More Fields
Strain Species Genotype
NL244 C. elegans nhr-2(pk43::Tc1) mut-2(r459) I. Show Description
Dpyish.
NL245 C. elegans mut-2(r459) I; elt-2(pk46::Tc1) X. Show Description
Insertion in GGTCAAACG TA AGTTAAAGT.
NL4000 C. elegans sma-1(e30) V. NL subclone of CB4000. Show Description
NL subclone of CB4000. High Tc1 copy number strain. See WBG 14(4): 16-17.
NL4609 C. elegans C27H5.7(pk1745) II. Show Description
Right flanking sequence of Tc1: 5'-TATATTCCAGAAA.
NL706 C. elegans mut-2(r459) cap-1(pk56::Tc1) I. Show Description
NL708 C. elegans mut-2(r459) I; cct-1(pk58::Tc1) II. Show Description
TTCTCACA TA ATTCCGATCT. Somewhat Dpyish.
NL728 C. elegans cey-1(pk81) II. Show Description
Tc1 allele.
NL735 C. elegans unc-2(pk95::Tc1) X. Show Description
NL742 C. elegans rskn-1(pk209::Tc1) mut-2(r459) I. Show Description
Dpyish. Primers used to isolate pk209 are: cgatcctcgacagtttgaactgc & cgagattcagggcatgtctatgc.
NW1613 C. elegans msh-2(ev679::Tc1) I. Show Description
Reduced fertility. Reduced long-term survival. Mutator phenotype. DNA damage-induced apoptosis in the germ line. No effect on lifespan or meiotic chromosome disjunction observed.
RC301 C. elegans Show Description
Reference WBG 9(3) 29 and 10(2) 140-141. npr-1 pka bor-1. Caenorhabditis elegans wild isolate (Tc1 pattern HCF).
RM2209 C. elegans ric-8(md1909) IV. Show Description
Poor growth and fertility at 25C. Grows well at 20C and is more fertile than ric-8(md303). Degree of aldicarb resistance is similar to md303 but locomotion rate is greater than md303 and embryonic lethality is only 19%, versus 29% for md303. Contains a Tc1 transposon insertion in the middle of the ric-8 coding sequence.
RW6999 C. elegans Show Description
Caenorhabditis elegans wild isolate. RW subclone of Bergerac BO (Tc1 pattern HCA).
RW7000 C. elegans Show Description
PCR STS mapping standard strain. Caenorhabditis elegans wild isolate. RW subclone of Bergerac BO (Tc1 pattern HCA).
RW7097 C. elegans mut-6(st702) unc-22(st192st527) IV. Show Description
Mutator stock, carrying Tc1 induced revertant of a Tc1 induced unc-22 allele. Do not maintain by passaging.
SF1 C. elegans odc-1(pc13::Tc1) V. Show Description
Made by PCR screen of Tc1 transposon insertion library. odc-1(pc13::Tc1) has a partial deletion of the Tc1 element. Phenotypically it has 35% reduction in brood size compared to the WT N2 Bristol strain.
TR388 C. elegans Show Description
Wild type. Low Tc1 copy number. Isolated in Madison, WI. Caenorhabditis elegans wild isolate (Tc1 pattern I?).
TR389 C. elegans Show Description
Wild type. Low copy Tc1 number. Isolated in Madison, WI. Caenorhabditis elegans wild isolate (Tc1 pattern I?).
TR403 C. elegans Show Description
A wild type C. elegans virtually indistinguishable from N2. Males mate with high efficiency, unlike Bergerac. High copy number of Tc1 elements. Active for Tc1 transposition and excision. Not temperature sensitive for growth (unlike Bergerac). See also WBPaper00001053 and WBG 10(2) 140-141 and 11(5) 60. Collected from soil in Madison, WI. Caenorhabditis elegans wild isolate (Tc1 pattern HCD).