LP869 |
C. elegans |
cpSi171 I. Show Description
cpSi171 [vha-8p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in multiple tissues including intestine, hypodermis, and excretory cell.
|
|
LP870 |
C. elegans |
cpSi172 I. Show Description
cpSi172 [myo-2p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in the pharynx.
|
|
LP871 |
C. elegans |
cpSi174 I. Show Description
cpSi174 [myo-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in body wall muscle.
|
|
MLC1065 |
C. elegans |
pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous pash-1 tagged with the auxin-inducible-degron (AID) peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
|
|
MLC1245 |
C. elegans |
drsh-1(luc82[myc::AID::3XFLAG::4xGGSG::drsh-1::4xGGSG::3XFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID) peptide. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
|
|
MLC1726 |
C. elegans |
drsh-1(luc82[myc::AID::3XFLAG::4xGGSG::drsh-1::4xGGSG::3XFLAG::AID::myc]) pash-1(luc71[pash-1::2xGGSG::3XFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID) peptide. Endogenous pash-1 tagged with the AID peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germ line. Animals are superficially wild-type, addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
|
|
MLC1729 |
C. elegans |
drsh-1(luc82[myc::AID::3XFLAG::4xGGSG::drsh-1::4xGGSG::3xFLAG::AID::myc]) pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV; lucIs20; lucIs24. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID) peptide. Endogenous pash-1 tagged with the AID peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germline. In addition, strain expresses mirtron-versions of mir-35 and mir-51, which are processed independently of Drosha and Pasha. miRNA biogenesis can be stringently inhibited via simultaneous removal of Drosha and Pasha, causing absence of all canonical miRNAs and embryonic lethality upon Auxin treatment. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
|
|
MQD2356 |
C. elegans |
hqSi8 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
hqSi8 [rgef-1p::TIR1::mRuby::unc-54 3UTR+Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi8 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the rgef-1 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the neurons.
hqSi8 previously known as hq373. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
MQD2374 |
C. elegans |
ieSi61 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
ieSi61 [ges-1p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the intestine. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the intestine.
Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
MQD2375 |
C. elegans |
daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3' UTR + Cbr-unc-119(+)] IV. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the germ line.
|
|
MQD2378 |
C. elegans |
hqSi9 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
hqSi9 [dpy-7p::TIR1::mRuby::unc-54 3UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi9 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the dpy-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the hypodermis.
hqSi9 previously known as hq374. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
MQD2379 |
C. elegans |
hqSi10 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
hqSi10 [myo-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi10 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the myo-3 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the body wall muscles.
hqSi10 previously known as hq375. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
MQD2383 |
C. elegans |
hqSi11 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
hqSi11 [lim-7p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi11 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the lim-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the gonadal sheath.
hqSi11 previously known as hq378. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
MQD2453 |
C. elegans |
ieSi57 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in somatic tissues. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
MQD2491 |
C. elegans |
daf-16(hq389[daf-16::gfp::degron]) I; ieSi57 II; daf-2(e1370) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering.This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in somatic tissues. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
MQD2492 |
C. elegans |
daf-16(hq389[daf-16::gfp::degron]) I; hqSi8 II; daf-2(e1370) unc-119(ed3) III. Show Description
hqSi8 [rgef-1p::TIR1::mRuby::unc-54 3UTR+Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi8 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the rgef-1 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the neurons. hqSi8 previously known as hq373. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
MQD2493 |
C. elegans |
daf-16(hq389[daf-16::gfp::degron]) I; hqSi9 II; daf-2(e1370) unc-119(ed3) III. Show Description
hqSi9 [dpy-7p::TIR1::mRuby::unc-54 3UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi9 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the dpy-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the hypodermis.
hqSi9 previously known as hq374. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
MQD2494 |
C. elegans |
daf-16(hq389[daf-16::gfp::degron]) I; ieSi61 II; daf-2(e1370) unc-119(ed3) III. Show Description
ieSi61 [ges-1p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering.This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the intestine. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
MQD2498 |
C. elegans |
daf-16(hq389[daf-16::gfp::degron]) I; daf-2(e1370) unc-119(ed3) III; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3' UTR + Cbr-unc-119(+)] IV. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering.This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the germ line. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
MQD2499 |
C. elegans |
daf-16(hq389[daf-16::gfp::degron]) I; hqSi10 II; daf-2(e1370) unc-119(ed3) III. Show Description
hqSi10 [myo-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi10 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the myo-3 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the body wall muscles.
hqSi10 previously known as hq375. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
MQD2500 |
C. elegans |
daf-16(hq389[daf-16::gfp::degron]) I; hqSi11 II; daf-2(e1370) unc-119(ed3) III. Show Description
hqSi11 [lim-7p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi11 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the lim-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the gonadal sheath.
hqSi11 previously known as hq378. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
OH13988 |
C. elegans |
ieSi57 II; unc-3(ot837[unc-3::mNeonGreen::AID]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. The endogenous unc-3 locus is tagged with mNeonGreen and AID degron. mNeonGreen expression is seen in the cholinergic motor neurons, command interneurons, and ASI. Reference: Patel T & Hobert O. eLife 2017.
|
|
OH14125 |
C. elegans |
daf-16(ot853[daf-16::linker::mNeonGreen::3xFlag::AID]) I. Show Description
mNeonGreen tag inserted into endogenous daf-16 locus; AID at 3' end of mNeonGreen. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin, allowing conditional knock-down of daf-16 expression. Reference: Bhattacharya et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. PMID: 30686580
|
|
OH14654 |
C. elegans |
daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID]) I; daf-2(e1370) III. Show Description
Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID conditional daf-16 allele in daf-2(e1370) background (TIR1-less control). Reference: Aghayeva et al., submitted
|
|
OH14888 |
C. elegans |
daf-16(ot853[daf-16::mNG::3xFlag::AID]) I; ieSi57 II; daf-2(e1370) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID conditional daf-16 allele in daf-2(e1370) background with ubiquitous TIR1 expression. Reference: Aghayeva et al., submitted
|
|
OH14897 |
C. elegans |
daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID]) I; ieSi60 II; daf-2(e1370) III. Show Description
ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR] II. Temperature sensitive dauer constitutive. Maintain at 15C. Pharyngeal muscle-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted
|
|
OH14945 |
C. elegans |
daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID]) I; ieSi61 II; daf-2(e1370) III. Show Description
ieSi61[ges-1p::TIR1::mRuby + unc-119(+)] II. Temperature sensitive dauer constitutive. Maintain at 15C. Intestine-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted
|
|
OH14946 |
C. elegans |
ieSi57 II; daf-7(e1372) III; daf-3(ot877[daf-3::TagRFP-T::3xFlag::AID]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID conditional daf-3 allele in daf-7(e1372) background with ubiquitous TIR1 expression. Reference: Aghayeva et al., submitted
|
|
OH14984 |
C. elegans |
daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP::AID]) X. Show Description
Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID conditional daf-12 allele in daf-7(e1372) background (TIR1-less control). Reference: Aghayeva et al., submitted
|
|
OH14986 |
C. elegans |
ieSi57 II; daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP-T::AID]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID conditional daf-12 allele in daf-7(e1372) background with ubiquitous TIR1 expression. Reference: Aghayeva et al., submitted
|
|
OH14989 |
C. elegans |
ieSi60 II; daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP-T::AID]) X. Show Description
ieSi60 [myo-2p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. Pharyngeal muscle-specific depletion of DAF-12 in the presence of auxin. Reference: Aghayeva et al., submitted
|
|
OH15845 |
C. elegans |
daf-16(ot853[daf-16::mNG::AID]) I; daf-2(e1370) III; otIs730. Show Description
otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted
|
|
OH15913 |
C. elegans |
daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP::AID]) X; otIs730. Show Description
otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-12 in the presence of auxin. Reference: Aghayeva et al., submitted
|
|
OH16508 |
C. elegans |
daf-16(ot975[daf-16::mNeptune2.5::3xFlag::AID]) I; daf-2(e1370) III; otIs730. Show Description
otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted
|
|
OH17582 |
C. elegans |
daf-16(ot853[daf-16::mNG::AID]) I; otSi2 II; daf-2(e1370) III. Show Description
otSi2 [ges-1p::TIR1(F79G)::mRuby::unc-54 3'UTR + Cbr-unc-119(+) *ieSi61] II. Temperature-senstive daf(c): maintain at 15C. Intestine-specific TIR1 sequence in ieSi61 allele was edited to TIR1(F79G) using CRISPR/Cas9 to make it compatible with AID2. [TCC GTC GAG CTC AAG GGA AAG CCA CAC TTC] edited to [AGT GTC GAA TTG AAG GGA AAG CCA CAC GGA]. This strain can be used to deplete DAF-16 specifically from the intestine with the modified auxin 5-Ph-IAA. Constitutive dauer formation at 25 C due to daf-2(e1370). Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https://doi.org/10.1101/2025.01.06.631508.
|
|
OH19078 |
C. elegans |
daf-16(ot853[daf-16::mNG::AID]) I; otIs908 V. Show Description
otIs908 [pha-4prom2::TIR1(F79G)::mTur2::tbb-2 3 UTR + unc-122p::mCherry::unc-54 3' UTR] V. TIR1(F79G) expression in all 22 enteric neurons (20 pharyngeal neurons, AVL and DVB), RIS and PVT. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https://doi.org/10.1101/2025.01.06.631508.
|
|
OH19232 |
C. elegans |
daf-16(ot853[daf-16::mNG::AID]) I; otSi2 II. Show Description
otSi2 [ges-1p::TIR1(F79G)::mRuby::unc-54 3'UTR + Cbr-unc-119(+) *ieSi61] II. Intestine-specific TIR1 sequence in ieSi61 allele was edited to TIR1(F79G) using CRISPR/Cas9 to make it compatible with AID2. [TCC GTC GAG CTC AAG GGA AAG CCA CAC TTC] edited to [AGT GTC GAA TTG AAG GGA AAG CCA CAC GGA]. This strain can be used to deplete DAF-16 specifically from the intestine with the modified auxin 5-Ph-IAA. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https://doi.org/10.1101/2025.01.06.631508.
|
|
PHX6129 |
C. elegans |
ieSi57 II; Y47D3A.21(syb6129[GFP::AID:::3Xflag::3xGAS::Y47D3A.21]) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. GFP, AID, 3xFLAG, and 3xGAS tags inserted into endogenous Y47D3A.21 locus. Reference: Sharma N, et al. bioRxiv [Preprint]. 2024 Jan 19:2024.01.16.575916. doi: 10.1101/2024.01.16.575916. PMID: 38293206.
|
|
PX627 |
C. elegans |
fxIs1 I; spe-44(fx110[spe-44::degron]) IV. Show Description
fxIs1 [pie-1p::TIR1::mRuby, I:2851009] I. Auxin-inducible spermatogenesis arrest, resulting in hermaphrodite self-sterility. Degron tag was inserted into the endogenous spe-44 locus. Reference: Kasimatis KR, et al. (2018) Auxin-Mediated Sterility Induction System for Longevity and Mating Studies in Caenorhabditis elegans. BioRvix. doi: https://doi.org/10.1101/284232.
|
|
PX629 |
C. elegans |
fxIs1 I; spe-44(fx110[spe-44::degron]) IV; him-5(e1490) V. Show Description
fxIs1 [pie-1p::TIR1::mRuby, I:2851009] I. Auxin-inducible spermatogenesis arrest, resulting in hermaphrodite self-sterility and reversible male sterility. Him: males produced at ~30%. Degron tag was inserted into the endogenous spe-44 locus. Reference: Kasimatis KR, et al. (2018) Auxin-Mediated Sterility Induction System for Longevity and Mating Studies in Caenorhabditis elegans. BioRvix. doi: https://doi.org/10.1101/284232.
|
|
RAF2181 |
C. elegans |
ieSi57 II; daf-2(bch-40[degron::3xFLAG::STOP::SL2::SV40::degron::wrmScarlet::egl-13NLS]) unc-119(ed3) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Degron tag inserted into endogenous daf-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Venz R, et al. Elife. 2021 Sep 10;10:e71335. doi: 10.7554/eLife.71335. PMID: 34505574.
|
|
RJP5296 |
C. elegans |
reSi7 I; unc-31(rp166[GFP::TEV::AID::FLAG::unc-31]) IV. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor with N-terminal GFP::TEV::degran::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9 can be used for conditional depletion of UNC-31 in the nervous system. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635
|
|
TV28592 |
C. elegans |
bmdSi339 I; bmdSi297 II; arx-2(wy1814[arx-2::mIAA7::mNG]) qyIs225 V; lam-2(qy20[lam-2::mNG]) X. Show Description
bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. mNG tags inserted into endogenous arx-2 and lam-2 loci. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.
|
|
TV28593 |
C. elegans |
bmdSi339 I; bmdSi297 II; arx-2(wy1815[arx-2::AID::mNG]) qyIs225 V; lam-2(qy20[lam-2::mNG]) X. Show Description
bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. AID and mNG tags inserted into endogenous arx-2 locus. mNG tag inserted into endogenous lam-2 locus. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.
|
|
WBM1204 |
C. elegans |
raga-1(wbm40[raga-1::AID::EmGFP]) II. Show Description
Auxin-inducible degron (AID) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Can be used in conjunction with tissue-specific TIR1-expressing lines to degrade RAGA-1 protein via the Auxin Inducible Degron system. Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https://doi.org/10.1371/journal.pgen.1010938. PMID: 37721956.
|
|
WBM1250 |
C. elegans |
raga-1(wbm40[raga-1::AID::EmGFP]) II; wbmIs83 IV. Show Description
wbmIs83 [rab-3p::3xFlag::TIR1::rab-3 3'UTR] *wbmIs66 IV. Auxin-inducible degron (AID) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Neuronal-specific expression of TIR1 allows for auxin-inducible degradation of RAGA-1 in the nervous system. wbmIs66 [rab-3p::3XFLAG::dpy-10 crRNA::rab-3 3'UTR] (IV:5015000). Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https://doi.org/10.1371/journal.pgen.1010938. PMID: 37721956.
|
|
WBM1438 |
C. elegans |
ieSi57 raga-1(wbm40[raga-1::AID::EmGFP]) II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Auxin-inducible degron (AID) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Somatic expression of TIR1 allows for auxin-inducible degradation of RAGA-1 in the soma. Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https://doi.org/10.1371/journal.pgen.1010938. PMID: 3772195
|
|
WBM1481 |
C. elegans |
let-363(wbm46[AID::let-363]) I. Show Description
Auxin-Inducible Degron (AID) tag was inserted into the endogenous let-363 coding sequence via CRISPR/Cas9. This strain can be combined with TIR1-expressing strains to induce degradation of LET-363. Reference: Smith HJ, et al. PLoS Genetic. 2023 Sep 18;19(9):e1010938. doi: 10.1371/journal.pgen.1010938. PMID: 37721956.
|
|