[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1347 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGTAGAACTCGTTTTTTTTTTCTGCTCCA. Right flanking sequence: CCATAATCCCATCCAGCATCCTCTTCTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4584 C. elegans rpt-3(gk5655[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1611 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GAAATAAAAGTAAGTTGAAACCACATCGTA. Right flanking sequence: ATTTCGAGTTCTACAAGTAAACCACGAGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4586 C. elegans arp-11(gk5656[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2105 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATCAGCAGCTAATTTTCCATTTTTCCACTC. Right flanking sequence: TCAGCGACTCCAACGTTGATTGAGCAGTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4588 C. elegans F33H1.3(gk5658[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1872 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGGACTATTGATAGTGTTTTGTGGTGCGTT. Right flanking sequence: GAGAAACGAGAGAGGCATCCGAGTCTCCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4589 C. elegans srpa-72(gk5659[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 6397 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAGATGTGAGCATTCGGGTACGCAATTTGT. Right flanking sequence: ATTGGCGATTTTTAAGCCTTTTTGTCTGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4590 C. elegans nspb-4(gk5660[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1450 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCTACGTGCTTACCAACATATCTGCCTAAC. Right flanking sequence: AGCGGTAACTTTTCAATTTTCCAATCACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4591 C. elegans grd-5(gk5661[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 512 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATATAAAGCACCTCGCATTGTCAACCTCCT. Right flanking sequence: GATCTCTCGGAGGAAAATTCGAGACTGTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4592 C. elegans algn-2(gk5662[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2125 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCAATATAGTAGATCGCATTGTTTCCAAGA. Right flanking sequence: AGGCACACACTCGTTTGTACTTAAGAAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4593 C. elegans F27D4.1(gk5663[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2223 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATTTAAATTAATTTTGGCAATTTCTACCCG. Right flanking sequence: CATGAATACCTTCAAATAGCCTAATGTAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4595 C. elegans cdc-73(gk5665[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 4854 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCTCGTGGCCGCGGCCTAGAAATCCCGCTC. Right flanking sequence: CCAGGATAAGCCGGTGGCTCAAGTGATGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4596 C. elegans dxbp-1(gk5666[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
[NOTE: Please see RG5003 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2234 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GGTGGGCGGCAAAATATTTTTTCCGCCAAACCGGCAAATTGCCGGAATTGAAAATTTCCG. Right flanking sequence: TTCGGAAGTTAAGTGGCATTTGAAGCCGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4597 C. elegans F32D1.7(gk5667[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1527 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTATATATACACGAATGTCATTTAGTCGG. Right flanking sequence: CCTGGCACGGCAAAACAAAATTAGCAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4598 C. elegans F25H5.10(gk5668[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 369 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACGACTTTCATGGGTGACAGATTTTAGAGC. Right flanking sequence: AATTGGCGAAGAAAAGAAAGTGAAATTTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4599 C. elegans K04F10.3(gk5669[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1711 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAAGGAGTTGTGTTAGCGCACTCTCCGTGC. Right flanking sequence: GTGTCTTTCTGCCTGTCACATTTACTTGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4600 C. elegans F32B6.3(gk5670[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2258 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTAACAAATTCGACACTTTTCGATGGATCC. Right flanking sequence: CCGCTTTCTGCTCTTTTTCTTGATATCTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4601 C. elegans F30A10.13(gk5671[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 642 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACTTGGAGAAGAAGTTGCCGGGAAATGTC. Right flanking sequence: AGGAATTTTTGTGCGTTCAAGACTTTATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4602 C. elegans F39G3.5(gk5672[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 3027 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCCAATAAATAACATTTGTACCGGCCATAA. Right flanking sequence: TTGGCTCTTTTATTAGGTGTTTGTACCAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4603 C. elegans pbs-1(gk5673[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 783 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAACGATTTTAGAGGACTTGTTCGATGTGC. Right flanking sequence: TGGCTTTGCGCTTCTCATCTCGCATAGTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4604 C. elegans F42C5.6(gk5674[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 982 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGCTAGTTGACGAACACGATCCGCTGCTG. Right flanking sequence: GGGGGATCGCGATTAGATGTTGTTGGGGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4605 C. elegans tni-1(gk5675[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ X. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1397 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TAATGACAACAATGCCGGTATTTATTCCTC. Right flanking sequence: GGTGGGTGTGAAGGTATTCAAGGGTGTGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4606 C. elegans F56D5.2(gk5676[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2308 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TACAGTGGAAAATATTTCAGGACACCACGG. Right flanking sequence: ATTGGTTCAAAAGTGGCGGTACGAGTCGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4607 C. elegans F59B10.3(gk5677[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
[NOTE: Please see RG5016 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2307 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GAGAAGAGGCGGAGGATTGCGGCGATATGT. Right flanking sequence: CGATTTTCTGTAAATATTTGCTCAAACCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4608 C. elegans exos-7(gk5678[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2617 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ACAAAATCATTTTTCAAAATATATCTTCCT. Right flanking sequence: AATTTATGGAATTTATTCAATTTGTTGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4609 C. elegans F30F8.9(gk5679[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 3227 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TATTCCTGACACAATTATTTCAATTATCCA. Right flanking sequence: GTTAAGTACTTTTTCCCCATCCGCTCCAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4610 C. elegans H12I13.1(gk5680[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 5113 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTATTTACATTAAAATGAACTAACCTCCA. Right flanking sequence: CTGGCTTAGAATCTCAAGCGACTGTAGTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4611 C. elegans F32D1.5(gk5681[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1829 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTGTAGGTGCAAGCTGAACGGATGCCTCCG. Right flanking sequence: TGGGGCAGCGCTATCAATTCAAAAAAAAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4612 C. elegans C34D4.4(gk5682[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Pick viable fertile GFP+ animals to maintain. Deletion of 1040 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AAAAGCGAAAATTTCCGGAGCGTTCCCCCG. Right flanking sequence: TGCTCAACAACCACCACAAGAATATCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4613 C. elegans F09E5.11(gk5683[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 655 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CCATATTCTTGAAGCTGAATGTTTCCCCAG. Right flanking sequence: GTAGGAGATTTTTATCTTCTTGTGACACGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4614 C. elegans F35G12.7(gk5684[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 527 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAATTCGTAGAATCCACAATCCATCCTCCA. Right flanking sequence: TATGGGTCGCACTTGCGCGTCACGGTGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4615 C. elegans ucr-11(gk5685[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 448 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AACATCTTCATAATTCTAAAAAAGTCAATC. Right flanking sequence: TGGCTTCATGTACAGCATGATTCAACCTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4619 C. elegans F37C4.4(gk5689[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2273 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATTCCGATAATTTGTTGTACTTTCACGAGT. Right flanking sequence: ATCCAGAAGATAAGGGTTATCATATCGTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4620 C. elegans vha-10(gk5690[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 714 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGAGAGGGATATCACATCATAAAAGTAAGG. Right flanking sequence: GTTTGTGAGGCCATTTTAAGGTTTTCGGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.