| CL2337 |
C. elegans |
smg-1(cc546) I; dvIs38. Show Description
dvIs38 [myo-3p::GFP::degron::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Rollers. Temperature-dependent expression of aggregating GFP in body wall muscle (weak at 16C, strong at 25C). Animals become paralyzed if upshifted as larvae to 25C due to expression of aggregating GFP. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| CL2355 |
C. elegans |
smg-1(cc546) dvIs50 I. Show Description
dvIs50 [pCL45 (snb-1::Abeta 1-42::3' UTR(long) + mtl-2::GFP] I. Maintain at 16C. Pan-neuronal expresion of human Abeta peptide. Constitutive intestinal expression of GFP from marker transgene. Strain shows deficits in chemotaxis, associative learning, and thrashing in liquid. Strain also has incomplete sterility due to germline proliferation defects and embryonic lethality. Maintain at 16 C to reduce selection against transgene, although this does not alter the partial sterility. Reference: Wu Y., et al. J Neurosci. 2006 Dec 13;26(50):13102-13. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| CL2621 |
C. elegans |
smg-1(cc546) I; dvIs75. Show Description
dvIs75 [myo-3::Abeta 1-42 G37L::3' UTR(long) + mtl-2::GFP)]. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in ~32 hr if induced as L3 larvae. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| CL2659 |
C. elegans |
smg-1(cc546) I; dvIs770. Show Description
dvIs770 [myo-3::Abeta 1-42 wt::3' UTR(long) + mtl-2::GFP]. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in 18-24 hr if induced as L3 larvae. NOTE: dvIs770 was originally described as dvIs70 in Fonte et al, 2011. The name of this array was changed to dvIs770 to avoid confusion with dvIs70 [hsp-16.2p::GFP + rol-6(su1006)] carried in strain CL2070. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| CL4176 |
C. elegans |
smg-1(cc546) I; dvIs27 X. Show Description
dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Rollers. Temperature sensitive: needs to be propagated at 15C. Upshift larval animals to check that the worms get paralyzed and give offspring that arrest as eggs/early larvae. This strain produces low levels of beta amyloid peptide even when grown at low temperature, and therefore there is always some selection for loss of transgene copies. It is recommended to maintain growing stock plates at 15-16 degrees C by transferring small numbers of animals each generation rather than by "chunking", which increases the effective population size and therefore the chance of a relatively rare transgene loss, and then this revertant taking over the population. The strain should also be frozen shortly after being received. This strain can only be sent to academic users and not to commercial organizations. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| CL6049 |
C. elegans |
dvIs62 X. Show Description
dvIs62 [snb-1p::hTDP-43/3' long UTR + mtl-2p::GFP] X. Temperature-sensitive. Maintain at 16 to minimize selection against transgene. Uncoordinated from hatching; phenotype is stronger at higher temperatures. Intestinal GFP expression. Reference: Ash PE, et al. Hum Mol Genet. 2010 Aug 15;19(16):3206-18.
|
|
| CL6180 |
C. elegans |
smg-1(cc546) I; dvIs19 III; skn-1(zu67)/nT1 [unc-?(n754) let-?] (IV;V); dvIs27 X. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Roller with weak constitutive GFP expression. Balanced strain, segregates Rol Uncs [skn-1(zu67) heterozygotes], Rol nonUncs [skn-1(zu67) homozygotes] and dead eggs. Maintain by picking Rol Uncs. Paralyzed if upshifted as larvae to 25C. References: Dostal, V and Link CD (2010) J Vis Exp. Oct 9;(44). Dostal V, Roberts CM, Link CD (2010) Genetics Nov;186(3):857-66. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| COP227 |
C. elegans |
oaSi41 II; unc-119(ed3) III. Show Description
oaSi41 [par-5p::GFP::par-5::par-5 3' UTR.2(prespliced) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.2 isoform exclusively. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
|
|
| COP262 |
C. elegans |
unc-119(ed3) III; knuSi221. Show Description
knuSi221 [fib-1p::fib-1(genomic)::eGFP::fib-1 3' UTR + unc-119(+)]. Single copy insertion. fib-1 promoter, genomic sequence, and 3'UTR was inserted into pCFJ151 (ttTi5606) targeting vector and inserted into ttTi5605. Allen AK, Nesmith JE, and A Golden. 2014 G3:4(12)2329-43.
|
|
| CV203 |
C. elegans |
rjSi1 II. Show Description
rjSi1 [cra-1p::cra-1::GFP::cra-1 3'UTR + Cbr-unc-119(+)] II. Single copy insertion. cra-1 promoter, cra-1::GFP and 3'UTR was cloned into pCFJ150 (ttTi5605) vector and inserted into ttTi5605 of EG4322 strain. Outcrossed three times to N2 Bristol; could still carry unc-119(ed9) in the background. Superficially wild-type. This CRA-1::GFP fusion construct has been shown to be functional and its localization reflects endogenous CRA-1 localization. rjSi1 transgene can rescue synapsis defects of cra-1 mutants and restore cross-over events (six bivalents instead of the 11 to 12 univalents characteristic of cra-1 mutants). Brood size and embryonic lethality were significantly, albeit not completely, restored in the rescued line suggesting that the GFP tag might affect other CRA-1 functions. Reference: Gao J, et al. PLOS Genetics 11(3): e1005029. https://doi.org/10.1371/journal.pgen.1005029
|
|
| CY251 |
C. elegans |
sqt-1(sc13) age-1(mg44) II; bvIs2. Show Description
bvIs2 contains [ric-19p::age-1(cDNA)::myc::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs2 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GCA CAG TTT TAC GAA AGG AAC-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.
|
|
| CY262 |
C. elegans |
sqt-1(sc13) age-1(mg44) II; bvIs1. Show Description
bvIs1 contains [ges-1p::age-1(cDNA)::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs1 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GTC ATT TTG GCA CCA TAG GAG-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.
|
|
| CYA11 |
C. elegans |
ldrIs1; eeeIs1. Show Description
ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. eeeIs1 [unc-54p::Htt513(Q15)::YFP::unc-45 3'UTR]. Derived by crossing parental strains LIU1 and EAK102. YFP is fused to a fragment of mutant human Huntingtin protein; expression in body wall muscle cells. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets.
|
|
| CYA12 |
C. elegans |
ldrIs1; eeeIs2. Show Description
ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. eeeIs2 [unc-54p::Htt513(Q128)::YFP::unc-54 3'UTR]. Motility defect. Derived by crossing parental strains LIU1 and EAK103. YFP is fused to a fragment of mutant human Huntingtin protein; expression in body wall muscle cells of the pharynx in adults and punctate expression in body wall muscle cells of larval animals. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets.
|
|
| CYA13 |
C. elegans |
frSi17 II; rde-1(ne300) V; ldrIs1. Show Description
frSi17 [mtl- 2p::rde-1 3'UTR] II. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. Derived by crossing parental strains IG1839 and LIU1. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. frSi17 inserted into ttTi5605 site.
|
|
| CYA6 |
C. elegans |
rexEx4. Show Description
rexEx4 [myo-2p::mCherry::P2A::Flag::UltraID::unc-54 3'UTR]. Pick mCherry+ to maintain. Mosaic expression of red fluorescence (mCherry) in pharynx. P2A is the self-cleaving peptide sequence.
|
|
| CYA7 |
C. elegans |
rexEx5. Show Description
rexEx5 [ges-1p::mCherry::P2A::Flag::UltraID::unc-54 3'UTR]. Pick mCherry+ to maintain. Mosaic expression of red fluorescence (mCherry) in the intestine. P2A is the self-cleaving peptide sequence.
|
|
| CYA8 |
C. elegans |
rexEx6. Show Description
rexEx6 [myo-3p::mCherry::P2A::Flag::UltraID::unc-54 3'UTR]. Pick mCherry+ to maintain. Mosaic expression of red fluorescence (mCherry) in body-wall muscle; punctate mCherry signals in some animals. P2A is the self-cleaving peptide sequence.
|
|
| CZ24092 |
C. elegans |
gip-2(lt19[gip-2::GFP::loxP::Cbr-unc-119(+)::loxP]) I; ltSi953 II; unc-119(ed3) III. Show Description
ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous gip-2 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged gip-2 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.
|
|
| CZ24274 |
C. elegans |
dhc-1(lt45[dhc-1::GFP]) I; ltSi953 II; unc-119(ed3) III. Show Description
ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous dhc-1 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged dhc-1 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.
|
|
| CZ26389 |
C. elegans |
esyt-2(ju1408) III. Show Description
CRISPR-engineered deletion of esyt-2 from middle of 5'UTR to middle of 3'UTR using guide RNAs crCP01 (GGTTTCAGTAATTGTGGGCT) and
crCP02 (GTGCACTTACGGGTTGTAGG). Superficially wild-type. Reference: Piggott CA, et al. Genetics. 2021 Apr 19;iyab063. doi: 10.1093/genetics/iyab063. PMID: 33871019.
|
|
| DCL569 |
C. elegans |
mkcSi13 II; rde-1(mkc36) V. Show Description
mkcSi13 [sun-1p::rde-1::sun-1 3'UTR + unc-119(+)] II. Germline rescue of the rde-1(mkc36) indel mutation, allowing germline-specific RNAi. Reference: Zou L, et al. Scientific Reports Volume 9, Article number: 2354 (2019) "Construction of a germline-specific RNAi tool in C. elegans."
|
|
| DCR9089 |
C elegans |
olaIs138 IV. Show Description
olaIs138 [ttx-3p::SL2::HYlight::let-858 3'UTR + elt-7p::mCherry] IV. Expression of HYlight, a codon-optimized biosensor that responds to changing levels of FBP in cells, in the neuron pair AIY. Derived by UV/TMP insertion of the olaEx5367 transgene. Reference: Wolfe AD, et al. Proc Natl Acad Sci U S A. 2024 Jan 16;121(3):e2314699121. doi: 10.1073/pnas.2314699121. PMID: 38198527.
|
|
| DE112 |
C. elegans |
sup-46(qa710) I; dnSi4 II; unc-119(ed9) III. Show Description
dnSi4 [gna-1::GFP::gna-1 3UTR + Cbr-unc-119(+)] inserted into ttTi5605 on LG II. Unknown if unc-119(ed9) III is homozygous or heterozygous in this strain.
|
|
| DE116 |
C. elegans |
dnSi9II; unc-119(ed9) III. Show Description
dnSi9 [sup-46::GFP::sup-46 3UTR + Cbr-unc-119(+)] inserted into ttTi5605 on LG II. Strong nuclear-localized GFP expression (expression from dnIs22 is brighter).
|
|
| DLW109 |
C. elegans |
wrdSi23 I; unc-104(knu973[unc-104::AID*]) II. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
| DLW110 |
C. elegans |
wrdSi23 I; unc-18(knu969[unc-18::AID*]) X. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
| DLW112 |
C. elegans |
reSi7 I; unc-104(knu973[unc-104::AID*]) II. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID*-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).
|
|
| DLW114 |
C. elegans |
reSi7 I; unc-18(knu969[unc-18::AID*]) X. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID*-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID* into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).
|
|
| DLW124 |
C. elegans |
wrdSi22 I; unc-52(knu968[AID*::unc-52]) II. Show Description
wrdSi22 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR::SEC[LoxP + let-858 term + sqt-1(d) + hs::Cre + hygR + unc-54 term + LoxP]] I. wrdSi22 is inserted at ttTi4348 (-5.32 cM). Pick Rollers to maintain animals retaining the SEC in the insertion. SEC can be removed by heat shock-induced excision according to the protocol in Dickinson et. al. Genetics 2015. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at N-terminus of endogenous unc-52 locus by CRISPR/Cas9. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
| DQM104 |
C. elegans |
bmdSi15 I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. CRISPR/Cas9-mediated recombination was used to insert eef-1a.1p::GFP into the standard MosSCI insertion site ttTi4348. Reference: Reference: Costa DS, et al. Development. 2023 May 1;150(9):dev201570. doi: 10.1242/dev.201570. PMID: 37039075.
|
|
| DQM1118 |
C. elegans |
icbSi228 II; unc-119(ed3) III; ama-1(ers49[ama-1::degron::gfp]) IV. Show Description
icbSi228 [ttTi5605_right::wrt-2p::wCherry::Dam:linker:egl-13NLS::vhhGFP4::unc-54::unc-119 3'UTR::unc-119::unc-119p::ttTi5605_left)] II. Wild-type growth and movement.
|
|
| DQM1126 |
C. elegans |
icbSi228 II; unc-119(ed3) III; had-1(bmd134[had-1::GFP::loxP]) V. Show Description
icbSi228 [ttTi5605_right::wrt-2p::wcherry::Dam:linker:egl-13NLS:vhhGFP4::unc-54::unc1193'UTR::unc-119::unc-119p::ttTi5605_left)] II. Wild-type growth and movement.
|
|
| DV3799 |
C. elegans |
reSi1 I. Show Description
reSi1 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Hypodermal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in hypodermal nuclei.
|
|
| DV3800 |
C. elegans |
reSi2 II. Show Description
reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Hypodermal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in hypodermal nuclei.
|
|
| DV3801 |
C. elegans |
reSi3 I. Show Description
reSi3 [unc-54p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Muscle-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in muscle nuclei.
|
|
| DV3803 |
C. elegans |
reSi5 I. Show Description
reSi5 [ges-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Intestinal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in intestinal nuclei.
|
|
| DV3805 |
C. elegans |
reSi7 I. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in neuronal nuclei. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).
|
|
| DV3825 |
C. elegans |
reSi11 II. Show Description
reSi11 [unc-54p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Muscle-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in muscle nuclei.
|
|
| DV3826 |
C. elegans |
reSi12 II. Show Description
reSi12 [ges-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Intestinal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in intestinal nuclei.
|
|
| DWP294 |
C. elegans |
rhIs2. Show Description
rhIs2 [pat-3::HA::GFP]. rhIs2 contains cosmid-derived full-length pat-3, including 5 kb 5UTR and 1 kb 3 UTR, with HA and GFP(S65C) tags inserted prior to the pat-3 stop codon. Reference: Plenefisch JD, et al. Development. 2000 127(6):1197-207. doi: 10.1242/dev.127.6.1197.
|
|
| DZ841 |
C. elegans |
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III; zuIs236. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. zuIs236 [his-72(1 kb 5'UTR)::BIRA::GFP::his-72(1 kb 3'UTR) + unc-119(+)]. Location of zuIs236 is not known, but is not in LG III.
|
|
| EAG16 |
C. elegans |
eagIs6[*fxIs10] II. Show Description
eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.
|
|
| EAG25 |
C. elegans |
eagIs6[*fxIs10] ujIs113 II. Show Description
eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. H2::mCherry marks germline nuclei. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.
|
|
| EAG28 |
C. elegans |
eagIs6[*fxIs10] II; ltIs44 IV. Show Description
eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)] IV. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. mCherry::PH marks cell membranes. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.
|
|
| EAK102 |
C. elegans |
eeeIs1. Show Description
eeeIs1 [unc-54p::Htt513(Q15)::YFP::unc-45 3'UTR]. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.]
|
|
| EAK103 |
C. elegans |
eeeIs2. Show Description
eeeIs2 [unc-54p::Htt513(Q128)::YFP::unc-45 3'UTR]. Motility defect. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.]
|
|
| EG5389 |
C. elegans |
oxIs494 II; unc-119(ed3) III. Show Description
oxIs494 [peel-1p::GFP::peel-1 3'UTR + Cbr-unc-119(+)] II. GFP is expressed in the spermatogenic germline. During spermatogenesis, GFP remains in the residual body and is not packaged into sperm. Reference: Seidel HS, et al. PLoS Biol. 2011 Jul;9(7):e1001115.
|
|
| EG5767 |
C. elegans |
qqIr7 I; oxSi78 II; unc-119(ed3) III. Show Description
qqIr7 [peel-1(qq99)] I. oxSi78 [peel-1p::peel-1 (introns included)::GFP::peel-1 3'UTR + Cbr-unc-119(+)] II. Genetic background is a mixture of N2 and wild isolate EG4348. The oxSi78 insertion produces a PEEL-1::GFP translational fusion. PEEL-1::GFP is expressed in the spermatogenic germline and packaged into sperm. PEEL-1::GFP appears to localize to fibrous body-membranous organelles. PEEL-1::GFP does not rescue peel-1(qq99). Reference: Seidel HS, et al. PLoS Biol. 2011 Jul;9(7):e1001115.
|
|
| EG5801 |
C. elegans |
oxSi87 II; unc-119(ed3) III. Show Description
oxSi87 [peel-1p::N-terminal 12 amino acids of PEEL-1::GFP::peel-1 3'UTR + Cbr-unc-119(+)] II. GFP is expressed in the spermatogenic germline. During spermatogenesis, GFP is packaged into sperm. Reference: Seidel HS, et al. PLoS Biol. 2011 Jul;9(7):e1001115.
|
|