nIs51 [egl-10(+) + lin-15(+)] X. Egl-C, Bor, hyperforaging, hyperactive locomotion, and male longevity and mating reduced. By Western blotting and staining the EGL-10 protein is highly overexpressed relative to N2. nIs51 was generated by injecting the lin-15 rescuing plasmid pEK1 at 50 ug/ml and the egl-10 rescuing fragment pMK21 at 80 ug/ml into MT1642 lin-15(n765) worms. The resulting strain was gamma irradiated and an integrant isolated, and was backcrossed to N2 four times. nIs51 was mapped to the right arm of X.

Suppressor of ced-9(n1950n2161) maternal effect lethality.

Medium strong allele. Suppressor of ced-9(n1950n2161) maternal effect lethality.

Medium-strong alllele; suppresses of ced-9(n1950 n2162) maternal effect lethality. Reference: (1999) Genetics 153(4):1655-71.

Suppressor of ced-9(n1950n2161) maternal effect lethality. Strong allele of ced-3.

Suppressor of ced-9(n1950n2161) maternal effect lethality.

Serotonin hypersensitive. Isolated as a 1688 bp deletion. Backcrossed 6 times using PCR as the assay to follow mutant chromosome. 5-HT hypersensitivity phenotype does segregate after 6 backcrosses. Hyperslowing in locomotion assay as well.

C. elegans var Bristol. Generation time is about 3 days. Brood size is about 350. Also CGC reference 257. Isolated from mushroom compost near Bristol, England by L.N. Staniland. Cultured by W.L. Nicholas, identified to genus by Gunther Osche and species by Victor Nigon; subsequently cultured by C.E. Dougherty. Given to Sydney Brenner ca. 1966. Subcultured by Don Riddle in 1973. Caenorhabditis elegans wild isolate. DR subclone of CB original (Tc1 pattern I). [NOTE: This stock might carry a ~1.8 kb deletion in alh-2 in the background. (UPDATE: 03/26/2018 - a user reported the stock they received was homozygous for the alh-2(ot588) mutation.)]

WT C. elegans. From Cambridge collection-originally frozen around 1968: In 1980, in order to establish an ancestral stock, Jonathan Hodgkin thawed one of the earliest frozen tubes of N2, dating from 1968. From this plate J.H. grew up a population en masse (without subculturing) on NGM plates (about 2 generations). Multiple samples of this were frozen in order to provide a reference N2 stock. This set of stock samples was replenished by regrowth in 1985 and 1991, using the same procedure, and a freshly thawed sample was sent to the CGC in 1993. Thus, samples from this frozen stock, called N2 (ancestral), should be only about 6 generations away from the stock used by Sydney Brenner as his standard WT N2. [Isolated from mushroom compost near Bristol, England by L.N. Staniland. Cultured by W.L. Nicholas, identified to genus by Gunther Osche and species by Victor Nigon; subsequently cultured by C.E. Dougherty. Given to Sydney Brenner ca. 1966.] Caenorhabditis elegans wild isolate. Note: N2 (ancestral) has reduced lifespan and fertility relative to the standard CGC N2 strains. See Worm Breeder's Gazette 16(5): 24 (February 1,2001).

C. elegans var Bristol. Self-fertilizing hermaphrodite. Generation time is about 3.5 days at 20C. Male stock maintained by mating. Also CGC reference 257. Isolated from mushroom compost near Bristol, England by L.N. Staniland. Cultured by W.L. Nicholas, identified to genus by Gunther Osche and species by Victor Nigon; subsequently cultured by C.E. Dougherty. Given to Sydney Brenner ca. 1966. Subcultured by Don Riddle in 1973. Caenorhabditis elegans wild isolate. DR subclone of CB original (Tc1 pattern I). [NOTE: (09/07/2018) The Gems Lab has identified a mutation in the gene fln-2 carried in this stock causing an increased lifespan. The effect is quite modest (+11%, median lifespan), but this effect can be more pronounced in other genetic backgrounds.] [NOTE: (03/26/2018) - a user reported the stock they received was homozygous wild-type for alh-2; some N2 stocks carry the ot588 mutation in alh-2.)

5% of the wild type b-glucuronidase activity.

Bacteria. Jim Lewis received this E. coli strain from Henry Epstein in 1977. It is a prototroph and the worms grow well on it in liquid, even when the bacteria are highly labeled with 35-S. It hasn't been tested to see if it is temperature sensitive. It should be distributed as "Jim Lewis' NA22" until it has been confirmed that this is a certified version of NA22. Biosafety Level: BSL-1.

Undectectable levels of b-glucuronidase activity. Limp paralysed phenotype at all stages. Larvae can move slightly more than adults. Egl.

Intragenic revertant restoring to almost WT level of b-glucuronidase activity. Throws males.

Reduced apoptosis after gamma-ray treatment compared to N2. Double mutant exhibits hypersensitivity to gamma rays similar to brc-1(tm1145) alone. Reference: Ryu JS, et al; PLoS One. (In Press).

Double mutant is less sensitive to ionizing radiation than the parg-2(ok980) single mutant, but as sensitive as the exo-1(tm1842) single mutant. Parental parg-2(ok980) strain outcrossed 6 times; parental exo-1(tm1842) strain outcrossed 4 times. Reference: Bae W, et al. Hypersensitivity to DNA double-strand breaks associated with PARG deficiency is suppressed by exo-1 and polq-1 mutations in Caenorhabditis elegans. The FEBS Journal, In press.

Hypersensitivity to ionizing radiation due to the parg-2(ok980) mutation is rescued by the polq-1(tm2572) mutation.  The double mutant is as sensitive as the wild-type to ionizing radiation. Parental parg-2(ok980) strain outcrossed 6 times; parental polq-1(tm2572) strain outcrossed 5 times. Reference: Bae W, et al. Hypersensitivity to DNA double-strand breaks associated with PARG deficiency is suppressed by exo-1 and polq-1 mutations in Caenorhabditis elegans. The FEBS Journal, In press.

otIs181[dat-1::mCherry + ttx-3::mCherry] III. otIs138[ser-2(prom3)::GFP + rol-6(su1006)] X. otIs396 [ace-1prom2::NLS::tagRFP]. Rollers. dat-1::mCherry labels ADE, CEP, and PDE neurons. ttx3::mCherry labels AIY neurons. ser-2(prom3)::GFP labels OLL, PDE, and PVD neurons. ace-1prom2::NLS::tagRFP labels CEP and OLL neurons. PVD can be identified by expression only GFP. An additional pair of GFP-only cells anterior to OLL are occasionally observed in this strain. Can be used to isolate PVD by FACS (green-only). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). Reference: Barbara O’Brien (2017) Diverse genetic and transcriptional programs mediate dendritic development of a nociceptor neuron. Ph.D Dissertation, Vanderbilt University. (https://ir.vanderbilt.edu/handle/1803/14489?show=full)

Low penetrance (about 25%) embryonic lethality and reduced brood size. wsp-1(gm324) is an N-terminal deletion that exhibits no observable mRNA or protein.

Unc and scrawny, but viable. Egl. Class II egl-15 mutation. Lethality suppressed by let-60.

ay75gf: ts dominant Clr, Sterile; Dominant sterile at 25C, fertile at 15C, severely reduced fertility at 20C. At 15C, ay75gf: recessive adults Clr, partially penetrant Muv. At 15C, heterozygotes segregate 50% WT, 25% Dpy, and 25% adult Clear.

Abnormal body shape. Unc. Severity of phenotype: rh326 > rh80 > rh148.

Abnormal body shape. Unc. Severity of phenotype: rh326 > rh80 > rh148.

Abnormal body shape. Unc. Severity of phenotype: rh326 > rh80 > rh148.

qyIs127 [lam-1p::lam-1::mCherry + unc-119(+)] V. qyIs166 [cdh-3p::GFP::CAAX + unc-119(+)] X. Temperature-sensitive sterile; maintain at 20C or lower for optimum fertility. Increased sensitivity to RNAi when compared to wild-type animals. lam-1p::lam-1::mCherry expression can be weak and variable. Reference: Kelley, LC, et al. Developmental Cell. 2019 Feb 11;48(3):313-328.e8.

CRISPR/Cas9 insertion of mNeonGreen tag into endogenous let-60 locus. Fairly high penetrance of L1 rod-like lethality. Reference: Jayadev et al. 2023. Post-embryonic endogenous expression and localization of LET-60/Ras in C. elegans. microPublication Biology. 10.17912/micropub.biology.000931.

pkEx467 [acy-2(+) + rol-6(su1006)]. pk465 was isolated from a chemical deletion library and has a deletion of the first catalytic domain and the two multiple transmembrane regions of the predicted ACY-2 protein. The phenotype of pk465 is early larval lethality. The lethal phenotype of pk465 is rescued in NL1242 by a transgene containing WT acy-2 (cosmid C10F3) and rol-6.

pk690 is a deletion allele within the gene C32E8.7. The deletion is stable in the homozygous state and has no obvious phenotype. Can verify the presence/homozygosity of the deletion by PCR using the following primers: AL1: 5'-CGACGACACTCCATTATTCC-3' AR1: 5'-CCAGTCCTGCAAAAATGCTC-3'. A product of about 3.7 kb is obtained from WT worms, while a product of about 1 kb is obtained from NL2003 worms. The deletion has been sequenced and covers position -354 to +2276.

Homozygous rrf-3 deletion allele. Increased sensitivity to RNAi when compared to WT animals. Deletion sequence (deletion in lower case letters, flanking undeleted sequence in capital letters): TGCACATATTctacagaatt ------- --------tacccgattaAATGGACAATT (from Plasterk Lab 11/05).

pkEx170 [gpb-1(+) + rol-6(su1006)]. Rollers. Pick Rollers to maintain. NL361 is homozygous for the gpb-1 deletion allele pk44; this results in an L1 arrest if the larvae has maternally derived GPB-1 or in an early embryonic lethality if there is no maternally derived GPB-1 for the developing embryo. This phenotype is rescued by the extrachromosomal transgene which contains the WT gpb-1 gene.

CRISPR-engineered deletion removing entire cdc-7 gene. Out-crossed 3x to N2. Reference: Currey HN & Liachko NF. 2019. A CRISPR/Cas9-generated cdc-7 loss of function mutation does not cause temperature-dependent fertility defects. microPublication Biology. Jan 3;2019:10.17912.

jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Reduced SNB-1::GFP localization to synaptic regions; slighty Dpy. js410 has linked phenotype of reduced brood size. js410 is an R->Stop at aa 235. snb-1::GFP is expressed in mechanosensory neurons visible in the cell body and in the axon (very low levels). GFP puncta absent from the ventral nerve cord due to rpm-1 lesion.

jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Reduced SNB-1::GFP localization to synaptic regions; slighty Dpy. js317 is a W->Stop at aa 861. snb-1::GFP is expressed in mechanosensory neurons visible in the cell body and in the axon (very low levels). GFP puncta absent from the ventral nerve cord due to rpm-1 lesion.

Reduced fertility. Reduced long-term survival. Mutator phenotype. DNA damage-induced apoptosis in the germ line. No effect on lifespan or meiotic chromosome disjunction observed.

Null allele. Enhances sensory ray fusion defect of mab-20(bx61). No fusions as single. Some embryonic and larval lethality.

muIs32 [mec-7p::GFP + lin-15(+)]. Extensive ray fusion. Body morphology defects at larval stages. Embryonic and larval lethality.

GFP tag inserted into endgonenous par-2 locus in an analogue-sensitive background. pkc-3(crk77[I331A,T394A]) is a CRISPR-engineered analog-sensitive allele containing both I331A (gatekeeper site) and T394A (suppressor site) mutations, allowing rapid and reversible chemical inhibition of PKC-3 activity. Reference: Ng K, et al. (2022). An analog sensitive allele permits rapid and reversible chemical inhibition of PKC-3 activity in C. elegans. Reference: Ng K, et al. microPublication Biology. 10.17912/micropub.biology.000610

Maintain at 15-20C. Temperature-sensitive embryonic lethality at 25C: approximately 60% of embryos fail to hatch. Reference: Peel N, et al. PLoS Genet. 2017 Jan 19;13(1):e1006543. doi: 10.1371/journal.pgen.1006543. PMID: 28103229.

Phenotypically wild-type for brood size, viability, Dyf and male mating efficiency. Strain OC306 is identical to OC422: the same out-crossed stock was frozen down twice in lab stocks. Reference: Chawla DG, et al. Biol Open. 2016 Sep 15;5(9):1290-8. doi: 10.1242/bio.017442. PMID: 27635036

Phenotypically wild-type for brood size, viability, Dyf and male mating efficiency. Reference: Chawla DG, et al. Biol Open. 2016 Sep 15;5(9):1290-8. doi: 10.1242/bio.017442. PMID: 27635036

Phenotypically wild-type for brood size, viability, Dyf and male mating efficiency. Reference: Chawla DG, et al. Biol Open. 2016 Sep 15;5(9):1290-8. doi: 10.1242/bio.017442. PMID: 27635036

Phenotypically wild-type for brood size, viability, Dyf and male mating efficiency. Reference: Chawla DG, et al. Biol Open. 2016 Sep 15;5(9):1290-8. doi: 10.1242/bio.017442. PMID: 27635036

Analog-sensitive allele generated by CRISPR/Cas9 engineering of the endogenous plk-1 locus. Engineered mutations confer sensitivity to 1-NM-PP1 for drug inhibition of plk-1. gRNA sequences: GGACGATTTTTGGGCAAGGG & TCTCAACGTGTATATCACTT Reference: Gomez-Cavazos JS, et al. Curr Biol. 2020 Aug 17;30(16):3101-3115.e11. doi: 10.1016/j.cub.2020.05.090 PMID: 32619481.

mNeonGreen and Flag tags inserted at 5' end of endogenous cyb-3 locus using CRISPR/Cas9 engineering. Strain has lethality and brood size defects. gRNA sequence: tgaagtcaggtcgacattct Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. K957M mutation introduced into the endogenous ogt-1 locus using CRISPR/Cas9; Sanger sequence confirmed. The K957M mutation ablates the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. gpdh-1p::GFP reporter is induced in the hypodermis and intestines during hypertonic stress. col-12p::GFP is constitutively expressed in the hypodermis. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

K957M mutation introduced into the endogenous ogt-1 locus tagged with C-terminal GFP. The K957M mutation ablates the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. OGT-1(K957M)::GFP is expressed ubiquitously in somatic tissues with a nuclear localization. Sanger sequence confirmed. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. H612A mutation introduced into the endogenous ogt-1 locus using CRISPR/Cas9; Sanger sequence confirmed. The H612A mutation decreases, but does not completely ablate, the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. gpdh-1p::GFP reporter is induced in the hypodermis and intestines during hypertonic stress. col-12p::GFP is constitutively expressed in the hypodermis. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. H612A mutation introduced into the endogenous ogt-1 locus tagged with C-terminal GFP. OGT-1(H612A)::GFP is expressed ubiquitously in somatic tissues with a nuclear localization. The H612A mutation decreases, but does not completely ablate, the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. Sanger sequence confirmed. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. TPR domain deleted in the endogenous ogt-1 locus using CRISPR/Cas9; Sanger sequence confirmed. The TPR domain deletion (128 aa - 583 aa) ablates the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. Defective gpdh-1p::GFP induction in the hypodermis and intestine during hypertonic stress. Constitutive col-12p::DsRed expression. Impaired adaptation to hypertonic stress. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

TPR domain deleted in the endogenous ogt-1 locus tagged with C-terminal GFP. The TPR domain deletion spans 128 aa - 583 aa. OGT-1(delta-TPR)::GFP is expressed ubiquitously in somatic tissues with a nuclear localization. The TPR domain deletion ablates the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. Sanger sequence confirmed. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.