CA1421 |
C. elegans |
meIs8 dsb-2(ie58[dsb-2::AID::3xFLAG]) II; ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
|
|
CA1423 |
C. elegans |
meIs8 II; spo-11(ie59[spo-11::AID::3xFLAG]) ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
|
|
CA1472 |
C. elegans |
ieSi68 II; unc-119(ed3) III. Show Description
ieSi68 [sun-1p::TIR1::mRuby::htp-1 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing a modified Arabidopsis thaliana TIR1 tagged with mRuby in the germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
|
|
CB7080 |
C. elegans |
eEx754. Show Description
eEx754 [ilys-3p::ilys-3::mCherry::unc-54 3'UTR + sur-5p::GFP]. Pick GFP+ to maintain. Translational reporter for ilys-3. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.
|
|
CB7587 |
C. elegans |
ptr-15(gk5234) V; crEx498. Show Description
crEx498 [dpy-14p::ptr-15(+) + sur-5p::GFP]. Pick animals with nuclear GFP throughout body to maintain. Lethal ptr-15 deletion allele marked with pharyngeal GFP [loxP ::myo-2p::GFP::unc-54 3UTR + rps-27p::neoR::unc-54 3UTR::loxP]; lethality rescued by hypodermal expression of PTR-15 form crEx498 array. Non-nuclear GFP animals (only pharyngeal expression) will be dead eggs and dead hatchlings. Derived from parental strain VC4151. References: ORourke et al. (in revision 2024).
|
|
CER41 |
C. elegans |
unc-119(ed3) III; cerIs2. Show Description
cerIs2 [lsm-4p::lsm-4::GFP::lsm-4 3'UTR + unc-119(+)]. Reporter contains full-length lsm-4 tagged with GFP. GFP was inserted into a fosmid containing lsm-4. Ubiquitous nuclear GFP expression in somatic and germ cells under normal growth conditions. Cytoplasmic GFP accumulation after exposure to heat-shock. Reference: Cornes E, et al. RNA. 2015 Sep;21(9):1544-53.
|
|
CF4582 |
C. elegans |
muIs252 II; unc-119(ed3) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of wrmScarlet1-10 (under the control of the eft-3 promoter and unc-54 3'UTR). Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
CF4586 |
C. elegans |
muIs252 II; unc-119(ed3) III; vha-13(mu493[wrmScarlet11::vha-13]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::vha-13 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
CF4587 |
C. elegans |
muIs253 II; unc-119(ed3) III. Show Description
muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). [NOTE: A low level of "leaky" GFP expression from sfGFP1-10 is detected at high magnifications.] Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
CF4588 |
C. elegans |
muIs253 muIs252 II; unc-119(ed3) III. Show Description
muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 and wrmScarlet1-10 (both under the control of the eft-3 promoter and the unc-54 3'UTR). [NOTE: A low level of "leaky" GFP expression from sfGFP1-10 is detected at high magnifications.] Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
CF4592 |
C. elegans |
muIs253 II; unc-119(ed3) III; his-3(mu496[his-3::sfGFP11]) V. Show Description
muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). GFP11 tag inserted into endogenous his-3 locus via CRISPR/Cas9 insertion into parental strain CF4587. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
CF4594 |
C. elegans |
muIs252 II; unc-119(ed3) III; his-3(mu497[his-3::wrmScarlet11]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
CF4601 |
C. elegans |
muIs252 II; unc-119(ed3) III; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
CF4608 |
C. elegans |
muIs252 II; unc-119(ed3) III; his-3(mu500[his-3::wrmScarlet11(x3)]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11(x3) generated via CRISPR/Cas9 insertion of three wrmScarlet11 tags into the endogenous his-3 locus in parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
CF4610 |
C. elegans |
muIs257 I. Show Description
muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Muscle-specific expression of wrmScarlet1-10 (Under the control of the myo-3 promoter and unc-54 3'UTR). Generated using CRISPR/Cas9 in the SKI-LODGE strain WBM1126. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249
|
|
CF4611 |
C. elegans |
muIs257 I; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4610. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
CF4614 |
C. elegans |
muIs252 II; tbb-2(muIs260[wrmScarlet11::tbb-2]) unc-119(ed3) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11 inserted at the N-terminus of the endogenous tbb-2 locus; detectable in all somatic tissues where wrmScarlet1-10 is present. Figure 3B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
|
|
CF4616 |
C. elegans |
muIs252 II; unc-119(ed3) III; vha-13(muIs264[wrmScarlet11(x2)::vha-13]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Two tandem repeats of split-wrmScarlet11 inserted at the N-terminus of the endogenous VHA-13 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure 4A from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
|
|
CF4625 |
C. elegans |
muIs252 II; unc-119(ed3) III; tomm-20(muIs276[tomm-20::wrmScarlet11(MDELYK)]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11(MDELYK) inserted at the C-terminus of the endogenous TOMM-20 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure S6B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
|
|
CFJ191 |
C. elegans |
kstSi32 I; unc-119(ed3) III; kstEx45. Show Description
kstSi32 [Cbr-unc-119(kst13)] I. kstEx45 [hsp-16.41p::Cas9::gpd-2::TagRFP-T::smu-1 3'UTR + mlc-1p::mCherry + NeoR]. Pick mCherry+ to maintain. Unc. Cbr-unc-119(kst13) is a partial unc-119 used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Reference: El Mouridi S, et al. 2022.
|
|
CFJ192 |
C. elegans |
unc-119(ed3) III; kstSi37 IV; kstEx46. Show Description
kstSi37 [Cbr-unc-119(kst13)] IV. kstEx46 [hsp-16.41p::Cas9::gpd-2::TagRFP-T::smu-1 3'UTR + mlc-1p::mCherry + NeoR]. Pick mCherry+ to maintain. Unc. Cbr-unc-119(kst13) is a partial unc-119 used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Reference: El Mouridi S, et al. 2022.
|
|
CGC135 |
C. elegans |
let-7(umn45[let-7p::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.
|
|
CGC136 |
C. elegans |
mir-84(umn46[mir-84p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) X. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-84 pre-miRNA via CRISPR/CAS9. Left Flanking: GTTGAGACATGTATATGTTTTTGTT, Right Flanking: GCTACTATTCATCATACGTCTGCCT. sgRNA: ATTCATCATACGTCTGCCTG.
|
|
CGC137 |
C. elegans |
mir-241(umn47[mir-241p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) V. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-241 pre-miRNA via CRISPR/CAS9. Left Flanking: CTATTTTTTTCACTTGGATTAGGGG, Right Flanking: GGGATGCTCTTTTTGTACCAAACCG. sgRNA: CCTCAACTTTGACACCCCCG.
|
|
CGC152 |
C. elegans |
mir-48(umn59[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9. Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
|
|
CGC153 |
C. elegans |
mir-48(umn60[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::linker::mODC(422-461)(E428A/E430A/E431A):: lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9. Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
|
|
CGC159 |
C. elegans |
mir-61&mir-250(umn66[mir-61p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722]) II. Show Description
mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC has been removed, leaving the SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3'UTR transcriptional reporter in the locus
|
|
CGC162 |
C. elegans |
mir-266(umn69[mir-266p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
mScarlet replacement of mir-266 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-266 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
|
|
CGC164 |
C. elegans |
mir-271(umn71[mir-271p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
mScarlet replacement of mir-271 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-271 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
|
|
CGC166 |
C. elegans |
mir-784(umn73[mir-784p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272])]) X. Show Description
mScarlet replacement of mir-784 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-784 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
|
|
CGC168 |
C. elegans |
mir-787(umn75[mir-787p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272])]) X. Show Description
mScarlet replacement of mir-787 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-787 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
|
|
CGC170 |
C. elegans |
mir-788(umn77[mir-788p+SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-788 pre-miRNA via CRISPR/CAS9. Left Flanking: TCTGTGCGTATTACAAATTTTCAGCTGGAA, Right Flanking: GAATAGCAGTTTTCAAAATTGTGAGTTGCT. sgRNA: CTGCAAATGGAAGTTAGAAG.
|
|
CGC172 |
C. elegans |
mir-799(umn79[mir-799p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-799 pre-miRNA via CRISPR/CAS9. Left Flanking: ATTTTCTATTTATTGGTATAAAATATGTTA, Right Flanking: AAGAAGTACACTTCATATGCTCCTAACAAT. sgRNA: GTGAACCCTGATAAAGCTAG.
|
|
CGC177 |
C. elegans |
lin-4(umn84[lin-4p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type mScarlet+ GFP+, and segregate wild-type mScarlet+ GFP+, Lin-4 mScarlet+ non-GFP (umn84 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.
|
|
CGC180 |
C. elegans |
mir-82(umn87[mir-82p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-82 pre-miRNA via CRISPR/CAS9. Left Flanking: TATCATTCTCTCTACTACTAGTGAACTCAT, Right Flanking: TTATCAAGAAAATTCAAGAAAATTCAAAAG. sgRNA: CTGTAGATCACAGAGAAAAC.
|
|
CGC58 |
C. elegans |
C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
CGC59 |
C.elegans |
gnrr-7(umn3[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
CGC61 |
C. elegans |
F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
CGC72 |
C. elegans |
npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
CGC73 |
C. elegans |
npr-28(umn6[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATTTGGTATCATTTTTCTAGCCGACTTTC ; Right flanking sequence: TGGACTTGTTTTCACTCATCCCTGTACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
CGC78 |
C. elegans |
C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
CGC81 |
C. elegans |
C09F12.3(umn9[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
CL2179 |
C. elegans |
smg-1(cc546) I; dvIs179. Show Description
dvIs179 [myo-3p::GFP::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Superficially wild-type Roller; expression of GFP in body wall muscles increases with temperature. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
CL2337 |
C. elegans |
smg-1(cc546) I; dvIs38. Show Description
dvIs38 [myo-3p::GFP::degron::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Rollers. Temperature-dependent expression of aggregating GFP in body wall muscle (weak at 16C, strong at 25C). Animals become paralyzed if upshifted as larvae to 25C due to expression of aggregating GFP. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
CL2355 |
C. elegans |
smg-1(cc546) dvIs50 I. Show Description
dvIs50 [pCL45 (snb-1::Abeta 1-42::3' UTR(long) + mtl-2::GFP] I. Maintain at 16C. Pan-neuronal expresion of human Abeta peptide. Constitutive intestinal expression of GFP from marker transgene. Strain shows deficits in chemotaxis, associative learning, and thrashing in liquid. Strain also has incomplete sterility due to germline proliferation defects and embryonic lethality. Maintain at 16 C to reduce selection against transgene, although this does not alter the partial sterility. Reference: Wu Y., et al. J Neurosci. 2006 Dec 13;26(50):13102-13. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
CL2621 |
C. elegans |
smg-1(cc546) I; dvIs75. Show Description
dvIs75 [myo-3::Abeta 1-42 G37L::3' UTR(long) + mtl-2::GFP)]. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in ~32 hr if induced as L3 larvae. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
CL2659 |
C. elegans |
smg-1(cc546) I; dvIs770. Show Description
dvIs770 [myo-3::Abeta 1-42 wt::3' UTR(long) + mtl-2::GFP]. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in 18-24 hr if induced as L3 larvae. NOTE: dvIs770 was originally described as dvIs70 in Fonte et al, 2011. The name of this array was changed to dvIs770 to avoid confusion with dvIs70 [hsp-16.2p::GFP + rol-6(su1006)] carried in strain CL2070. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
CL4176 |
C. elegans |
smg-1(cc546) I; dvIs27 X. Show Description
dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Rollers. Temperature sensitive: needs to be propagated at 15C. Upshift larval animals to check that the worms get paralyzed and give offspring that arrest as eggs/early larvae. This strain produces low levels of beta amyloid peptide even when grown at low temperature, and therefore there is always some selection for loss of transgene copies. It is recommended to maintain growing stock plates at 15-16 degrees C by transferring small numbers of animals each generation rather than by "chunking", which increases the effective population size and therefore the chance of a relatively rare transgene loss, and then this revertant taking over the population. The strain should also be frozen shortly after being received. This strain can only be sent to academic users and not to commercial organizations. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
CL6049 |
C. elegans |
dvIs62 X. Show Description
dvIs62 [snb-1p::hTDP-43/3' long UTR + mtl-2p::GFP] X. Temperature-sensitive. Maintain at 16 to minimize selection against transgene. Uncoordinated from hatching; phenotype is stronger at higher temperatures. Intestinal GFP expression. Reference: Ash PE, et al. Hum Mol Genet. 2010 Aug 15;19(16):3206-18.
|
|
CL6180 |
C. elegans |
smg-1(cc546) I; dvIs19 III; skn-1(zu67)/nT1 [unc-?(n754) let-?] (IV;V); dvIs27 X. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Roller with weak constitutive GFP expression. Balanced strain, segregates Rol Uncs [skn-1(zu67) heterozygotes], Rol nonUncs [skn-1(zu67) homozygotes] and dead eggs. Maintain by picking Rol Uncs. Paralyzed if upshifted as larvae to 25C. References: Dostal, V and Link CD (2010) J Vis Exp. Oct 9;(44). Dostal V, Roberts CM, Link CD (2010) Genetics Nov;186(3):857-66. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|