More Fields
Strain Species Genotype
SD1894 C. elegans gaIs286. Show Description
gaIs286 [unc-62(7b)::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. A STOP-codon was inserted into exon 7a of unc-62 to generate an UNC-62(7b)-specific reporter. Recombineered fosmid was integrated by biolistic bombardment to produce strain OP602, which wa outcrossed to produce SD1894. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
SD1898 C. elegans glo-4(ok623) V; gaIs286. Show Description
gaIs286 [unc-62(7b)::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. A STOP-codon was inserted into exon 7a of unc-62 to generate an UNC-62(7b)-specific reporter. Recombineered fosmid was integrated by biolistic bombardment to produce strain OP602, which wa outcrossed to produce SD1894. glo-4(ok623) causes a a partially-penetrant Dpy phenotype. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org). Derived from parental strains RB811 and SD1894.
SSM289 C. elegans mre-11(iow45[mre-11::gfp::3xflag]) V. Show Description
Homozygous gfp and 3xflag C’ terminal tag inserting just before the STOP codon of mre-11. The strain is fertile and contains wild type germline (examined by DAPI). GFP is expressed in all germline nuclei. Maintain the strain by picking worms at 20C, no selection required. gfp::3xflag was added by CRISPR/Cas9 using pDD282-based vector. Reference: Reichman R, et al. Genetics. 2018 Apr;208(4):1421-1441.
TB528 C. elegans ceh-14(ch3) X. Show Description
PHA and PHB dye-filling defect. About 50% athermotactic. ch3 deletes exon 3, causes frameshift and premature stop. [NOTE: Miyazaki, et al. (2022) report that this strain carries the fln-2(ot611) mutation in the background.]
TOG1 C. elegans mfsd-6(ogr1) III. Show Description
Slow growth, Slow movement. ogr1 is a 1.2 kb deletion causing a frameshift at residue 54 and premature stop at residue 83. Reference: Ogurusu T, et al. Biochem Biophys Res Commun. 2015 Aug 7;463(4):994-8. PMID: 26079877
TV28592 C. elegans bmdSi339 I; bmdSi297 II; arx-2(wy1814[arx-2::mIAA7::mNG]) qyIs225 V; lam-2(qy20[lam-2::mNG]) X. Show Description
bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. mNG tags inserted into endogenous arx-2 and lam-2 loci. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.
TV28593 C. elegans bmdSi339 I; bmdSi297 II; arx-2(wy1815[arx-2::AID::mNG]) qyIs225 V; lam-2(qy20[lam-2::mNG]) X. Show Description
bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. AID and mNG tags inserted into endogenous arx-2 locus. mNG tag inserted into endogenous lam-2 locus. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.
TX1246 C. elegans unc-119(ed3) III; teIs113. Show Description
teIs113 [pie-1p::GFP::H2B::zif-13'UTR 771bp + unc-119(+)]. A 771 bp genomic sequence downstream of the zif-1 stop codon (starting immediately after the stop codon) was cloned downstream of pie-1 promoter-driven GFP::H2B in the germline expression vector pID3.01B. Superficially wild-type. Reference: Oldenbroek M, et al. Dev Biol. 2012 Mar 15;363(2):388-98.
TX1377 C. elegans unc-119(ed3) III; teIs127. Show Description
teIs127 [pie-1p::GFP::H2B::mom-2 3'UTR + unc-119(+)] teIs127 construct includes a 557 bp genomic sequence beginning 100 bp upstream of the mom-2 stop codon was cloned downstream of pie-1 promoter-driven GFP::H2B. Superficially wild-type. Reference: Oldenbroek M, et al. Development. 2013 Nov;140(22):4614-23.
TX174 C. elegans oma-1(zu405te33) IV. Show Description
Dominant suppressor of zu405. Putative oma-1 null. [NOTE (09/2016; D. Greenstein, unpublished results): The two molecular changes in te33 are different than reported by Detwiler et al. (2001), but nonetheless result in a strong loss of oma-1 function. Sequencing of the original isolate of te33 gave the same result (S. Robertson and R. Lin, unpublished results).] This strain carrying oma-1(zu405te33) contains the following mutations: zu405 [C8889984T; P240L] and te33 [C8889978A, S238stop & C8889863T, H200Y].
TX183 C. elegans oma-1(zu405te33)/nT1 [unc-?(n754) let-?] IV; oma-2(te51)/nT1 V. Show Description
Heterozygotes are Unc and segregate Unc and non-Unc steriles (oma-1; oma-2 homozygotes). The Oma animal has an empty uterus and lots of oocytes in the gonad arms. Maintain by picking Uncs. zu405 is a gain-of-function mutation which results in temperature sensitive, embryonic lethality. Loss-of-function mutation in either oma-1 or oma-2 alone does not have a detectable phenotype. te33 is a dominant suppressor of the zu405 embryonic lethality. te51 is a mutation that, in the oma-1(zu405te33) background, gives an Oma (Ooctye Maturation defective) phenotype. [NOTE (09/2016; D. Greenstein, unpublished results): The two molecular changes in te33 are different than reported by Detwiler et al. (2001), but nonetheless result in a strong loss of oma-1 function. Sequencing of the original isolate of te33 gave the same result (S. Robertson and R. Lin, unpublished results).] This strain carrying oma-1(zu405te33) contains the following mutations: zu405 [C8889984T; P240L] and te33 [C8889978A, S238stop & C8889863T, H200Y].
UL2992 C. elegans leEx2992. Show Description
leEx2992 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL2994 C. elegans leEx2994. Show Description
leEx2994 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL2996 C. elegans leEx2996. Show Description
leEx2996 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL3294 C. elegans leEx3294. Show Description
leEx3294 [sir-2.1::mCherry + R11A8.5::GFP + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon and R11A8.5 with GFP inserted just before the STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL3295 C. elegans leEx3295. Show Description
leEx3295 [sir-2.1::mCherry + R11A8.5::GFP + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon and R11A8.5 with GFP inserted just before the STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL3351 C. elegans leEx3351. Show Description
leEx3351 [sir-2.1::mCherry + R11A8.5::GFP + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon and R11A8.5 with GFP inserted just before the STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UP2436 C. elegans lpr-1(cs207) I. Show Description
cs207 is an early nonsense allele (Q72stop). Approximately 90% rod-like larval lethal, with 10% normal escapers. Exact percentages are sensitive to temperature and culture conditions.
VC1228 C. elegans klp-11(tm324) IV. Show Description
331 bp deletion. T608 Stop. Flanking sequences: aaaatgagaaaaggaacaactgaattggac taatttttaaacacaaaacttactattgtt. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VF3 C. elegans hmt-1(gk161) III. Show Description
Hypersensitive to cadmium; refractile inclusions in intestinal cells on Cd plates. Maintain under normal conditions. 2,149 bp deletion encompasses exons 5, 6 & 7; introduces premature stop codon. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
VH1075 C. elegans rhIs4 hdIs26 III; fmi-1(rh308) V. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. hdIs26 [odr-2p::CFP + sra-6p::DsRed2] III. Ventral cord cross-over defects. PVQ axons sometimes stop short or leave the ventral cord. Reference: Steimel A, et al. Development. 2010 Nov;137(21):3663-73.
VH1565 C. elegans rhIs4 hdIs26 III; fmi-1(hd121) V. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. hdIs26 [odr-2p::CFP + sra-6p::DsRed2] III. Ventral cord cross-over defects. PVQ axons sometimes stop short or leave the ventral cord. Reference: Steimel A, et al. Development. 2010 Nov;137(21):3663-73.
WJA780 C. elegans unc-54(cc4092[unc-54::GFP::T2A::nonstop]) I.; nonu-1(srf780) III. Show Description
srf780 is a deletion of the Smr nuclease domain of nonu-1. Unc. GFP expression in body wall muscle. Reference: Glover ML, et al. Cell Rep. 2020 Mar 31;30(13):4321-4331.e4. doi: 10.1016/j.celrep.2020.03.023. PMID: 32234470.
XA4900 C. elegans rib-2(qa4900)/qC1 [dpy-19(e1259) glp-1(q339) III. Show Description
Heterozygotes are WT and segregate WT and Sterile Dpys. Homozygous rib-2(qa4900) animals give homozygous F2 animals that can develop to the adult stage but exhibit abnormal phenotypes such as egg-laying defects, increased body width, and reduced activity in movement. While the F2 qa4900 homozygotes are fertile, the F3 qa4900 homozygous progeny stop developing during gastrulation and fail to develop normally. 511 bp deletion in the region of intron2 to exon 6 of the rib-2 gene (K01G5.6).
YY186 C. elegans nrde-2(gg91) II. Show Description
T to A substitution at position 129 and Y to stop at position 24 in exon 2. Reference: GuangS, et al. Nature. 2010 Jun 24;465(7301):1097-101.
ZG31 C. elegans hif-1(ia4) V. Show Description
Healthy and fertile in standard lab conditions, but unable to adapt to 1% oxygen. When hif-1(+) animals are incubated in1% oxygen, >94% will complete embryogenesis and larval development. In contrast, hif-1(ia4) mutants exhibit 66% embryonic lethality and 9% larval lethality in 1% oxygen. The requirement of hif-1 is alleviated if the oxygen level is increased to 2%. The ia4 mutation is a 1231 bp deletion of the second, third, and fourth exons, which encode much of the helix-loop-helix and PAS domains. Analysis of ESTs suggests that there are at least 4 alternatively spliced hif-1 transcripts. The ia4 deletion introduces a frameshift and a premature stop in the three longest forms.
ZM10040 C. elegans hpIs721. Show Description
hpIs721 [rig-3p::FRT::Stop::FRT::snb-1::GFP + nmr-1p::FLP::FLP + myo-2p::RFP]. Transgenic animals have pharyngeal RFP expression and SNB-1::GFP expression in AVA (soma and along the VNC).
ZM10538 C. elegans hpIs774; hpEx4081. Show Description
hpIs774 [twk-40p(short)::GCaMP6s::mNeptune]. hpEx4081 [rig-3p::LoxP::eBFP::Stop::LoxP::gtACR2::wCherry + twk-40p(short)::Cre + myo-2p::RFP]. Pick RFP+ (pharynx) to maintain. Transgenic animals are GFP and RFP positive in multiple neurons in the head, but strong RFP signals in AVA neurite. Superficially wild type. Activation of gtACR2 decreases AVA and AVB’s calcium signals. hpEx4081 can be maintained by picking animals with weak pharyngeal RFP signals (seems to be a common artifact of the Cre-LoxP system).
ZM10755 C. elegans hpIs814. Show Description
hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA. Slow forward and backward movement, with reduced reversals.
ZM10786 C. elegans hpIs721; hpIs811. Show Description
hpIs721 [rig-3p::FRT::Stop::FRT::snb-1::GFP + nmr-1p::FLP::FLP + myo-2p::RFP]. hpIs811 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::Cherry + twk-40p(short)::Cre]. Transgenic animals have pharyngeal RFP signal; GFP puncta are visible in AVA soma but not along the VNC; RFP signals along AVA neurite.
ZM10806 C. elegans hpIs824. Show Description
hpIs824 [flp-18p::LoxP::eBFP::Stop::LoxP::gtACR2::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA soma and neurites of the VNC. Activation of gtACR2 inhibits both forward and backward movement.
ZM11034 C. elegans hpIs819; hpIs810. Show Description
hpIs819 [twk-40p(short)::GCaMP::T2A::NLS::mNeptune + lin-15(+)]. hpIs810 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Transgenic animals exhibit strong RFP signals in AVA soma and neurites; cytoplasmic GFP and RFP in AVA, AVE, AVB and some neurons in RVG and tail (DVA).
ZM11082 C. elegans twk-40(hp834) III; hpIs814. Show Description
hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA. twk-40(hp834) is a loss-of-function allele. twk-40(hp834) itself is highly loopy and a weak backward coiler. The presence of hpIs814 in the background reduces body bending and speed compared to twk-40(hp834) alone.
ZM11085 C. elegans hpIs814; hpEx4363. Show Description
hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. hpEx4363 [npr-4p::ins-22::pHluorin + myo-2p::wCherry]. Pick wCherry+ (pharynx) animals to maintain. Red fluorescence in AVA.
ZM11151 C. elegans hpIs758; hpIs814. Show Description
hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40p(short)::Cre + myo-2p::wCherry]. hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. RFP positive in AVA soma and neurite along the VNC. Weak pharyngeal RFP. Flat and slow movement without ATR or LED stimulation. Chrimson activation induces loopy reversal but not loopy forward after 5min.
ZM1385 C. elegans hpIs66. Show Description
hpIs66 [nab-1::GFP]. Reporter contains nab-1 genomic clone with 9 kb promoter sequence upstream of ATG, the entire nab-1 gene with GFP inserted immediately before the stop codon, and the 1 kb downstream sequence. Animals are slightly short with malformed tail in hermaphrodites. GFP localized in puncta at synapses in nerve cords and nerve ring. GFP localization also along the excretory canals, and some vulva expression. Reference: Hung W, et al. Development. 2007 Jan;134(2):237-49.
ZM6804 C. elegans hpIs270. Show Description
hpIs270 [rig-3p::FRT::stop::FRT::ChR2(H134R)::wCherry + nmr-1p::FLP + lin-15(+)]. ChR2 activation in AVA neurons upon exposure to blue light (470 nm). Slightly slow growth. Reference: Gao S, et al. eLife, 7, e29915. https://doi.org/10.7554/eLife.29915 PMID: 29360035
ZT3 C. elegans csr-1(fj54) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA.
ZT60 C. elegans csr-1(fj54)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Sterile csr-1 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Homologous pairing and unpaired silencing of meiotic chromosomes are inaccurate in this csr-1 null-mutant homozygotes. The fj54 deletion causes a frame-shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. The inversion-based balancer in ZT60 is more amenable to producing csr-1(fj54) homozygous males than a translocation-based balancer (ZT3). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT61 C. elegans vsra-1(tm1637) I; csr-1(fj54)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Sterile csr-1 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Homologous pairing and unpaired silencing of meiotic chromosomes are inaccurate in homozygous tm1637; fj54 double mutants. The vsra-1 mutation enhances the defects caused by the csr-1 mutation. The fj54 deletion causes a frame-shift to stop the translation of both PAZ and Piwi domains. tm1637 can be detected by PCR with the following primers: AAGCAGTTCTTCAAGACTGGTC and TTGTCCACTCGCACTTTGTG. The fj54 deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
CB1068 C. elegans unc-79(e1068) III. Show Description
Unc-fainter. Stops. Stiff anterior.
CB1272 C. elegans unc-80(e1272) V. Show Description
Unc-fainter: stops. M-MATING+++ 10-30%WT.
CB1291 C. elegans unc-79(e1291) III. Show Description
Unc-fainter: stops.
EEG107 C.elegans tph-1(mg280) II; mudIs1. Show Description
mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. When tph-1 mutants carrying mudIs1 are exposed to blue light, the worms continue to move rather than stopping like wild-type animals. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.
MOS370 C. elegans him-5(e1490) V; lite-1(ce314) X; fsIs22; ljIs114. Show Description
fsIs22 [osm-5p::fem-3::mCherry + unc-122p::GFP]. ljIs114 [gpa-13p?FLPase + sra-6p?FRT::mCherry::StopCodon::FRT?ChR2?YFP]. Him. Pan-ciliated masculinization with ChR2 specifically in ASH. Reference: Pechuk V., et al. 2022, Current Biology 32, 1–14. https://doi.org/10.1016/j.cub.2022.08.038
MOS88 C. elegans him-5(e1490) V; etyIs1. Show Description
etyIs1 [gpa-13p::FLPase + sra-6p::FRT::mCherry::StopCodon::FRT::GCaMP6s]. Him. Integrated ASH-specific calcium sensor transgene. Reference: Pechuk V., et al. 2022, Current Biology 32, 1–14. https://doi.org/10.1016/j.cub.2022.08.038
NL4807 C. elegans unc-119(ed3) III; pkIs2170 X. Show Description
pkIs2170 [hsp-16.41::ATG-LacZ(first 251nt)-I-Sce-I site-stops-LacZ + unc-119(+)]. Reference: Pontier DB &Tijsterman M. Nat Methods. 2009 Sep;6(9):655-7.
TBD307 C.elegans dhc-1(he255[epdz::mCherry::dhc-1]) I; utdSi51 II. Show Description
utdSi51[mex-5p::tomm-20(aa 1-55)::halotag::lov::tbb-2 3’UTR] II. Maintain at 23C and protect from light. Strain is sickly, seems to grow best and lay more eggs at 23C. Upon stimulation with 488nm light, the LOV-ePDZ optogenetic system will recruit mitochondria to the dynein heavy chain in the worm embryo. Embryonic cell divisions can be stopped by if mitochondrial recruitment is stimulated in early development. Room light can also induce mitochondria re-localization and cause infertility; store this strain in the dark. Reference: Fan X, et al. G3 (accepted).
XF86 C. elegans unc-119(ed3) III; pkIs2379 pkIs2170. Show Description
pkIs2170 [hsp-16.41::ATG-LacZ(first 251nt)-I-Sce-I site-stops-LacZ + unc-119(+)]. pkIs2379 [hsp-16.41::I-Sce-I ORF + rol-6(su1006)]. Reference: Pontier DB &Tijsterman M. Nat Methods. 2009 Sep;6(9):655-7.